Ryan Reynolds
Appearances
20/20
True Crime Vault: The DNA Detective
She calls reporter Barbara Hoffroda to give one final newspaper interview pleading for answers.
20/20
True Crime Vault: The DNA Detective
amazingly the young student who lived through the trauma of losing her teacher good evening is now all grown up and a reporter covering the cold case this is the school where christy marack or miss marack as she was known to her students never showed up the day she was murdered she says her teacher's murder influenced her decision to become a reporter i think her death really did shape a lot of us in ways that we didn't even know
20/20
True Crime Vault: The DNA Detective
Well, my mouth drops open. It took you just a couple of days to find a real, serious tip.
20/20
True Crime Vault: The DNA Detective
Trying to keep his sister's case front and center, Vince leases a giant billboard next to the highway.
20/20
True Crime Vault: The DNA Detective
Flash forward, two decades after the murder, District Attorney Craig Stedman's office takes over the cold case.
20/20
True Crime Vault: The DNA Detective
Coming up, a DNA revolution allows them to stare into the face of a killer. What was it like to look at a sketch of a person who potentially raped and murdered your sister? And a break in another famous cold case would lead to a breakthrough in this one.
20/20
True Crime Vault: The DNA Detective
Across the country in California, a former actress and singer is also watching with keen interest.
20/20
True Crime Vault: The DNA Detective
Her name is Cece Moore, and she is now a genetic genealogist.
20/20
True Crime Vault: The DNA Detective
Cece helps foundlings, babies abandoned at birth, and adoptees find their biological parents.
20/20
True Crime Vault: The DNA Detective
Making family connections never thought possible. I love you like my little girl. Moore got hooked on genealogy when she researched her own family years ago. And although she didn't break the Golden State Killer case... Give it up for CeCe Moore. Her groundbreaking methods helped. She has received international recognition for her pioneering techniques.
20/20
True Crime Vault: The DNA Detective
Moore has always known that she could use her genetic genealogy skills to catch criminals, but she was reluctant.
20/20
True Crime Vault: The DNA Detective
And she is now teaming up with a company called Parabon Nanolabs, who is already familiar with the Merak cold case.
20/20
True Crime Vault: The DNA Detective
In 2017, the Lancaster District Attorney connects with Parabon Nanolabs, who are able to use an innovative technique to create a rendering of the suspect using DNA found at the crime scene. Months later, the composite is released to the public.
20/20
True Crime Vault: The DNA Detective
What was it like to look at a sketch of a person who could potentially rape and murder your sister?
20/20
True Crime Vault: The DNA Detective
Ultimately, the sketch doesn't shake loose any viable leads. But now, Parabon has their new secret weapon. Cece Moore. Could this DNA detective help catch Christy Murak's killer?
20/20
True Crime Vault: The DNA Detective
In the Merak case, there was DNA found both on the carpet and Christy's body. Cece Moore and Parabon convert that DNA into a data file and upload it to a free, no-frills genealogy website called GEDmatch, designed to find genetic relatives.
20/20
True Crime Vault: The DNA Detective
They get a hit. The DNA file matches up with several distant family members of the killer.
20/20
True Crime Vault: The DNA Detective
Cece narrows her search down to a target family in Lancaster of Northern European descent.
20/20
True Crime Vault: The DNA Detective
She also notices that the suspect has some Latin American heritage.
20/20
True Crime Vault: The DNA Detective
How long did it take you from the time you started working on this case to find that person?
20/20
True Crime Vault: The DNA Detective
Well, my mouth drops open because this is a case that went unsolved for over 25 years, and it took you just a couple of days to find a real serious tip.
20/20
True Crime Vault: The DNA Detective
Now it's up to law enforcement to confirm CeCe's findings by obtaining DNA from the possible suspect and matching it to that DNA from the crime scene.
20/20
True Crime Vault: The DNA Detective
Lancaster, Pennsylvania. A popular destination wedding location. Attracting families from surrounding states for the beautiful venues, food, and flowers. But is it also possible that one of these wedding professionals, responsible for creating people's most cherished moments, is also responsible for a brutal murder two and a half decades earlier?
20/20
True Crime Vault: The DNA Detective
An undercover unit begins to stake out the suspect, trailing him as he enters this elementary school. They sit and wait for their moment.
20/20
True Crime Vault: The DNA Detective
DNA from that water bottle and chewing gum is rushed to the crime lab. After 25 years... Police think they have their man.
20/20
True Crime Vault: The DNA Detective
When we come back, an arrest that would stun Lancaster. The alleged perpetrator had been hiding in plain sight.
20/20
True Crime Vault: The DNA Detective
On June 25th, 2018, Lancaster District Attorney Craig Stedman calls reporters together for a late afternoon press conference. But he doesn't tell them why.
20/20
True Crime Vault: The DNA Detective
Unbeknownst to reporters, hours earlier, the man police believe savagely murdered Christy Murak and eluded law enforcement for 26 years was arrested. Tell me what it was like when you got the call from the DA.
20/20
True Crime Vault: The DNA Detective
Vince immediately jumps in his car to make the two-hour drive to Lancaster for the press conference.
20/20
True Crime Vault: The DNA Detective
The man police have charged with criminal homicide is Raymond Rowe. And now, looking at that Parabon sketch created from the DNA at the crime scene, a chilling resemblance.
20/20
True Crime Vault: The DNA Detective
Most people know Raymond Rowe by a different name in this community, DJ Freeze.
20/20
True Crime Vault: The DNA Detective
DJ Freeze was many things in the Lancaster community. A renowned DJ, a business owner, a father, husband, and churchgoer. But now, a new adjective was being used to describe him. Murder suspect. He was one of the most sought after wedding DJs. This ad touts him as the best in Lancaster.
20/20
True Crime Vault: The DNA Detective
Derek Diener has filmed numerous weddings where Raymond Rowe was the DJ.
20/20
True Crime Vault: The DNA Detective
DJ Freeze has been a fixture in this city since his late teens. He started making a name for himself breakdancing, which he spoke about in this documentary.
20/20
True Crime Vault: The DNA Detective
The Chameleon Club, Lancaster's nationally renowned live music venue. In the late 1990s, he was the house DJ there. And also an advocate against violence, which now in hindsight has people's jaws dropping.
20/20
True Crime Vault: The DNA Detective
This story does not begin at a wedding, but during another time of anticipation and excitement, days before Christmas 1992.
20/20
True Crime Vault: The DNA Detective
Roe, the man accused of committing the Christmastime murder, comes across as quite the family man on this Christmas card of his own.
20/20
True Crime Vault: The DNA Detective
How is it possible this successful business and family man allegedly committed this horrific crime?
20/20
True Crime Vault: The DNA Detective
This is horrible. Christy Merak, seen here in her yearbook photo, grew up in Pennsylvania, in cold country, the middle child of a close-knit family and older sister to Vince. What was she like as a sister?
20/20
True Crime Vault: The DNA Detective
Lancaster, Pennsylvania, a city coming to grips with the realization that the man accused of the horrific rape and murder of Christy Murack has been living among them.
20/20
True Crime Vault: The DNA Detective
He had played at their weddings, their kids' elementary school parties, their high school graduation dances.
20/20
True Crime Vault: The DNA Detective
Nobody saw that coming. When you started learning more about what his life was like, what was your reaction?
20/20
True Crime Vault: The DNA Detective
The other part of this that strikes me as ironic is he spent all this time in the middle of people's celebration of the milestones of their life. And yet, if he is the person that did this, he didn't give Christy that same chance.
20/20
True Crime Vault: The DNA Detective
For that tight-knit professional wedding community, it is utter disbelief. The DJ and friend they had been working side by side with is now being charged with criminal homicide.
20/20
True Crime Vault: The DNA Detective
Emily Noble dated Raymond Rowe in 1996, four years after the murder of Christy, while they both worked at the Chameleon Club. Noble looking eerily similar to Merak.
20/20
True Crime Vault: The DNA Detective
The two shared a love of rap music. A favorite, the Sugar Hill Gang. One of the soundtracks for their courtship.
20/20
True Crime Vault: The DNA Detective
Although Emily said he wasn't violent, he became controlling and emotionally abusive.
20/20
True Crime Vault: The DNA Detective
Emily says Roe hated that she smoked and once caught her sneaking a cigarette.
20/20
True Crime Vault: The DNA Detective
Emily says during an outing at Red Lobster, celebrating Mother's Day with Ro's mother and his daughter, she showed up in an outfit that set him off.
20/20
True Crime Vault: The DNA Detective
Eventually, Emily moved away to New Mexico. And when she got the call that Roe had been arrested decades after the relationship, it gave her chills.
20/20
True Crime Vault: The DNA Detective
So was there a relationship between Christy Murack and Raymond Roe? It's a mystery everyone is trying to unwind. Do you think she knew Raymond Roe?
20/20
True Crime Vault: The DNA Detective
Investigators hope they will be able to piece together the connection before trial. But even if they can't, they are feeling extremely confident about the DNA evidence.
20/20
True Crime Vault: The DNA Detective
Roe is being held without bail. His lawyer did not return 2020's calls asking for comment. CeCe Moore says cases like this should put potential criminals on notice.
20/20
True Crime Vault: The DNA Detective
Coming up next, an emotional surprise for the victim's brother, Vince.
20/20
True Crime Vault: The DNA Detective
It's been an arduous 26-year journey for Vince Merak. That's 26 Christmases, 26 birthdays, and hundreds of other life milestones without his radiant sister by his side. No matter what happens at the trial, nothing will erase that heartbreak.
20/20
True Crime Vault: The DNA Detective
Today, Vince is getting the chance to meet that woman whose tireless determination led to the arrest in Christy's case and provided him with a small measure of relief after all these years. Cece Moore.
20/20
True Crime Vault: The DNA Detective
That's Christy on the right, next to Annie. By December of 1992, she was living in Lancaster, Pennsylvania.
20/20
True Crime Vault: The DNA Detective
And that is exactly why CeCe and Parabon will continue to use genetic genealogy on other cold cases.
20/20
True Crime Vault: The DNA Detective
Her work with Parabon has already led to breaks in 10 other cold cases, one just earlier today.
20/20
True Crime Vault: The DNA Detective
And Vince has a message for those families out there searching for those answers who may be losing faith.
20/20
True Crime Vault: The DNA Detective
Teaching sixth grade at Roristown Elementary School, Principal Harry Goodman hired her.
20/20
True Crime Vault: The DNA Detective
December 18th, Christy has dinner with her brother Vince. It would be the last time he would see her.
20/20
True Crime Vault: The DNA Detective
The evening of December 20th, Christy is at home preparing for the holiday, wrapping copies of the book Miracles on Maple Hill for each of her 24 students. She wrote a message to them.
20/20
True Crime Vault: The DNA Detective
The next morning is a chilly one with temperatures below freezing. Christy is up before sunrise.
20/20
True Crime Vault: The DNA Detective
Her roommate leaves first at 7 a.m. Christy would usually leave shortly after by 7.45. But on this morning, she did not. In the next 45 minutes, something unspeakable would happen.
20/20
True Crime Vault: The DNA Detective
Over at Christy's school, Principal Goodman gets worried when she doesn't show up to her classroom.
20/20
True Crime Vault: The DNA Detective
When he walks up, he's horrified by the scene in the living room.
20/20
True Crime Vault: The DNA Detective
Joseph Maddenspacher is the Lancaster District Attorney in 1992.
20/20
True Crime Vault: The DNA Detective
Officers begin to piece together what has just taken place. A horrific scene. Christy dead on the floor. Her head beaten. Her jaw broken. She had been raped and strangled.
20/20
True Crime Vault: The DNA Detective
It is immediately clear to investigators that Christy was in a violent struggle for her life.
20/20
True Crime Vault: The DNA Detective
In that scene of destruction, police are able to collect multiple samples of the killer's DNA. And those Christmas presents she had so meticulously wrapped the night before are now strewn about the apartment.
20/20
True Crime Vault: The DNA Detective
At Christie's school, a classroom full of students is wondering why their teacher never showed up. Assistant Superintendent Bob Wildeson is there.
20/20
True Crime Vault: The DNA Detective
When 12-year-old Christina Butler gets off the bus that afternoon, her mother is waiting to break the news.
20/20
True Crime Vault: The DNA Detective
Who would do this? Still ahead, a disturbing visit the next day from a mystery man looking for Christy at school.
20/20
True Crime Vault: The DNA Detective
Drive a few miles out of downtown Lancaster, Pennsylvania, and you will find some of the most bucolic farmland in the country.
20/20
True Crime Vault: The DNA Detective
That sense of safety is shattered by the murder of 25-year-old schoolteacher Christy Murack just four days before Christmas in 1992. Her family is now planning her funeral. I understand that a priest at one point told you not to look at her.
20/20
True Crime Vault: The DNA Detective
I understand that a priest at one point told you not to look at her.
20/20
True Crime Vault: The DNA Detective
The day after Christy Murack's murder, teachers and students are mourning.
20/20
True Crime Vault: The DNA Detective
Her principal is grief-stricken, but he's also under suspicion.
20/20
True Crime Vault: The DNA Detective
As police launch their investigation, a suspicious visitor shows up at Christy's school, carrying flowers and heading for her classroom.
20/20
True Crime Vault: The DNA Detective
The assistant superintendent escorts him from the building and calls police. The visit seems even more suspicious the next day when the man calls Wilderson at home.
20/20
True Crime Vault: The DNA Detective
The man turns out to be Christy's secret boyfriend, 20 years her senior and married.
20/20
True Crime Vault: The DNA Detective
Those close to Christy are convinced her killer must be someone she knows. She never would have opened the door to a stranger. I understand that she was a stickler for safety.
20/20
True Crime Vault: The DNA Detective
Police run the DNA found at the crime scene through the National Law Enforcement Database. but there is no match. Investigators begin reading through everyone she knows.
20/20
True Crime Vault: The DNA Detective
Ultimately, both Principal Goodman and Christy's married boyfriend provide airtight alibis and are cleared. The suspect list grows shorter and shorter.
20/20
True Crime Vault: Overboard
I was concerned the day before Thanksgiving when I haven't heard from him.
20/20
True Crime Vault: Overboard
You guys were great. Now the problem is, Skylar could never remember his lines. And his dad would yell at him on the set until the producers were basically like, get that guy out of here. He's really, he's upsetting Skylar, he's upsetting everyone else. And Skylar hated acting.
20/20
True Crime Vault: Overboard
When he got out of the Marines, he wanted to change his name to Skyler DeLeon. On the paperwork, it says he doesn't want to be associated by the same name as his father because his father is a bad person and a criminal. It was right before he met Jennifer that he changed his name.
20/20
True Crime Vault: Overboard
According to Jennifer's mother, she thinks that they got pregnant on their wedding night because the timing of it was just so. So, yeah, they had a little girl, Haley, and then they got pregnant again.
20/20
True Crime Vault: Overboard
And they're expecting it to be Skyler. And they know what Skyler looks like because he's got a record and he's in the database, but it's not Skyler.
20/20
True Crime Vault: Overboard
He grew up on a farm with a brother, Jim Hawks. They liked to go surfing. They liked to go sailing.
20/20
True Crime Vault: Overboard
Who would come up with a story that they used money laundered drug money to buy a boat unless it was really true?
20/20
True Crime Vault: Overboard
This transaction allegedly occurred in the parking lot at the 15th Street dock, basically on the trunk of the car with a suitcase full of money.
20/20
True Crime Vault: Overboard
He became a probation officer. His brother became a police officer and then later a police chief. So he came from a law enforcement family.
20/20
True Crime Vault: Overboard
How close were you guys growing up even? Very close. My parents divorced when I was probably like five. He pretty much raised me all the way to adulthood and made me who I am today.
20/20
True Crime Vault: Overboard
The biggest thing that we can do as a family was to reach out in the media and find someone maybe willing to talk, someone that maybe seen them, know of their last location, know about their safety. You know, I think something's wrong. I think something's missing. I think something's really wrong. But my first priority is to find about the whereabouts of my parents.
20/20
True Crime Vault: Overboard
The biggest thing was their car, and if we could find their car, we know we could kind of backtrace their steps or what happened to them.
20/20
True Crime Vault: Overboard
The next day, the police department gets a call from this woman who had seen the show. And she basically said, I'm looking at this car right now. I live in Mexico, and I'm in a trailer park, and it's in the parking lot.
20/20
True Crime Vault: Overboard
They had a lot of friends, 150 people at their wedding. The boys called her mom, even though their mother was still alive.
20/20
True Crime Vault: Overboard
They called me on their way up. It's like, yeah, we got it on the back of a flatbed truck. And that was a key person.
20/20
True Crime Vault: Overboard
They realized that Skyler DeLeon and Jennifer, who was also described, had been down there. They had now witnesses who knew them, and they said, they gave us this car.
20/20
True Crime Vault: Overboard
I was about 99% sure that my parents were murdered. But I still had 1% hope. But when they found that car, that 1% was wiped out.
20/20
True Crime Vault: Overboard
The baby suddenly spits up all over him, and so it interrupts the interview.
20/20
True Crime Vault: Overboard
They get Skyler out of the house and arrest him, and they go inside.
20/20
True Crime Vault: Overboard
I love how they play with the boats. The well-deserved is a 55-foot trawler. It's kind of a smaller yacht, but you can live on it.
20/20
True Crime Vault: Overboard
They put in a lot of up-to-date equipment, the GPS system, and all kinds of other stuff that really made it nice.
20/20
True Crime Vault: Overboard
And she finally says, no, we were not. in the parking lot, like I said before.
20/20
True Crime Vault: Overboard
My stepmother definitely fell hook, line, and sinker for that woman and her baby.
20/20
True Crime Vault: Overboard
Meanwhile, Skyler, he's upsetting the GPS to go out to the deepest point in the ocean. It's 3,500 feet. It's the deepest place.
20/20
True Crime Vault: Overboard
The weight of the anchor, it goes tight. And suddenly, they're being pulled across the deck. Jackie's head knocks into the side. Boom, you can hear it.
20/20
True Crime Vault: Overboard
The weight of the anchor pulls them down to the bottom of the deepest part of the sea.
20/20
True Crime Vault: Overboard
She had a chance to save herself, and she chose to stick by Skylar.
20/20
True Crime Vault: Overboard
Although her family suffers because she's loved, they'll still get a chance to see her say their last words and say their thoughts. They'll be seeing her through plexiglass. But you know, to see my parents, I have to look through 3,600 of the cold Pacific Ocean.
20/20
True Crime Vault: Overboard
I want him to know that I'm there. I want him to realize, you know, this is what he took from me and the rest of my family.
20/20
True Crime Vault: Overboard
It's a big relief. We've been waiting for this for a very long time.
20/20
True Crime Vault: Overboard
Skylar has finally, I think, become the person that she has always wanted to be.
20/20
True Crime Vault: Overboard
Skylar has finally, I think, become the person that she has always wanted to be. Schuyler is now legally a woman. She has filed court papers and she has changed her name from Schuyler Julius de Leon to Schuyler Preciosa de Leon.
20/20
True Crime Vault: Overboard
Over time, he was growing more and more effeminate looking. He asked for female underwear and a bra. And eventually, as the criminal justice system has been kind of changing with the culture, he She was allowed to start wearing those things. And she wants to be called a she.
20/20
True Crime Vault: Overboard
take advantage of the system to get some sort of benefit that they think they deserve, we are sending the wrong message.
20/20
True Crime Vault: Overboard
They went on one last trip to Catalina Island. Jim Hawks, Tom's brother, brought his boat, and they all had this little party.
20/20
True Crime Vault: Overboard
Next thing you know is no one can get a hold of them. For them just to shut off their cell phones and drop off the face of the earth is extremely out of character.
20/20
True Crime Vault: Overboard
My uncle knew something was wrong right away. Your dad didn't tie the dinghy, your dad didn't lift the motor down.
20/20
True Crime Vault: Overboard
They were excited. They thought we got a buyer. You know, we've got someone. We're going to sell this boat.
20/20
True Crime Vault: Overboard
Jennifer says, we don't know where the hawks are and we still wanted to find out where they are because we still need some information about how to use this boat that we now have. We bought the boat, they drove away. You know, we haven't heard from them and we don't know where they are either.
20/20
True Crime Vault: Overboard
Sergeant Dave Byington, he sends out a detective to go out to the boat. And so the guy gets to the boat, and he's looking around, and he sees this receipt. on the floor.
20/20
True Crime Vault: The Sinfluencer of Soho
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
20/20
True Crime Vault: The Sinfluencer of Soho
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
20/20
Death in the Dorms Season 2: Episode 2: Haley Anderson
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
20/20
'Radioactive' - Ep. 5: The Phantom Vehicle
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
20/20
'Radioactive' - Ep. 5: The Phantom Vehicle
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
20/20
Dirty Little Secret
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
20/20
Dirty Little Secret
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
20/20
'The King Road Killings': 911 Call Released
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
20/20
Small Town, Big Con
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
20/20
Bad Romance: Doomsday's Bride
You're telling me that Tylee took JJ's life and then took her own life? On accident.
20/20
Bad Romance: Doomsday's Bride
Hi, who are you? Okay, just stand over there for just a second, guys.
20/20
The Last Text
I observed him, what appeared to be cleaning his vehicle, the interior and exterior.
20/20
Mountain of Lies
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
20/20
Mountain of Lies
A Highlands ranch man already being investigated for murdering his first wife, arrested today accused of murdering his second wife.
20/20
The After Show: Bad Romance
All the time. All the time. And it's exactly what we're talking about. It's this idea of can't you just handle something differently? Like in this case, this was a man who was engaged to one woman and then ended up connecting with another woman who we end up speaking to in the episode. And so he tries to then break it off with the first woman.
20/20
The After Show: Bad Romance
But instead, it kind of gets out of control and things happen. Part of his story is it went beyond what I thought it was going to happen. But there are so many different ways to handle these issues. But I come back to the same thing we talked about before. When emotion and passion and love are involved, all bets are off.
20/20
The After Show: Bad Romance
And I can't tell you... I know I keep saying this, that people stop me and ask me about these episodes. But the other thing people say is... You know, why don't people just think it through more? Why would you do it that way? Because when you're in a situation like this and there is so much passion and so much emotion, you are not thinking clearly by default.
20/20
The After Show: Bad Romance
Think about all the times when you've been in love. I could tell you, at least for me, when I've been in love, like I would love to sit up here and say the only time I've been in love was with my wife. But there were times before.
20/20
The After Show: Bad Romance
We'll buy that. Maybe once or twice. Only once. But when I was in those situations, I can look back and say, why did I do that? Why did I do this? And I think these cases that we cover, it's that times 100. It's emotions or anger or different things coming in times 100. And when that happens... All the things that make sense go right out the window.
20/20
The After Show: Bad Romance
That information, that important clue, it stands out to me so much about this episode because the worst part of cases like this that we cover, at least I think, are the ones that involve children. And when you have a child, I always like to tell people, cases like this, they don't happen and then investigators research it for a week and then the case is solved in two weeks.
20/20
The After Show: Bad Romance
Yeah, exactly. It takes years, courtrooms, the little child having to tell the story probably several times. and all the trauma that she's gone through in all of this. And that's what's so harrowing about this story, Deborah, that you did.
20/20
The After Show: Bad Romance
I really want people to see it because I want them to understand not only the effect of a case like this and how the emotions and the love of a situation can make things turn so wrong, but also the involvement of children in some of this.
20/20
The After Show: Bad Romance
And when we feel it, Deborah, it can make us do things that are unexpected and that make us go beyond what we would normally do. I can't tell you how many people who watch Bad Romance, they stop me on the street and say, oh, I saw this show you guys did on Bad Romance. They tell me about a particular show, and then they say something to the effect of,
20/20
The After Show: Bad Romance
Yes. The reason you're doing this podcast is so helpful for a lot of people because what they do is they see our stories and then they want to say, I saw it and you helped tell it. So you got to tell me more. And so I'm like, OK, so this and that. And then we go through it and then they want to dissect it. They want to know more behind the scenes. Exactly.
20/20
The After Show: Bad Romance
So they're going to love this because they want to know as much as they can about the stories. And that's what makes this work so powerful, I think, Deborah. I don't know how you feel about it, but it's true crime for a reason. Crime that we watch on TV, CSI, things like that. Those are interesting.
20/20
The After Show: Bad Romance
But when it actually happened in real life, you almost can't believe it happened and you want to know more.
20/20
The After Show: Bad Romance
I feel the same way. For all these interviews, especially when we're dealing with people who've lost someone, I try to look at it first like I'm trying to honor them first. So, for example, if I'm interviewing someone who's lost a loved one, I want them to be able to tell the story of their loved one. And what I do a lot of times is I'll stop if they feel and I'll try to say, are you okay?
20/20
The After Show: Bad Romance
Do you want to share more? How do you feel? I understand that we have a desire to tell as much of the story as we can, but I also feel like it's their story to tell. So for me, I always take it from a place of how can we help you best express what you feel about what happened?
20/20
The After Show: Bad Romance
I love that. And I love it when people, a lot of sometimes people say to me, hey, thank you for doing it that way. And that really makes me feel good. If they can feel at the end of it, some good has come out of this for them, then I feel like I've done what I'm supposed to do.
20/20
The After Show: Bad Romance
You know, I could see why maybe they felt that way, but why would they go here? And I always tell them, think about the first thing you just said. You can see why they felt that way. So many of the stories we cover are about people who are in a relationship or trying to hide something in a relationship to maintain another relationship.
20/20
The After Show: Bad Romance
One that really stands out to me is this story called Doomsday Bride. It's a case that a lot of people may know of, a woman named Lori Vallow Daybell. She was involved with a man, Chad Daybell. This was a very big story for a very long time. She's in a relationship, and it's sort of a twisted story. She uprooted her life to be with Chad, and Chad is this doomsday preacher.
20/20
The After Show: Bad Romance
He talks about the end of times, and Lori becomes a believer herself, and then her children go missing. So Lori recently faced a new charge in Arizona, and she was found guilty of conspiracy to commit murder for the death of her fourth husband, Charles Vallow. She served as her own attorney in that case.
20/20
The After Show: Bad Romance
I do, I do. It's one of the things I think works when I do these interviews and when I talk to people, just using my legal mind, how a case comes together, how evidence comes together to help them tell their stories.
20/20
The After Show: Bad Romance
all these different emotions surrounding love that make people do things. And what I try to tell people is the reason I think people connect with a lot of these stories is because they can see parts of themselves in those stories, not in terms of the crime committed, but in terms of the emotions involved and why people end up feeling the way they're feeling.
20/20
The After Show: Bad Romance
The only difference in many of our stories is people take it too far. And one thing I like to tell people about these stories is a lot of times these cases are not often cases with people with long criminal records, with previous crimes. Oftentimes no records. Exactly. Oftentimes no records.
20/20
The After Show: Bad Romance
So you're talking about heat of passion situations, situations where people's emotions, because of love, drove them to do something that was really beyond their normal behavior.
20/20
The After Show: Bad Romance
It's interesting that you talk about this. One thing that shocked me when I first started working on 2020s was how many of these cases involve people who are living double lives, as we call them, or have a relationship in one spot and then another relationship somewhere else. That's the motive a lot of times. Sometimes it deals—our episodes deal with— Custody issues can be the motive.
20/20
The After Show: Bad Romance
Other times it can be control issues can be the motive. Somebody didn't do what I wanted and I wanted them to change their behavior. So now I'm taking this action. But it all still comes back to the basic human feelings that we have. Just these are those feelings that are far beyond the pale. So for example, we have an episode that involves a custody situation.
20/20
The After Show: Bad Romance
And in that particular situation, you would argue, well, there's so many ways to handle that. But sometimes people feel it's gotten out of control. and that there's no other way to do anything except take this extreme action. So the motives can be all over the place.
20/20
The After Show: Bad Romance
Wow. Right? Wow. Yeah. First of all, I can't believe she said yes, but then also, I'm not only registering the shock from her, but the shock in your voice as you're going through it. Yeah.
20/20
The After Show: Bad Romance
I mean, and I also like the fact that you talk about this idea, because a lot of people ask me about this as well, that how could this person not have known? How could you not know? I mean, this is your husband, your spouse. And then they try to make, I think in many ways, judgments on the relationship. I'm not trying to say that everybody should or should not know in different situations.
20/20
The After Show: Bad Romance
I'm just saying like, I think sometimes what I've learned a lot of times, Debra, from these stories is you have no idea the lengths that people sometimes go to try to cover something that's going on in their lives. And sometimes when that happens, it can be extremely difficult for people to know what's happening.
20/20
The After Show: Bad Romance
Wow, I can't believe that. Now them hearing that firsthand, standing right there with you, I can't believe that. Just in real time, they're like, oh my goodness, that job that canceled on us was this woman.
20/20
The After Show: Bad Romance
I have never had that happen. Somebody on the set who was in some way connected to what happened. I've never had that happen. But that is that is remarkable.
20/20
The After Show: Bad Romance
Yeah, it was so strange, this case. He was writing them to cover his tracks. But this case was a really strange one in that when you talk about David Hoshaw, he actually initially had an alibi. in this situation. So as time went by, though, he felt the need to kind of cover his tracks. So he writes these letters sort of baiting police, trying to throw police off.
20/20
The After Show: Bad Romance
But what he didn't plan on, and I think people are really going to find this interesting when they watch the episodes, are that his cell phone records and his credit card receipts ended up putting him in the vicinity of some of the postmarks on the letters. That ended up connecting officers and investigators to him. He was with one woman.
20/20
The After Show: Bad Romance
He was trying to get married to her, but then met someone else and trying to break it off. If he would have handled it differently, maybe it would have ended differently. But even in the aftermath of the killing, his behavior with the letters and the different things he wrote kind of reminds you of a movie, right? Somebody sending these letters, please come and get me. What are you going to do?
20/20
The After Show: Bad Romance
He's trying to throw them off. And what he did was essentially give himself up.
48 Hours
Anchors Away
I couldn't pitch with my father or anyone else or Jackie with anyone else. Jackie's coming today. Got the boat all cleaned up.
48 Hours
Anchors Away
She couldn't stop crying. She was yelling at Skyler, saying, you this, you that. You took your baby daughter and your wife on our boat. How could you?
48 Hours
Anchors Away
Ich glaube, das Einzige, was mein Vater bewegen konnte, waren seine Hände. Er hat mir die Hände von Jackie gestolpert, um ihr ein bisschen Ruhigkeit zu geben.
48 Hours
Anchors Away
Er hat das Geräusch hundertmal gehört, und er hat gesagt, du Arschloch, sie werden uns nicht verlassen.
48 Hours
Anchors Away
So that's where they are right now. They're 3,600 feet below the cold Pacific Ocean, tied to an anchor.
48 Hours
Anchors Away
Ich habe zuerst meinen Vater angerufen. Dann habe ich Jackie angerufen. Und er hat nie von ihrem Telefon gesprochen. Was ging dir in den Kopf? Ich dachte, es wäre eine letzte-minütige Reise. Ich habe mit meinem Onkel Jim gesprochen. Er ist der Vertreter der Polizei Karlsbad.
48 Hours
Anchors Away
Das musste geschlossen werden. Mein Vater hat mich angerufen und gesagt, dein Vodafone ging in den E-Mail. Das ist wirklich seltsam. Mein Vater ist der Art von Mann, dem man einen Wagen anbauen kann. Ich habe meinen Bruder angerufen und gefragt, was ist denn los, Matt?
48 Hours
Anchors Away
Ich habe Schmerzen. Du würdest nicht denken, dass so etwas jemals passieren könnte.
48 Hours
Anchors Away
Es war nicht ein gutes Gefühl oder aufregend. Es war traurig, weil es alles vorbei war und meine Eltern immer noch nicht da waren. Ich werde niemals die Chance haben, sie zu töten. Ich werde niemals die Chance haben, sie zu verabschieden. Und das macht mich schmerzhaft.
48 Hours
Anchors Away
He was a man's man. He was very masculine, very outdoors. Tom's boys, Ryan and Matt.
48 Hours
Anchors Away
He would take us to Catalina Island. Do a lot of hiking. Some of my better times with him were on the water.
48 Hours
Anchors Away
You know, stay strong. I remember if I wrecked or cried as a little kid, he'd be like, toughen up, boy, toughen up, come on, come on.
48 Hours
Anchors Away
Tom war der Art Probation-Officer, der einen echten Interesse auf die Probleme hatte, die seine Probationer hatten.
48 Hours
Anchors Away
Tom war ein guter Mann. Ich glaube, dass Toms Familienleben, wie die meisten von uns, sehr wichtig war für ihn.
48 Hours
Anchors Away
Ich erinnere mich, er nennt es seinen berühmten Gulasch. Er machte einen Pott davon für etwa eine Woche. Und jedes Mal, wenn wir zum Abendessen kamen, war er so, äh, wirklich, das wieder?
48 Hours
Anchors Away
Jackie, she's a real trooper. Most of the time when they do something, it's my father's idea. And Jackie never complains and she just goes with it.
48 Hours
Anchors Away
Toms Ziel im Leben war es, auf dem Meer zu wohnen, auf einem Fahrrad zu leben. Er sagte, das Leben ist zu kurz und es ist mein Leben und das ist unser Zeitpunkt. Und ich fühle, wenn ich versuche, wird es einfach gehen und ich werde es verpassen.
48 Hours
Anchors Away
Ich würde am Arbeitstag sitzen, und ich würde E-Mails bekommen, wie, die Wasser ist 80 Grad, die Surfen pumpen, und Mama macht mich zum Abendessen. Und ich bin so, pff, das ist hart. Und da ist der Sonnenschein.
48 Hours
Anchors Away
Für sie war das Wasser eine Seltsamkeit. Es war, die Kurve der Erde zu sehen und die Sonne, die jede Nacht hinter ihr fallen würde.
48 Hours
Anchors Away
If my father would introduce my brother and I, it would be, this isn't my son, this is my pride and joy.
48 Hours
A Deadly Family Secret
I've never seen anybody with that much sadness put it aside and just hold on to her kids and be the strong one for her children.
48 Hours
Marriage Secrets
Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.
48 Hours
The Mind of a Murderer
He's stating that he was the vice president of some company. He had loads of money. Ryan Coleman is a bartender at the Blue Marlin restaurant in Columbia. We knew that there was something not right about this guy's story.
48 Hours
The "Batman" Intruder
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
48 Hours
The "Batman" Intruder
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Armchair Expert with Dax Shepard
Allison Jones (Award-Winning Casting Director)
Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.
Armchair Expert with Dax Shepard
Allison Jones (Award-Winning Casting Director)
Give it a try at mintmobile.com slash switch whenever you're ready.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Thank you. Thank you.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Thank you.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Thank you. Thank you.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Guiltily, that is my daughter, Inez. I'm so sorry we had to admit that. And I am father of the year over here for allowing her to say such language, which, to her credit, she really didn't want to say, and then came back later and said, I want to say it now, when I started looking at other people to play it.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Yeah. Yeah. I'm going to pay for that later.
Candace
Judge Slaps Down Blake Lively. Colleen Hoover Returns. | Candace Ep 146
Nope, I got it. I'll get it. Here, I can do that. You're not going to read it? I will then. Okay, thank you very much. That's the one. It says, Ryan would love to have a new dad to have a catch. And I think he could really use a man in his life. Hugh is no spring chicken anymore. Blink once for yes or blink once for I'd love to be your new dad. He blinked. He blinked. Is this hell?
Candace
HYPOCRISY: Blake Lively Improvised Grabbing Her Co-Star's Private Parts | Candace Ep 170
Guiltily, that is my daughter, Inez. I'm so sorry we have to admit that. And I am father of the year over here for allowing her to say such language, which, to her credit, she really didn't want to say, and then came back later and said, I want to say it now, when I started looking at other people to play it.
Candace
HYPOCRISY: Blake Lively Improvised Grabbing Her Co-Star's Private Parts | Candace Ep 170
Yeah. Yeah. I'm going to pay for that later.
Candace
IT’S OFFICIAL: Justin Bieber Unfollows Usher | Candace Ep 132
You think you can hold the house down until I get back?
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
My blind, elderly, African-American roommate, Blind Al, always says that pain teaches us who we are. Sometimes we need to listen to that pain instead of running from it. Who are you? Oh, I'm Deadpool. And I guess you're Deadpool, too. But in here, everybody calls me Nicepool. Oh, my goodness. Wait till you see Ladypool. She is gorgeous. She just had a baby, too, and... Can't even tell.
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
And I guess you've already met Mary Puppins, aka Dogpool. You let this little flirt out of your sight for one second and she starts shopping for a new papa. You better hope that you don't run into the Deadpool Corps. Yeah, they're crazy. They will chop you up into a thousand pieces and hide you all over the void.
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
If they could only process their childhood trauma, they'd go on one heck of a healing journey.
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
I don't feel very comfortable asking this question.
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
I got it. I'll get it here. I can do that. You're not going to read it. I will then. OK, thank you very much. That's that's one. It says Ryan would love to have a new dad to have a catch. And I think he could really use a man in his life. Hugh is no spring chicken anymore. Blink once for yes or blink once for I'd love to be your new dad. He blinked. He blinked. Is this hell?
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
No, it's Iowa. That's from Field of Dreams. It's one of Ryan's favorite movies because he and his late father had so much unresolved sadness. But pride got in the way, and neither of them were able to find closure. Ryan thinks Field of Dreams is a true story because he's on meth, and that drug is super scary. Call me Blake. I could blow your f***ing mind, dog.
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
I mean, if Colleen has her rights, I'll go anywhere.
Candace
Selena Gomez Cries & More Ryan Reynolds' Lies | Candace Ep 139
So the big question on a lot of our minds is, what is she going to do next?
Candace
EXCLUSIVE! Did Ryan Reynolds Extort Hollywood Execs? | Candace Ep 143
Mine and I had questions, so we went to the only logical place for answers. A woman.
Conan O’Brien Needs A Friend
Ryan Reynolds
Slowly at the top. Oh, I know. I know you know. We're up there together just holding each other.
Conan O’Brien Needs A Friend
Ryan Reynolds
I'm in the prairies, Canada. I'm in Moose Jaw, Saskatchewan, where the tallest hill is a curb.
Conan O’Brien Needs A Friend
Ryan Reynolds
That's what I say to you, sir. I have exited some rooms through drywall. I'll say that. And my father was, yeah, he was definitely very, well, I'm just going to say it, emotionally abusive. But no, it's actually odd because my dad was tough and he was very, very like coiled emotionally.
Conan O’Brien Needs A Friend
Ryan Reynolds
And I think when you, as you get older, and he's been, he's passed away for, I don't know, 10 years now or so, cause of death uncertain. No, he died of something tragic. But anyway, it was- How do you get laughs with that line? You shouldn't. He died of something tragic.
Conan O’Brien Needs A Friend
Ryan Reynolds
Out of trust, I'm going to leave a large air hole now. Okay. And, uh, as I was saying, um, no, he, he was, he was, uh, I, the story changes when people pass away too. It's like a, your, your memory becomes like a less of a reliable narrator and it's becomes more of a feeling. Like I was saying, you know, I've been, I'm pushing 50 here.
Conan O’Brien Needs A Friend
Ryan Reynolds
I've, uh, uh, I had some experience, some experience under my belt and I, I'm listening to, I'm realizing I don't know as much now. as I thought I did then. So when I think about my dad and I think about how I internalized however he was raising me and the other brothers and certainly his relationship with my mom, it's not what it, I started asking myself, is that true? Is that true?
Conan O’Brien Needs A Friend
Ryan Reynolds
Was he really that? Or was that more romantic to think of it like that? And he was not great in some ways. And in other ways, he was great. Like he really was. And I think it just, in time that changed. When you die, they will love you.
Conan O’Brien Needs A Friend
Ryan Reynolds
we don't have to worry about that we will not have to worry about that for four years so let's just settle down everybody that is true the um it's gonna be like an express he's gonna have a huge effigy built the Conan O'Brien library of The Bruce Valanche log. Bruce Valanche Bible.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, he did. But he really did. My dad's dad would come home from his job. He was like a city councilman in Alberta and then moved to British Columbia. They bought their house for, I don't know, like a half glass of water and spit. Yeah. And, like, lived in this house.
Conan O’Brien Needs A Friend
Ryan Reynolds
But he would get out there and mow the lawn after work, and he'd take his jacket off, not his tie, and he would fold his shirt up one cuff and then mow the lawn. Like, this is not a man who knows how to fuck. So, you know, like, very, like, conservative, right? I mean... Very conservative.
Conan O’Brien Needs A Friend
Ryan Reynolds
Is that why they did it? Yeah. It's like every bully has a bully, right? You know, so he had those elements, but he also was, he showed up. You know, he once went a long, long time without speaking to me. And it was over some, yeah, something trivial and dumb. Uh, and then he, but he would never miss a game. Never miss a football game. Never miss a baseball game.
Conan O’Brien Needs A Friend
Ryan Reynolds
Always there for a catch, even though it would be silent and super fucking awkward. Yeah. He would. Yeah. And and he had that that guy had a right arm that you would not believe he had. He could he broke the little bone in my finger. I had to switch to a catcher's mitt and he did that underhand. Like so when people are like, oh, that's a softball question.
Conan O’Brien Needs A Friend
Ryan Reynolds
I was like, have you ever fucking caught a softball from Jim Reynolds? No, you haven't. Shut up about that sport. God, if pickleball were around, there'd be a lot of dead people.
Conan O’Brien Needs A Friend
Ryan Reynolds
No, it was joy once I kind of, in his, whatever his measure of making it means.
Conan O’Brien Needs A Friend
Ryan Reynolds
uh then it was yeah except you know he didn't go to university but he didn't talk about that he had parkinson's he said the word parkinson's maybe three times in his life also former boxer from who knows what you know um so he was very reserved with that with praise which is why i have an insatiable desire for validation so uh we can unpack that later
Conan O’Brien Needs A Friend
Ryan Reynolds
i love you guys you don't need that well i don't know what you're talking about yeah someone who has no need for validation absolutely not uh but he he would when i made quote unquote made it uh i think then he accepted it he's very bummed that i didn't go to university i did though i went for i'm not making this up i went for 45 minutes i wanted to meet the one teacher he was like a guy that dr mcclain was his name he was a he got his doctorate in prison uh he was a
Conan O’Brien Needs A Friend
Ryan Reynolds
think a Hell's Angel or something, but went to jail for 20 years or something, long time. And then, but got his education in jail and became an author and wrote a book. And I read this book. I went there, I met him, beautiful, lots of prison tattoos, but also beautiful pastel sweater.
Conan O’Brien Needs A Friend
Ryan Reynolds
And then I walked back out the door of Kwantlen Polytechnic University in British Columbia, and I drove to Los Angeles.
Conan O’Brien Needs A Friend
Ryan Reynolds
I really knew once I was inside. I just thought, I'm not ready for this. Like, I don't think I can do this. I only had one brother who really was adamant about going to university and it stressed the hell out of him. And I just thought, I don't want to be a food broker. So, and you don't, my dad did it without a university education, so.
Conan O’Brien Needs A Friend
Ryan Reynolds
I did do Groundlings, but I moved to LA to be in Groundlings, and of course it doesn't work like that. You don't just show up and go, ready for the main stage, everyone. I can give you Streisand. I can give you everything you want. No, you go through the class.
Conan O’Brien Needs A Friend
Ryan Reynolds
And so... Well, they're so good. They're all so in shape in there. Like, you know what I mean? That's a muscle, like that kind of ability.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, but also it's I would say that you are a person that does it as well. But you can also pivot quite quickly to something that's emotional because most people that are funny, I think, have some pretty, you know, deeply emotional people as well. I think like comedy and drama subsist on the same thing. Tension subverting it makes it makes moves you.
Conan O’Brien Needs A Friend
Ryan Reynolds
and if you have a like a film that has emotion then you can or anything redemption called whatever you want but it makes all that funny stuff so much more funny and rich and powerful so i loved groundlings when i did do their shows i used to do it like once in a while like a thursday cooking with gas show
Conan O’Brien Needs A Friend
Ryan Reynolds
they had and um and i would do i think i did armando a couple times here and then i loved it because there was no limit to it but on a film set i don't want to i like it's almost like method acting i'm not gonna like when people are coming on a film set a deadpool film anything i'm not gonna make my process their process right so like i'd never want to be that guy so i was i was
Conan O’Brien Needs A Friend
Ryan Reynolds
chat and we talk and we say, how can I help you feel awesome? Even an actor who's a day player comes in for one day, that's the hardest job in show business because he's got two lines. And he's going to over the fuck do it like you wouldn't believe.
Conan O’Brien Needs A Friend
Ryan Reynolds
Because in his mind, you know, there's no small parts, just small actors. I got to crush the shit out of this. And then you, but you, if you can make it safe. I always love the.
Conan O’Brien Needs A Friend
Ryan Reynolds
Oh, yeah. We're going to liquefy you. I'm going to snort your ashes on the top of the Place de Vosges. Oh my God. Just to say I did it. Yeah, yeah. Yeah, but I always say to them when they're leaving, you say, hey, look, if you just give me that moment, you're gonna drive home. And yeah, when day players, yeah, you drive your cell phone. And you have to touch everything in the car too, by the way.
Conan O’Brien Needs A Friend
Ryan Reynolds
You're gonna get in that car and you're gonna go, fuck, I should have done that. And then I was like, then we go like, okay, take 10 minutes and think about what that is. Yeah. And then let's go do that. And it's like this fun little trick. And then you do that. And then you say, now do the worst version you can do. Like, I'm telling you, you're safe. We'd never use the worst version. Trust me.
Conan O’Brien Needs A Friend
Ryan Reynolds
But like, do the worst. And then that's always the take that ends up in the show. Because now you've basically said, like, you're as safe as you could ever imagine. And I love that feeling. So I'm not like a... My improv is like, I've written... 10 alts for each joke, but not just for me, but for my co-stars or, you know, and it's a, well, here's the menu. Is there anything you'd like here?
Conan O’Brien Needs A Friend
Ryan Reynolds
Wesley Snipes was like, nope, nope, nope, nope, nope, nope. I was like, you did not read that fast.
Conan O’Brien Needs A Friend
Ryan Reynolds
Oh my God. But then he delivered. He was like, you know, I gave him that hit. This ice skate uphill line.
Conan O’Brien Needs A Friend
Ryan Reynolds
You just missed me singing along to the Marvel theme song. They were amazing. Bob Iger saw the film and the first time he saw the film, he was in pretty good shape. He said, you've got to remove the one line, Ryan. I was like, what line? You know the line. And I went, Mickey Mouse? He's like, yeah. And I was like, Bob, the whole movie orbits around that line. Like, that line is the film.
Conan O’Brien Needs A Friend
Ryan Reynolds
It's the thrust. The thesis. It's everything. And it's because my brain, when he says the one line, is like, precious.
Conan O’Brien Needs A Friend
Ryan Reynolds
And so I really had to kind of like walk around his office a little bit, do a couple of laps, and then it was fine. We were good. We switched it up. And he just didn't want the Mickey Mouse joke in. And now it got, not because of me, they released this script for like WGA, you know, awards season and stuff. And they just shower these kinds of movies with awards.
Conan O’Brien Needs A Friend
Ryan Reynolds
So, you know, I was dancing behind you and trying to suggest things at the Academy Awards.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yes, you were. What we're calling the Academy Awards situation.
Conan O’Brien Needs A Friend
Ryan Reynolds
Most would assume arthritis at this stage of the game, though. No, they have pills for that, too.
Conan O’Brien Needs A Friend
Ryan Reynolds
Well, it's so different now. It's like now people who are in film are hoping to gain enough respect to get a TV show. Right.
Conan O’Brien Needs A Friend
Ryan Reynolds
A limited series. Yeah. Yeah, I know. Everything happened perfectly. My whole career was an aggregate. It was very slow. I never experienced that overnight fame thing. And honestly, I think about how lucky I am because a lot of the guys that I...
Conan O’Brien Needs A Friend
Ryan Reynolds
came into the business with are gone and a lot of them are passed away or like you know things took these tragic you know turns where you hear about it you know one random Wednesday you're like what you know you just can't these are friends of yours yeah you know in in Los Angeles when I first met you I lived in East Hollywood and and you know everyone was partying everyone was doing you know this and that I just it was uh scary it's a scary place to yes
Conan O’Brien Needs A Friend
Ryan Reynolds
You know, to be young and to have fame and money is a very, very odd combination of things. And I thankfully was so slow with everything. I wouldn't consider like I sort of hit it in a way. When you asked me earlier with my dad, he never made it to Deadpool. Like he never made it to that coming out. He made it to, I was in post-production on October 25th in 2015 when he passed away.
Conan O’Brien Needs A Friend
Ryan Reynolds
It was three months earlier. My daughter James is named for him. So he's James Reynolds. James does not like it when I call her Jimbo. She'll grow to love it. I know. Yeah, I'm... And that's our dog, Hawk Tua. Okay, you know what? I'm going to stop naming things.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, yeah. Oh, God. Poor sons of bitches around that time, right? Who had stuck with that name. God damn it. I mean, we had a feeling at his first speech, right? you know, the push, it was nuts. You were nuts. Um, yeah. Uh, yeah. I don't know what the fuck we were talking about, but, uh, well, your trajectory, but you just, you took it one step at a time. Yeah.
Conan O’Brien Needs A Friend
Ryan Reynolds
And I think it, it allowed me to enjoy it. Like in, in points I've all, I'm always uncomfortable with the thing that I'm also, uh, in pursuant, right?
Conan O’Brien Needs A Friend
Ryan Reynolds
Fame is a weird thing. It has a little power to it. It's odd, but like I, I, I found a way to kind of make myself appreciate that part of it more because I love acknowledging and playing with the cultural landscape, whether it's a movie, a commercial sports, like I don't care. I just, I don't discriminate. I love that they're in all those. all those areas.
Conan O’Brien Needs A Friend
Ryan Reynolds
So sharing fame made it way, way less weird for me. Like when like a kid comes up and says, can I get a selfie with you? I'm like, who's the most important person in your life? And they're like, my dad, Frank. And I'm like, video, switch to video. I'm like, Frank, I'm here with... fuck's your name? Will, Will, this is not a hostage situation. He's fine.
Conan O’Brien Needs A Friend
Ryan Reynolds
Look it up! I believe he says philodendron, but that didn't work.
Conan O’Brien Needs A Friend
Ryan Reynolds
Uh, but he wants, he, you're the most important person. And he's like, you're the one, you were the phone, a friend that was you, you know, and then you, you let it go. It takes just a few seconds longer than a selfie. Yes. But like now it's a fucking memory for them forever. Yeah. And it's a thing that I walk away feeling like good.
Conan O’Brien Needs A Friend
Ryan Reynolds
I once made a video for lorazepam. You know, I mean, somebody said lorazepam was the most important thing in their life. And I was like, okay, well, I'll make a video for that. I've seen it. They air it now.
Conan O’Brien Needs A Friend
Ryan Reynolds
And I just want to say, because I have to say this now every time I bring it up, is that if you're having clay-colored stool or any other side effects... Please consult a doctor immediately. Razapam. I feel like me again.
Conan O’Brien Needs A Friend
Ryan Reynolds
The clay-colored stool thing really cost them a lot, too, because you don't want that.
Conan O’Brien Needs A Friend
Ryan Reynolds
Or do you? You can pass it off as clay in our class. If you listen to it while you're on the toilet and you put some unchained melody on and that comes out, you're like, it's never going to happen. Oh, my God.
Conan O’Brien Needs A Friend
Ryan Reynolds
Just cut it. Just cut the rap early. I used to work with a studio executive who will not be named until we stop recording. And he always aimed it at someone who ever stopped. Jesus.
Conan O’Brien Needs A Friend
Ryan Reynolds
I'm going to, yeah, for those at home, Conan just went back in his chair and then aimed his crotch at everyone he was speaking to. I learned from the best. Yes, he did.
Conan O’Brien Needs A Friend
Ryan Reynolds
And that man could use some underwear, I tell you that much, because that also is, yeah.
Conan O’Brien Needs A Friend
Ryan Reynolds
Seth Rogen went to the high school up the hill for me. There you go. No, no, Seth Rogen went to high school.
Conan O’Brien Needs A Friend
Ryan Reynolds
I had to do a commercial in French-Canadian the other day. And it was sort of like a very scary thing. Because when you're in those schools, you have to know French-Canadian. You have to speak it fluently. And it just goes away. It just goes away. You don't use it, it's gone. So I was trying to, French Canadian is just like everything.
Conan O’Brien Needs A Friend
Ryan Reynolds
Until I ask for a pastry in Paris. And they're like, oh, is that French Canadian you're speaking? You need a chocolat pour moi, yeah? Yeah, no, not good. We realize that Canada does have a lot of fun.
Conan O’Brien Needs A Friend
Ryan Reynolds
I've had the Ackroyd voice in my head all day. You've heard me doing my bad impression, but I can't get it out. I can't get it out. Out, kid.
Conan O’Brien Needs A Friend
Ryan Reynolds
And one of the more underrated, though, I think, talents.
Conan O’Brien Needs A Friend
Ryan Reynolds
No one else could do that like him. He could pump half of the movie's boring exposition, make it funny, make it entertaining into your mind in a third of a second. I've never seen someone speak as fast as Dan Aykroyd does. In Ghostbusters, he has a speech that must have been that long on the page, and it just comes out. And you know it. You still hear it all. That's the trick.
Conan O’Brien Needs A Friend
Ryan Reynolds
And I just think he's, I'm kind of, I think I'm a little obsessed with him in some ways.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, you gotta come up, you gotta come up here to Ontario, kid. And then we're gonna eat a dinner and you're gonna sleep over and in the morning we're gonna do the interview and you're gonna, you're gonna fuck off back to where you came from.
Conan O’Brien Needs A Friend
Ryan Reynolds
Bring an extra Order Canada pin for me, yeah? And put it on and we'll do it. Let's go.
Conan O’Brien Needs A Friend
Ryan Reynolds
That was back when like the miscellaneous line item on like a production report is just like all cocaine. And then you guys spent $80,000 on miscellaneous in one night. What the fuck is that? Yeah. That's always the thing. Dan also shows like a thing a bit that John Candy, you know, you saw, I think you saw in Planes, Trains, which is where you're seeing him in performance.
Conan O’Brien Needs A Friend
Ryan Reynolds
It's heartbreaking, funny, vulnerable, and all the reasons I have always been and will always be very much in love with Mr. John Candy. But Dan Aykroyd, if you've ever seen Gross Point Blank, he gives the most unexpected...
Conan O’Brien Needs A Friend
Ryan Reynolds
villain performance i've ever seen it wasn't over the time it was just grounded and weird and it's on infinitely watchable when i finally tracked him down because he's elusive um i said i owe money because i've stolen so much from him that uh i believe i i own 41 million dollars yeah 41.
Conan O’Brien Needs A Friend
Ryan Reynolds
No, not at all. Because he'll take it. I heard him jot it down, though. But no, he's just a real gentleman, too. Like, really, you know, just made a good stuff. And he sells a tequila that comes in a skull. Vodka. Crystal skull vodka. Crystal skull vodka.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah. Did you try any? Did I try? I think I've tried everything that exists at some point. You know, tried it twice, right? Yeah. Yeah.
Conan O’Brien Needs A Friend
Ryan Reynolds
You can smoke it. We don't have to go back there. But don't smoke the lorazepam because I also have another PSA for that, and you don't want those side effects.
Conan O’Brien Needs A Friend
Ryan Reynolds
Or baby formula. Don't smoke baby formula. Are we going to list things you shouldn't smoke now? Yes. Most of them, when you smoke, you don't know you're peeing anymore for the rest of your life. You're like, oh, it's warm. It's warm and comforting all of a sudden. Like the womb. A little stingy, a little cold. Yeah, no, no, no, no.
Conan O’Brien Needs A Friend
Ryan Reynolds
It's probably why I'm like, as I come down a real heavy case of alive. Yeah. I've always wanted to do a non-alc.
Conan O’Brien Needs A Friend
Ryan Reynolds
commercial for like one of those, you know, I wrote one, I haven't figured out how to end it all yet, but like where people do the same things drunk people do, except on their non-alcoholic beverage choice, where they're like, you know, the next morning, they're like, you know, there's a woman who's like, I went out with Gail and the girls the other night, and I don't drink, but
Conan O’Brien Needs A Friend
Ryan Reynolds
And we just met. I didn't know his last name. And basically, experiences that each person has that you would normally think of the groom or the best man at a wedding, you know, gives a speech that's just fucking profound. You know, and it's not like just the letter L for five straight minutes and then like an anecdote about himself. You know, just nails it. Toe pick, everything.
Conan O’Brien Needs A Friend
Ryan Reynolds
So I've always wished that's the angle. That's the angle. That would be fun with a little.
Conan O’Brien Needs A Friend
Ryan Reynolds
They know they're being, I mean, consumers know they're being marketed to, so don't. It's not a very special episode of Dharma and Greg. It's a fucking, you know, it's a fucking Tide Stick commercial, you know? But it's, well, you know why? I like them, and it's sort of, it's not just me, certainly.
Conan O’Brien Needs A Friend
Ryan Reynolds
I have some of the greatest, smartest people that, quite frankly, I find threatening, who I get to work with. I mean, Sean Levy, who I've done three movies with now, you know, it's like a brain trust, and like there's a real, I mean, every... Movies that you sort of, quote, control are like, you're not controlling it. They just trust you. You know, you said, like, hey, I'm going to land the plane.
Conan O’Brien Needs A Friend
Ryan Reynolds
You know, I remember trying to get my Deadpool and Wolverine movie made, and I just focused on that. I was like, I will return your investment. Like, I will return your, I got you. Like, I am not a reckless, you know, pilot. I will land the fucking plane on a dime. It will be a four-quadrant. R-rated film. I'm going to make Disney's first fork water R-rated film.
Conan O’Brien Needs A Friend
Ryan Reynolds
And this is after they said no to 18 different things, including a movie where Deadpool is after the hunter who killed Bambi's mom. They said, we don't touch Bambi. And I said, you said you don't touch Mickey Mouse.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, we did. Yeah. But that's a part of our responsibility, too, is people that produce the movie and we go write the movie and we're back to all those things. It's like making sure it works because I've done movies that are, you know, small films that are in Sundance and all that stuff. And I loved making them. And they were hard to make.
Conan O’Brien Needs A Friend
Ryan Reynolds
And, you know, they would get great reviews and everything, but then it would just, you'd find out later, just bankrupted whatever little tiny studio made it. And I thought, I'm going to be out of work. They are getting out of work. I got to find a, I got to find a job that fits. So it, it's a win-win, you know, if I want to do it for the rest of my life, I'm gonna have to figure that out.
Conan O’Brien Needs A Friend
Ryan Reynolds
And then it grew to all of it. Like, All the other things. I loved commercials when I was a kid. Like, if you saw a good commercial, it stayed with you.
Conan O’Brien Needs A Friend
Ryan Reynolds
You know, and I was one of those kids like you probably were. You're sitting there two inches from the TV and just trying to stay up as late as humanly possible. Because TVs back then ran on plutonium. Oh, my God.
Conan O’Brien Needs A Friend
Ryan Reynolds
Really, the biggest change for me was Green Lantern because it didn't work. I watched a studio throw money at the problem after problem after problem instead of creating. Constraint is the greatest creative tool in the world. And that's why I like commercials because there's an economy to them. You have to make them quick. You have to be not precious about them.
Conan O’Brien Needs A Friend
Ryan Reynolds
You know, it's a fucking commercial. Who cares? It doesn't have to be a Fellini film. It'll either work or it doesn't or it moves at a speed of culture. So it's at least relevant. Like it's a it's an easier way to kind of fix it, you know. But the that movie was where I changed my life because I just saw you saw this is going down or this isn't.
Conan O’Brien Needs A Friend
Ryan Reynolds
And it was really like, that's hard for everyone because it's, it's too much money, too much time will murder creativity. Like if you have to, if you're under constraint, like the next movie I did was Deadpool, which had a $56 million budget, I believe, which is nothing. Like I think they probably spent $250 million. on Green Lantern and this one had nothing.
Conan O’Brien Needs A Friend
Ryan Reynolds
You had to supplant or change all of these action spectacle set pieces into movies that you remember the dialogue, not the thing because audiences also are inured to special effects. The world in danger, I was like, I love that the character is like, I don't give a shit about the world. Like, I care about those people. Right.
Conan O’Brien Needs A Friend
Ryan Reynolds
My name is Ryan Reynolds. And I feel philodendrous about being Conan O'Brien's friend. A little Who's Harry Crumb reference there for you.
Conan O’Brien Needs A Friend
Ryan Reynolds
I love the use of it because you could say anything in the Deadpool movies. I loved watching Kevin Feige watch the thing back, got together where Deadpool's like, he's like, you know, listen, we don't have to do this. There's a big fight about to happen and they're like, no, we're going to fuck you up or whatever the line is. And he says, no, I mean the multiverse. It's not working. It's
Conan O’Brien Needs A Friend
Ryan Reynolds
It's not great. It's just been miss after miss after miss. It's been two Ant-Mans forward and one Black Adam back. And it's not working. And Kevin wints on each miss. So funny. And yeah, but then what a sport.
Conan O’Brien Needs A Friend
Ryan Reynolds
I did it just to make you laugh. And I swear to God, there's one. It's actually we had to realign my head a couple of times because the going down the stairs didn't work quite well. So we were like rejiggering it, trying to get it right. But I just did it to make you laugh. Because there he is, shirtless, hasn't had a carb since the 80s. He's like, oh, my God.
Conan O’Brien Needs A Friend
Ryan Reynolds
You know, can we just get through this scene so I can have a bagel? And, you know, I am fucking around. It's just terrible.
Conan O’Brien Needs A Friend
Ryan Reynolds
Well, I actually had the same problem with the Whitney Houston song. Oh, the Dolly Parton song. But I always thought it was Hugh. I always, always loved Hugh. And then I was like, wait, you?
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, yeah. I was sitting next to someone who said commodified and I was like, I think you mean commodified. And he's smart as shit. So I felt the power in that moment, right? I was like, oh, I have something over you right now, don't I?
Conan O’Brien Needs A Friend
Ryan Reynolds
You and McElhenney because it was McElhenney. Robert Copernicus McElhenney.
Conan O’Brien Needs A Friend
Ryan Reynolds
alabaster yes no heart is a rock heart is a rock heart is a rock right now uh he is um just describing it your heart is a rock right i saw him without his shirt how you feeling now there you guys were expertly lit and in slow motion in my mind when i saw you guys coming together no no macklehenny don't don't uh don't sleep on that body if well sleep on it if you can uh happily married though so don't try uh but he's uh yeah he's a rock he's a beast
Conan O’Brien Needs A Friend
Ryan Reynolds
incredible so yeah Rob I treat with respect you better with kindness yeah occasional condescension and that's about it yeah mostly just those things but he did say co-modified because not great yeah he fucked up not me I wouldn't do that just finished like two years of just in the Guts is something, you know, I always think of filmmakers like Sean Levy is more like a brother.
Conan O’Brien Needs A Friend
Ryan Reynolds
We just love each other. We're three movies together. We're going to do a fourth one at some point. But that like filmmaker word is not broad enough, though, because like it's so when movies work, you guys talked about this on one of the shows. I think it was like Adam Scott. How, like, they're hard to make a movie. A movie's hard to make, right?
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah. Like, everyone has to be excellent, like, really, and care. People sort of underestimate how valuable caring is. And, you know, when you work with a props department or a production designer who, in his cells, wants to make the best possible... Our Deadpool and Wolverine, Ray Chan, he passed away, unfortunately, on our last fucking day of shooting, too. It was really...
Conan O’Brien Needs A Friend
Ryan Reynolds
But it was one of those things where in post we got to put Easter eggs of them everywhere in the movie. But that movie would never have done what it did or connected with people the way it did without this guy. And I consider a production designer a filmmaker. Sometimes a costumer is a filmmaker. Sometimes it's a cinematographer. It's more vast a pool than I think people understand.
Conan O’Brien Needs A Friend
Ryan Reynolds
realize, you know, there's a lot like, it's part of why it changed my trajectory when I was at the right time was, you know, you do a movie and you're working with people who if there's one person in charge, and that is it, my way or the highway, you get everyone into a yes, sir, no, sir. You know, like, when I pitch a joke, I'm always like, okay, here's the shittiest version possible.
Conan O’Brien Needs A Friend
Ryan Reynolds
But and I'm what I'm actually doing is inviting dissent. I want
Conan O’Brien Needs A Friend
Ryan Reynolds
you to disagree like disagree with me because then then we're gonna have fun it's gonna get better right and you may have an idea that it's amazing that you've suppressed because i'm like this is the way um but it's that pool always has to be expansive and and then you make great stuff and then it's why movies are like you know i was so happy you were hosting the oscars because like
Conan O’Brien Needs A Friend
Ryan Reynolds
You I think you've now and have always understood the joy of of collective effervescence.
Conan O’Brien Needs A Friend
Ryan Reynolds
That's another example of why I love this man. You've got to say my name because they might be confused. No, he's pointing to me. Gale. Cone Cone. Has anyone ever gone Cone Cone? They've never gone Cone Cone. Let's not do that. The reason I love you is that you don't punch down. It's not your vibe. Oh, no. I would very much like to be the joke.
Conan O’Brien Needs A Friend
Ryan Reynolds
I did it once in my life, and I deeply, deeply regretted it. And it was 22 years ago, and it was such a lesson they'll never forget. Yeah, yeah. So it's on late night. But it was a little bit like when just a comedian or the guy with the microphone starts picking on someone, and you're just like, they don't have a microphone as well. It's not fair, you know?
Conan O’Brien Needs A Friend
Ryan Reynolds
And just that land, that left a mark that I'll never, ever forget.
Conan O’Brien Needs A Friend
Ryan Reynolds
You know, you wake up and you're just, you know, wide away. It was a person. It gets worse. I am. I wrote a long note to the person afterwards and I said, I don't know why that came out of my mouth. And it was because I'd seen them like a couple of days before. Yeah. Near the apartment I was renting in Santa Monica. This is so long ago.
Conan O’Brien Needs A Friend
Ryan Reynolds
And I sent I wrote a long letter to him, sent him a case of champagne. I don't know. I was young. No one drinks champagne. Right. I don't know. And later I read a story about his wife saying that he fell off the wagon back in June. Oh, no. Yeah, no. I had no idea. This was before. You don't just Google someone. Like, I didn't know.
Conan O’Brien Needs A Friend
Ryan Reynolds
Fuck me. Like, I really. And then so that's where I got the lesson to never. If you're listening right now, don't apologize. Yeah, no, no. He's fine and wonderful. And may I say thriving.
Conan O’Brien Needs A Friend
Ryan Reynolds
I mean, as parents, you see, I mean, no, but yeah, exactly. And I do that all the time with the kids. If you like, if you get down, kneel down to their level and say, Hey, when we last night, when you wouldn't, you know, go to bed and you did all the, uh, the sorry, street art on the wall. Uh, um, I could have handled that better. And I wasn't great. I wasn't good at dadding.
Conan O’Brien Needs A Friend
Ryan Reynolds
And I'll even do the do-over. I'm like, can I try? Can you make some more street art? But on the paper, and I will come in and I'll do it again better. I love that you're asking for a retake. Yeah, basically that is what I'm doing.
Conan O’Brien Needs A Friend
Ryan Reynolds
Let's skip showbiz and just enroll you straight into cocaine.
Conan O’Brien Needs A Friend
Ryan Reynolds
And then go into showbiz with all your injuries, emotional injuries. Thank you.
Conan O’Brien Needs A Friend
Ryan Reynolds
four hours go by as fast as it just did uh no i'm serious i this is one of those things where you when i could tell in your voice it's time to wrap it up and i got genuinely sad because i you know you are an idol of mine you are somebody who i've watched and dare i say that the risk of over praising look up to and uh always have always will because you're kind uh you have integrity and you can that doesn't mean it costs you subversive comedy or any of those things all that edge is there and
Conan O’Brien Needs A Friend
Ryan Reynolds
It is a high bar you set. You always have. And that's why I did the Jay Leno thing. I just, I fucking snapped.
Conan O’Brien Needs A Friend
Ryan Reynolds
So God bless you. I know you are a deity. Deus? What is that? Isn't that what they call it?
Conan O’Brien Needs A Friend
Ryan Reynolds
Mm-hmm. Yeah, we're going to work on that. We're going to have a caucus. Is that what we say? We caucus on it. Okay, don't do that.
Conan O’Brien Needs A Friend
Ryan Reynolds
Your worship in Canada, that's a fun one. You have to say your worship to the judge.
Conan O’Brien Needs A Friend
Ryan Reynolds
I think. He won't admit to it. All right, sir. Thank you. Go with. Thank you, guys. Thank you all.
Conan O’Brien Needs A Friend
Ryan Reynolds
But you don't know about those kinds of movies. I mean, you never know. You never know when you're making it. You're like, oh, this is going to work. This is not going to work. When you're older, I think you can trust your experience and your instincts that line up. But then when you're older, you also go, nobody knows anything. Right.
Conan O’Brien Needs A Friend
Ryan Reynolds
So, but just friends, I, God, that was, we shot in Regina, Saskatchewan. It's one of my few times that I've ever been scared of like going to jail because we, just as a joke, me and the art department, we made a sign that would go over, it would snap over the welcome to Regina sign. And it just said, welcome to Regina, which rhymes with fun. And I got in trouble, though. You got in trouble?
Conan O’Brien Needs A Friend
Ryan Reynolds
But then they thought it was funny because it snapped off. So at first it was vandalism. Right. And then it was class.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, yeah. And I come from RCMP. My dad, my brother, is currently an RCMP officer. I always say, you guys should just say agent. It sounds better. You're an RCMP agent.
Conan O’Brien Needs A Friend
Ryan Reynolds
Syrup, little cartridges of syrup. My dad used to bust guys with confetti. He would just, like, walk up and throw the confetti at you. And it's always fun when you and your three older brothers. So it's just mayhem. It's actual mayhem. I mean, this is a horrible situation. Because I'm the youngest, so I'm the moving target. They're brothers. You know, I'm just the moving target.
Conan O’Brien Needs A Friend
Ryan Reynolds
Or harvestable organs. And, you know, we would... But as I got older, we would get out on the lawn. And it would be, like, an old-fashioned, like... Tom Cruise in Far and Away with the knuckles up and we would just beat the living shit out of each other. The neighbor would call the cops and the cop would be my dad. That's not a cop we wanted to mess with.
Conan O’Brien Needs A Friend
Ryan Reynolds
Yeah, but my dad got out of copping. I mean, he wasn't big on the truth, so I don't know why. But yeah, he got out of copping and then became a food broker, which we're like, come on, that's CIA, right?
Conan O’Brien Needs A Friend
Ryan Reynolds
And he's like, no, I really am a middleman for jars of jam and tiny yogurts.
Conan O’Brien Needs A Friend
Ryan Reynolds
That took me 41 days to compose that one. And it was just in case. Before that, I had no idea I was going to be on the show.
Conan O’Brien Needs A Friend
Ryan Reynolds
Day nine. Me, Wilson, you. I basically, I think it was about the dwindling licensing rights of the Academy Awards show. How the fate of the future of film and television, of course, is on your shoulders. Please don't fuck this up. There are a few hundred thousand people who are like, you know, very selfish and dependent upon, you know, food and shelter.
Digital Social Hour
AI's Game-Changing Role in Financial Planning | Lucas Winthrop DSH #1207
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Digital Social Hour
AI's Game-Changing Role in Financial Planning | Lucas Winthrop DSH #1207
Give it a try at mintmobile.com slash switch.
Digital Social Hour
The Truth About DEI & Why It’s Failing in America | Matt Dearden DSH #1214
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Digital Social Hour
The Truth About DEI & Why It’s Failing in America | Matt Dearden DSH #1214
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Digital Social Hour
From Homeless to Tequila Mogul | Metta Risdal DSH #1215
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Digital Social Hour
From Homeless to Tequila Mogul | Metta Risdal DSH #1215
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
FloodCast
S10E07 - ¡ Ay, Dracula !
Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.
FloodCast
S10E07 - ¡ Ay, Dracula !
Give it a try at mintmobile.com slash switch whenever you're ready.
FloodCast
S10E04 - Un Elephant en Pyjama
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
Give it a try at mintmobile.com slash switch.
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Honestly with Bari Weiss
Trump’s Second Week: DeepSeek, DEI in the Military and . . . Baby Chickens?
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Honestly with Bari Weiss
Trump’s Second Week: DeepSeek, DEI in the Military and . . . Baby Chickens?
Give it a try at mintmobile.com slash switch.
Honestly with Bari Weiss
Sam Altman on His Feud with Elon Musk—and the Battle for AI's Future
Ryan Reynolds here for Mint Mobile. One of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.
My Favorite Murder with Karen Kilgariff and Georgia Hardstark
Rewind with Karen & Georgia - Episode 28: I 28 His Liver With Some Fava Beans and A Nice Chianti
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
My Favorite Murder with Karen Kilgariff and Georgia Hardstark
Rewind with Karen & Georgia - Episode 28: I 28 His Liver With Some Fava Beans and A Nice Chianti
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Chelsea Handler on Embarrassing Vegas Nights, Flip-Flop Aversions & Bikini Skiing | Ep. 12
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Chelsea Handler on Embarrassing Vegas Nights, Flip-Flop Aversions & Bikini Skiing | Ep. 12
Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.
Not Gonna Lie with Kylie Kelce
Kylie on Marrying Into Fandom, Pop Culture Crash Course & Postpartum Lies with Amanda Hirsch | Ep. 7
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Not Gonna Lie with Kylie Kelce
Kylie on Marrying Into Fandom, Pop Culture Crash Course & Postpartum Lies with Amanda Hirsch | Ep. 7
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Right.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Right.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Right.
Not Gonna Lie with Kylie Kelce
Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike Big Wireless, is to not be a raging a**hole. and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6
$45 upfront payment required, equivalent to $15 per month. New customers on first three-month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes on unlimited. See mintmobile.com for details.
Not Gonna Lie with Kylie Kelce
Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6
What? IndieClub? We all fam. I don't...
Not Gonna Lie with Kylie Kelce
Kylie & Kat Dennings on Irish Dancing in Bars, Stage Name Origins & Kelce Cat Game Plan | Ep. 14
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Kat Dennings on Irish Dancing in Bars, Stage Name Origins & Kelce Cat Game Plan | Ep. 14
And
Not Gonna Lie with Kylie Kelce
Kylie on How to Talk to Pregnant Women, USWNT Legacy & Retirement Surprise with Alex Morgan | Ep. 5
Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com. I'm not going to lie.
Not Gonna Lie with Kylie Kelce
Kylie & Kate Hudson on Makeup in the Delivery Room, Red Carpet Run-Ins & RomCom Queendom | Ep. 13
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie on Inevitable Minivan Future, Online Clapbacks & Body Neutrality with Drew Afualo | Ep. 4
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie on Inevitable Minivan Future, Online Clapbacks & Body Neutrality with Drew Afualo | Ep. 4
Yeah.
Not Gonna Lie with Kylie Kelce
Kylie & Jason on Love Languages, Dating Red Flags & Valentine’s Day at the Eagles Parade | Ep. 10
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. Not going to lie.
PBD Podcast
Fani Willis DISQUALIFIED, President Elon Musk, Luigi Mangione Indicted | PBD Podcast | Ep. 523
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f**k are you talking about, you insane Hollywood a**hole?
PBD Podcast
Fani Willis DISQUALIFIED, President Elon Musk, Luigi Mangione Indicted | PBD Podcast | Ep. 523
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com.
Radioactive: The Karen Silkwood Mystery
Ep. 5: The Phantom Vehicle
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Radioactive: The Karen Silkwood Mystery
Ep. 5: The Phantom Vehicle
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Sean Carroll's Mindscape: Science, Society, Philosophy, Culture, Arts, and Ideas
288 | Max Richter on the Meaning of Classical Music Today
Ryan Reynolds here from Mint Mobile. With the price of just about everything going up during inflation, we thought we'd bring our prices down. So to help us, we brought in a reverse auctioneer, which is apparently a thing. Give it a try at mintmobile.com slash switch.
Sean Carroll's Mindscape: Science, Society, Philosophy, Culture, Arts, and Ideas
AMA | October 2024
Ryan Reynolds here from Mint Mobile. With the price of just about everything going up during inflation, we thought we'd bring our prices down. So to help us, we brought in a reverse auctioneer, which is apparently a thing.
Small Town Murder
#552 - Too Many Dead Neighbors - Kerby, Oregon
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Small Town Murder
#552 - Too Many Dead Neighbors - Kerby, Oregon
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
SmartLess
"Ariana Grande"
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
Something Was Wrong
S22 E9: How Dare You
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Something Was Wrong
S22 E9: How Dare You
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Commercial Break
12 Days of TCB: Don't Stare At The Red Rocket
Ryan Reynolds here for Mint Mobile. One of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Give it a try at mintmobile.com slash switch.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
$45 upfront payment equivalent to $15 per month. New customers on first three-month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes. See details.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
WOW! France DESTROYS Trump with MILITARY RESPONSE
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
WOW! France DESTROYS Trump with MILITARY RESPONSE
Upfront payment of $45 for three month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.
The MeidasTouch Podcast
Zelenskyy Puts the Screws into Trump… from Kyiv!
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Zelenskyy Puts the Screws into Trump… from Kyiv!
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Gets HUMILIATED by WORST Inauguration Ratings
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump has DISASTROUS Day 1 in Oval Office FIRST 24 HOURS
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
YIKES! Hegseth has DISASTER Confirmation Hearing on LIVE TV
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
YIKES! Hegseth has DISASTER Confirmation Hearing on LIVE TV
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Democratic Congressman Neguse on GOP Disaster CR
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Democratic Congressman Neguse on GOP Disaster CR
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trumpers Get RUDE AWAKENING as they LOSE EVERYTHING
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Trumpers Get RUDE AWAKENING as they LOSE EVERYTHING
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS on Day 1 - 1/20/25
Ryan Reynolds here from Mint Mobile, with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS on Day 1 - 1/20/25
Boy, is that striking.
The MeidasTouch Podcast
Judge SLAPS Trump DOWN on Immunity + MORE
Ryan Reynolds here for Mint Mobile. You know, one of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump THROWS Elon UNDER THE BUS for DISASTER
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Congressman Jake Auchincloss on GOP Blunders
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Congressman Jake Auchincloss on GOP Blunders
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Throws Tantrum as Bad News Grows
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump Throws Tantrum as Bad News Grows
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump’s First Cabinet Meeting Plunges Into Disaster
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump’s First Cabinet Meeting Plunges Into Disaster
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Oligarch Bros GO TO WAR with EACH OTHER…INSTANTLY
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump Oligarch Bros GO TO WAR with EACH OTHER…INSTANTLY
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Canada Leaders Issues FINAL URGENT WARNING to Trump
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Canada Leaders Issues FINAL URGENT WARNING to Trump
$45 upfront payment required equivalent to $15 per month. New customers on first three month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes on unlimited. See mintmobile.com for details.
The MeidasTouch Podcast
GOP House BLOWS ITSELF UP as MAGA Mike FIRES Top Member
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
GOP House BLOWS ITSELF UP as MAGA Mike FIRES Top Member
As you know, Donald Trump has been on the sidelines saying he doesn't want to see that aid go to Ukraine unless it's in the form of a loan. But just very quickly, do you expect it to get a vote this week, Congressman?
The MeidasTouch Podcast
Newsom GOES BALLISTIC on Trump in STUNNING RESPONSE
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Newsom GOES BALLISTIC on Trump in STUNNING RESPONSE
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
How to Fight Back with Messaging Guru Anat Shenker-Osorio
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
How to Fight Back with Messaging Guru Anat Shenker-Osorio
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Panicked Trump Screws Himself as Term Collapses
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Panicked Trump Screws Himself as Term Collapses
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Mexico President PUTS Trump TO SHAME in Public
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
GOP Leaders SUFFER Major BACKLASH in New Year
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Dems Call Trump’s BLUFF with PERFECT TRAP in NEW YEAR
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Union Voters GET FACES EATEN by MAGA Leopards
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Republicans Freak Out as Dems Go on Offense
I wouldn't say disaster. President Trump has a tendency to do the shotgun. But he also looks for the deal. You know, I'm more of a surgical, former SEAL Team 6. I like the surgical, you know, hit rather than the broad shotgun.
The MeidasTouch Podcast
Republicans Freak Out as Dems Go on Offense
The economy is fickle. The economy, you know, people are hurting, and people are hurting in Montana.
The MeidasTouch Podcast
Denmark UNLEASHES FURY at Trump after CALL FROM HELL
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Denmark UNLEASHES FURY at Trump after CALL FROM HELL
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump DESTROYS Lives of HIS Voters who TRUSTED HIM MOST
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Panicked Trump Gets Frantic as Tables Turn
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Panicked Trump Gets Frantic as Tables Turn
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Gets Destroyed by Dem Govs in Public
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump Gets Destroyed by Dem Govs in Public
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Runs to Golf Like a Coward as USA Rises Up
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump Runs to Golf Like a Coward as USA Rises Up
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
World Leaders Put the Screws in Trump as He Secretly Begs
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
World Leaders Put the Screws in Trump as He Secretly Begs
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Sen. Mark Kelly on Trump’s ‘Worst 50 Days’
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Sen. Mark Kelly on Trump’s ‘Worst 50 Days’
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
BOOM! Newsom THROWS DOWN on Trump in PUBLIC
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
UK Right-Wing Sends URGENT WARNING for Trump to STOP IT
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
World Leaders DESTROY Trump as he SCREWS AMERICA
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Latino Trump Voters SOBBING IN TEARS as Trump BETRAYS THEM
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Colombia Prez THROWS Trump into TOTAL TANTRUM
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Colombia Prez THROWS Trump into TOTAL TANTRUM
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Colombia Prez THROWS Trump into TOTAL TANTRUM
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Zelenskyy Punches Back at Trump Hard After Sell Out
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Zelenskyy Punches Back at Trump Hard After Sell Out
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump PSYCHOTIC MELTDOWN gets EVEN WORSE
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump has DISASTROUS Christmas as MAGA IMPLODES
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to Trump COLLAPSING TERM
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS before DAY 1 - 1/16/25
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS before DAY 1 - 1/16/25
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Right. I may have taken away Ebola for a little bit. And, you know, I don't know. You want to know my phone number? It's boob. 8088 boob.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Hamas is saying, oh, Donald Trump, did you hear?
The Rest Is History
535. Emperors of Rome: Tiberius, Slaughter and Scandal (Part 2)
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Rest Is History
535. Emperors of Rome: Tiberius, Slaughter and Scandal (Part 2)
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Could I just ask at this point, I know that you wrote about this and put it in your notes and then removed it because you were worried about time, but I think it should mention it because it's probably the one thing that most people listening to this episode will know about the early days of the Nazi invasion of Poland, which is a vague, inchoate sense that the romance and glory of war is upheld by Polish lancers charging panzers.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And This is not true. They did not do this. However, there were cavalry engagements. So there's a famous cavalry engagement in the first hours of the Nazi invasion where a group of German soldiers have moved into a forest, clearing in a forest. that Polish cavalry units see them, attack them, clear them out of the forest.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And although they then get attacked by armoured vehicles and machine gunned, and they lose about a third of their men and horses, the rest get away. They have held up the German advance for a few hours and enable Polish forces to drop back. So very kind of heroic. And then the Germans... invite international journalists to come and look at the scene of this skirmish, this battle.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And there were kind of, you know, horses with their guts ripped out and dead cavalrymen, Polish cavalrymen. And one of these journalists who's writing for an Italian paper, he writes it up as a,
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
cavalry charging tanks and i guess it resonates because of the famous story of of the poles arriving at the siege of vienna yeah in 1683 yeah the kind yes all of that and so for i mean i suppose for for some poles and certainly for foreign foreign sympathizers, it becomes emblematic of an age of chivalry. It has been destroyed. Whereas for the Nazis, it serves as an emblem of
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
polish backwardness so even gun to grass you mentioned the tin drum i mean he describes this the polish cavalry as as kind of don quixote and by extension the whole polish state yeah so there that's it's a kind of interesting ambivalence isn't it yeah that that it is a myth polish lancers didn't charge tanks but it obviously spoke to something that both sides in the war wanted to believe for different reasons
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Also, it highlights the imbalance in mechanization, which is what dooms them. Exactly. Because basically... The Nazis are stress testing what they can do with tanks, what they can do with modern airplanes. And as we all know, it's devastating.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And even though ruins lie where fine orphanages should stand, even though there are barricades where we wanted parks, even though our libraries are engulfed in flames, even though our hospitals are burning, then not in 50 years, not in 100 years, but now, today, Warsaw, defending the honour of Poland, has reached the peak of its greatness and its glory.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
They go back to France. And they outnumber the German forces in the West by five to one, six to one.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And I'm sure we'll come to this when we, in due course, I'm sure we will, we cover the phony war. But it is still, I mean, it's weird, isn't it? Why are they, I mean, is it psychological reasons?
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
I mean, the Polish strategy is the best that could have been hoped for. If the Poles do survive as a military force and they're attacking in the West, then you have the pincer movement that Hitler had been so afraid of. Yeah, I know. To squander that, it just seems so odd.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
That was the mayor of Warsaw, Stefan Starzynski, who was broadcasting to the people of the Polish capital on the 23rd of September, 1939. It is one of the most famous speeches in Polish history. And even in translation, it is, I mean, unbelievably moving and powerful. And all the more so, Dominic, because, of course, you can tell what the context for this is by his description.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And that, of course, will be in due course what the British will say about the French.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So the generals who are listening to this... What are they making of it?
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So after your virtual visit, Amazon will deliver your prescriptions directly to your door.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Because the implication of depopulating Poland and settling it with Germans, the prospect of committing genocide, I mean, that isn't really what soldiers sign up to. No. Even if you're serving Hitler.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Warsaw is under attack. It's being pounded by German artillery. You've got the Luftwaffe carpet bombing it from the skies. Thousands of civilians dead, fires blazing out of control, much of the city in ruins. And that great...
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So that is conscience being put in the shade by fascist ideology. Yeah.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Right. I mean, I know that soldiers who get shot at commit atrocities, but they don't justify it, I think, in the way that he is.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
owed I guess to this sense of the invincible spirit of the Polish people but goodness I mean the invincible spirit of the Polish people has to go through a lot in this episode and has to go through a lot in the years that will follow the events of this episode because we are talking about the Nazi invasion and conquest of Poland
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So in Nazi anti-Semitic cartoons, Jews will be portrayed as wearing a distinctive style of dress, wear their beards, their hair in a distinctive way, even though most German Jews do not look like this. But in Poland, lots of Jews do. I mean, you can tell them apart from the Gentile population. Absolutely right.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Which means that they're then sitting ducks to Germans who have been prepared to look on them with horror.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So it is the kind of neo-Darwinian, social Darwinian nightmare of how nature functions. Untrammeled by moral considerations, it is the predation of the strong upon the weak.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
OK, well, let's take a break there with the German army now. approaching the Polish capital. And in the second half, we will see what ensues. Hello, welcome back to The Rest Is History. And we're listening to the invasion, the conquest, the rape of Poland and Dominic. The Germans have reached the outskirts of Warsaw. How does the city respond?
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
The city held out for another week. But meanwhile, there is a devastating twist coming, isn't there, which was being prepared in our previous episode. So it comes as a total surprise to our listeners what now happens.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Well, Lloyd George is one of the guys who's being... I mean, in due course, he'll be lined up as a potential Marshal Pétain, won't he?
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
a god on Valhalla swooping over the scene of devastating battle or something.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
But I'm just wondering whether Nazi propaganda celebrates what's being done in Poland or whether it keeps quiet about it.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Absolutely. Dominic, thanks. I mean, that was a brutal, harrowing, terrifying episode. And that ends our account of the Nazi invasion of Poland. But we are not going to leave this story completely. We have an episode that is a kind of coda to the conquest of Poland. but is also a kind of palate cleanser.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
It's a story that takes us into the kind of the dark heart of Poland's fate in the Second World War. But I think it also offers perhaps a sense of hope and redemption, because amazingly, it features at its heart the story of a bear. And we will be back with that on Thursday. The story of Wojtek, a bear that is very well known in Poland, Dominic, and should, I think, be better known here.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So you can hear that episode on Thursday. But for now, goodbye. Bye-bye.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
Because the gallantry of it, the nobility of it, of that scene, I mean, it blazes all the brighter, doesn't it, for the near universal darkness that effectively is the rest of this invasion.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So they're not soldiers, they're not in uniform. No.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And again, it's a reminder, isn't it, of how, in so many ways, how distant this war is. Because now communications are so instantaneous. The fact that you have to have a journalist on the frontier holding a telephone out to inform the British Embassy of what's happening just seems incomprehensible. It does. Yeah, absolutely.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
But there aren't that many of them and they don't have many planes. Again, I mean, I know that I keep going on about this, but it seems bizarre that the country with the impregnable defences, i.e. Czechoslovakia, gives them up and Poland that has no defences at all fights.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And is this a strategy that's been formulated or is it one that evolves in the context of the war? I think a bit of both.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
But it's striking, because obviously the French do not adopt this. No. De Gaulle is very keen on it, but he doesn't have any leeway with that. But presumably it's adopted by the Nazi high command because it conforms with their sense of how a German army should be performing. Yeah, I think so.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
And I suppose that's also true of the Air Force, isn't it? Yes. They've had to build it from scratch, so it's that much more advanced and cutting edge.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
I believed Warsaw would be great. I and my colleagues drew up plans for a great Warsaw of the future. And Warsaw is great. It happened sooner than we expected. Not in 50 years, not in 100. But today, I see a great Warsaw. And as I speak to you now, through the windows I see, enveloped by clouds of smoke, reddened by flames, a wonderful, indestructible, great, fighting Warsaw in all its glory.
The Rest Is History
532. Hitler's War on Poland: The Fall of Warsaw (Part 3)
So Picasso's image of it is the kind of icon of bombing campaigns, isn't it? It is, absolutely. So it kind of does stand in for everybody else who suffers from it over the course of the war. It does.
The Tucker Carlson Show
Brigham Buhler: UnitedHealthcare CEO Assassination, & the Mass Monetization of Chronic Illness
Don Jr. here, guys. Are you receiving letters from the IRS claiming you owe back taxes? As penalties and interest fees pile up, the IRS gives you no clear path to resolution. Don't speak to them on your own. They are not your friends. To reach a team of licensed tax professionals that can help you reduce, settle, and resolve your tax matters, go to tnusa.com and check them out.
The Tucker Carlson Show
Brigham Buhler: UnitedHealthcare CEO Assassination, & the Mass Monetization of Chronic Illness
Solve your tax problems today. Call 1-800-780-8888 or visit tnusa.com. That's 1-800-780-8888.
The Tucker Carlson Show
Brigham Buhler: UnitedHealthcare CEO Assassination, & the Mass Monetization of Chronic Illness
100%.
The Tucker Carlson Show
Matt Taibbi: All the Top Secret Information Trump Is Releasing & What He Should Declassify Next
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Tucker Carlson Show
Matt Taibbi: All the Top Secret Information Trump Is Releasing & What He Should Declassify Next
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Tucker Carlson Show
Sean Davis: Trump Shooting Update, & the Real Reason Congress Refuses to Investigate
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Tucker Carlson Show
Sean Davis: Trump Shooting Update, & the Real Reason Congress Refuses to Investigate
Give it a try at mintmobile.com slash switch.
The Viall Files
E899 Going Deeper with Emmy and Will
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Viall Files
E899 Going Deeper with Emmy and Will
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Viall Files
E899 Going Deeper with Emmy and Will
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Viall Files
E899 Going Deeper with Emmy and Will
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I had a conversation with him and it was probably the most productive a conversation has felt. And like, I'm just such at my breaking point that I will take anything, any effort to And we came up with a big three, which was, I don't expect you to do the deep cleans. I honestly find those days to be very enjoyable.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I put my headphones in, I get down and dirty, you know, and his big three could be helping with the dishes, taking the trash out and like just general pick up your clothes off the floor kind of thing. That conversation was probably two or three weeks ago. And I felt like it was a very tangible, he could, that was a three things he could check off and it still hasn't gotten any better.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And he has not ever touched a dish. He only takes the trash out if I ask. He is, I want to also say like kind in a thousand other ways, but like for some reason things can never be 50-50. And I've asked plenty of times for, you know, a little bit of help and whatnot and don't get any.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Uh, I don't want to, I really don't, but yeah, you want him to help out.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yes, you're totally right. And you're, when you say like, it is almost just a slap in the face at this point, if he doesn't do it, because I, You know, it's almost embarrassing for me at this point that like I have a boyfriend who I'm begging and pleading for help. And no matter what I say or do, he knows that I'm not going to go anywhere.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And yeah, I think you're right that it does need to be something drastic. I don't want to break up and I don't want to move out. But like, what other option do I have? You know, because clearly his words don't have any value at this point and neither do mine.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. Yeah. I don't, I've really struggled with like where to go from here. Um, but I, And I've wanted to avoid any breakup ultimatum talks of any kind. But I think it's at the point where that's kind of just what I have to do.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like I said, I told him we had a conversation about this literally last night and I told him that, you know, I just straight up don't believe him anymore, that his words at this point hold no value to me when he says that he'll do something different because they haven't changed in the last four months. So why would it change now kind of thing? And that I just don't trust what he says anymore.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. Like any household responsibility, whether it is paying utilities, taking the trash out.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And it has started to fester into every other aspect of our relationship, like things that we we never had a problem with our sex life before. And now like, why would I want to sleep with you when I'm tired and exhausted? the last thing I want to do is like touch your penis. I can't, I can't do it. I'm tired.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And he's mentioned, you know, in the same way that I feel like I'm not being listened to or anything like that. He does feel like I just nag him all the time and that I'm so hyper focused on it. And he feels insecure because we don't have sex as much as we used to, you know, and I, and I've told him like, yeah, I'm probably not a joy to be around. I'm probably a bitch half the time.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
He feeds the dogs. We share the finances. We're very intertwined in a team when it comes to those things. But even just the simple task of like, hey, the Wi-Fi is due and hopping on there and doing it, that is something that falls on my plate. Or if we just moved recently, trying to communicate with landlords, things like that. Those are all responsibilities that I take care of.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
But like, I don't know what you would want me to do any differently. Like until things get better, I am going to continue to be frustrated and it's going to just get worse.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
He agrees. He's never told me that what I'm saying is wrong. That's the hard part is he doesn't ever disagree with me on anything. It's very annoying. And I've told him I almost feel crazy at this point that my expectations are so far out there and unobtainable that I literally think I'm going insane because I must just be such a crazy, clean freak. girlfriend, whatever.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And I know I'm not, but I told him that you make me feel that way. And he's like, well, that's not my intention. And, you know, I never want to make you feel like you're crazy and your expectations aren't too far out there and it is doable and I will do better. And it, yeah, those words are just so nice to hear, but they don't mean shit anymore.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And usually if I say something, he will like, I'm like, hey, trying to clean things up around here. Do you think you can maybe do the dishes? And, you know, I roll and he'll go up and do it. And that's great and all. And yeah, that took it off my plate today. But what happens next week and like constantly having to ask for help gets very, very exhausting.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like he's never anytime I ask, he will do it. But I don't want to have to ask anymore.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
do it which one would you choose that sounds like a miserable life i would probably opt to break up if i knew that that was what my future was going to be i would opt to break up even if he what if he jumped right up and said sure no problem when you asked still seems frustrating still seems like i'm his mom And maybe that's unrealistic. I don't know. But I'm sure not. It's not unrealistic.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And I think there's blue and pink jobs of how silly that sounds. But if I'm going to clean and do the laundry and whatever, that's fine. But go change the oil in my car. If that's what it is, or hang the shelf, or do the things that if you want to be a man, do the things that a man does. But the problem is, is that I am independent and I handle my own shit. And
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I've told him, I was like, if you don't want to clean and you don't want to do that, that's fine. But when it comes to mowing the lawn and changing the oil in our cars and things like that.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
At our last rental, our landlord mowed it for us. And at this one, there's someone else that now mows it as well, which is good. I guess that takes something off of, but just in the concept of life, like To me, if I'm gonna do everything else, those are some other things that you could do. Or clean the garage, maybe that's your job. But at this point, they're all my jobs.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah, I would. And like I said, in every other aspect of our life.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I feared that that's what you were going to say.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. I don't think you're totally wrong. And I do think that he thinks I'm a clean freak. I promise I'm, I like a clean home. I do, but I'm not, I have three dogs. They sleep in our bed. They sit on our couch. They drink out of our toilet. Like there are dishes in the sink sometimes. And that's cool. Like I'm not a freak by any means. I know I'm not.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Uh, but sometimes it like, he makes me feel like I am.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like, okay. So I told you we've been dating for a year and a half ish. Valentine's day was what a month ago. Yeah. The first time he ever cooked me dinner in our entire relationship was this Valentine's day.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
It was fine. It was steak. Yeah. And if that's what, and I've told him there's nights that I work late, later.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. I would love that. Yeah. I, there's nights that I work late and whatever. And I've told him, you know, if I, work from eight in the morning until nine o'clock at night, it'd be really nice to come home.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
He is truly like such a kind person. human being. We are such a good team together on every other aspect of life. Another little background is we both work at the same company, um, kind of on different sides of it, but like we do that very well together. We live together. Well, our families blend together.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And it could truly at this point, if it was Kraft mac and cheese sitting there waiting for me, like I would be over the moon at this point because like, it's just one thing to take off my plate, you know?
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Well, he's kind to his nieces and nephews and, you know, like he goes out of his way to be just a good person. He really is. So I don't know why this simple task of just like being a team in the house is so hard.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cleacacacacacacacacacacac cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cleacacacacacacac cle Athlet cle cle Athlet Athlet cle cle Athlet Athlet cle cle Athlet Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac cle cle disputos disput disputacacacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputosket
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And I think like communication, like we do very well on too. We, he's very much the kind of person that if we have an issue, I can feel comfortable like bringing it up. We sit, we chat about it, none of those things. But then when it comes to this, it feels like it's in one ear and out the other. because there's no action to follow, if that makes sense.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
The bed, broom, and the... The budget, right?
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
To be quite frank, I think that his mom has always done everything for him. I actually had a conversation with his older sister about this. Truly, I was at my breaking point, came to his older sister and was like, here's where we're at. Do you have any insight? And she was like, growing up, he never had to. My mom did everything for us. She does the dishes, she handles things, and she...
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
We live in the same town as his parents now. And they she still does the same thing. You know, like if there's something that maybe I can't handle that day and he thinks he doesn't have time for, like his mom will just drop everything and go do it. And so I think it's just, he's never had to lift a finger. And so here I am, like, I truly have begged and pleaded in every way I can.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I've been angry. I've been sad, like everything. And it just feels like it's in one ear, not the other. I mean, like this, we've, we've had a hundred conversations about it and I kind of get the same response every time that it's okay. I'm so sorry that you feel that way. I will do better. I will be better. I like, I will. And then a week, two weeks goes by. I'm still kind of handling everything.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And I've tried to give him plenty of like opportunities, you know, like leave the dishes a little extra long and see if anything changes. And it just doesn't. And I think it's just because he's never had to before.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
No, that's my fear is, you know, I would like to be a mom someday. And like having the responsibility of that on top of handling everything else scares the shit out of me.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
No, I would like to someday. I'm telling you.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. No, I think it would just make it worse.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
very 50, 50, it's just the act of like hopping on and doing it. But I have told him like, you know, Hey babe, can you run down and get this title thing figured out for, you know, my truck or whatever the case is. And I've straight up just said, no, I work and I don't have time.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like, and I have told him, and sometimes it feels like he's just adding more onto my plate, you know, of even the smallest, he can ask me, you know, where's the forks at
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And my knee-jerk reaction at this point is just to be like, I don't know, you fucking find them yourself kind of thing because it's just festered so long that the simple tasks, I'm just like, if you did the dishes, maybe you would know.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I don't know. I think that's what I'm having a hard time with. Like I said, he is such a good person in so many other ways. So I haven't wanted to ultimatum him up until this point because I just think it seems dirty to me. I don't know. So I'm just having a hard time deciding, like, when do I draw the line, you know?
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And I will say I have told him like, this is not a situation that I'm comfortable like continuing forward with in the future. I will not marry someone that can't. Help.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I just won't do it. Uh, probably about a year and a half. Okay.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Uh, we just started it, so it won't be up again until next February.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Good. My name's Ryan. I'm 24 years old and my boyfriend can't do the dishes.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I've definitely, I guess I don't know if I've voiced this to him, but my own personal thoughts have slowed down a lot on my engagement timeline solely for these reasons. I'm a pretty self-aware person, I think. And so I've kind of halted my brain on moving forward with a
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
engagement like i truly think if he asked me tomorrow i would probably say no um just because i there's not been any actions to follow up his words okay that's good to know yeah i hope so i yeah i don't want to marry someone that can't help so i just don't like is this something that he will grow out of or is this definitely is you know well it's who he is today and i don't think he'll grow out of it he's certainly capable
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Little context. We've been dating for a little over a year. We did like move in very quickly. I would say like within a couple of months, it was just the most practical thing at the time. So kind of from jump, I'm a homemaker. I cook, I clean, you know, that's just who I am. And you're in the honeymoon phase. You want to be sweet and do all those things. Now it's been like a year and a half.
The Viall Files
E877 Ask Nick - Married To The Mortgage
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Viall Files
E877 Ask Nick - Married To The Mortgage
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Weekly Show with Jon Stewart
History (and Trump) Repeats with Jon Meacham
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Weekly Show with Jon Stewart
History (and Trump) Repeats with Jon Meacham
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
This Past Weekend w/ Theo Von
E558 Katt Williams
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
Unfiltered Soccer with Landon Donovan and Tim Howard
USMNT vs Venezuela Recap, Everton Shock Spurs, and the Worst Manchester United Team Ever?!
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike Big Wireless, is to not be a raging a**hole. and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
Unfiltered Soccer with Landon Donovan and Tim Howard
Promotion and Relegation with Adam Crafton
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.