Shayne Topp
Appearances
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Hello, welcome to Smosh Mouth. I'm Shane.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What runs water? River. Has a mouth? River. Babbles? A brook. Trivia night at a bar, you're just yelling out the answers.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Are you even allowed to go? No, but not for the reasons you think. Trivia night is tough because they cover such different categories. I'm just sweating there with a blank page. I'm like, not a single Pokemon question all damn night.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You need to assemble a team. I've thought about this.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You need a team, because we have people who are- Are you calling in a team right now? You need movie people. You need music people. You need history people, like 20th century history. So that's going to be Ian.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's like, our next category is sad history.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And you need pop culture people from the past 15, 20 years. Okay. So you kind of need a range of- Types of people. You're kind of just describing Smosh.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Honestly, Smosh could assemble a killer team. Nick Fury.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's going to be the letters. I just need the seconds, minutes. Is it? I don't. I'm going to be worse at this than you. I'm not good at riddles. Especially if I'm a visual person. You need to read the question and the answer and then you'll get it. Can you repeat it one more time, please?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Right. Um... Uh... Circles. Cycles. No. You can just go outside if you want.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah. Or is this going to... I feel like it's the letters. It's going to be like, ah, second letter E. It's not syllables, but... Warmer?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's the letter N. You clocked that it was letters.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It is in seconds, the letter N, minutes, but not.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
We could do that. You don't even have to pay me. I'll just come in and do that. I think we'd do that at first, and then I actually think you would love watching those games because there's so much mystery.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The doctor was the mother. Roosters can't lay eggs. No. Wait, sorry, one more time. No. He's a baldy McBalderson.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
A pound weighs the same whether it's feathers or gold. No. Okay. Stop that now. Steel is heavier than feathers.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Your name? Unless you're me. And I look in the mirror and I go, Shane.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's your name on DVD, special edition, extra features, final answer. Sorry.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I've been through the desert on a horse with no name. I love that song. That's actually one of my favorite songs. It's a really great song. Do you guys want to know something like deep lore secret about me that I don't tell people about?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Sometimes if I'm hearing that song when I drive, I switch it out in my brain to a horse with no bones and I think about a horse just sort of like flopping around like a tumbleweed to a very serious song and it just makes me giggle.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I don't know if I told you guys I'm on new meds.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What's happening? I'm sorry. When is it time in society for a man to do a riddle?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I can't. I also think Dark Souls would get you because you're just the right level of fun competitive. Where Dark Souls is really hard, but you would be like, I have to try it again. I can get past this. I have to try it again. I love that. You would definitely enjoy watching. Dude, you would love watching Bloodborne. I think we just described hanging out.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Railroad crossing without any cars. That's a station. A railroad station.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
T-H-A-T. Oh, wait. Can you spell that without R's? Give me a break. Ew, I hate this. Ew.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Old mouthless Tony, which I think Angela probably took care of at some point. What? Angela takes care of weird dogs, right? Yeah, she does.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Bulldog on a summer day. Pierre. A hot dog. Give me a break. Hot dog was the answer for both? Yeah. Pretty sick.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
There's ten more dog riddles, and you're never going to believe the ninth one.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
All right. So now that Damien has the iPad, we're not going to get through any riddles.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Okay. Let's see if we can solve one more riddle. What kind of room has no doors or windows?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Has no doors and no windows. Panic room. Incorrect. That has a door. That's just factual.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's got to be like, what's something that's room, but it's not a physical room? Like, you know, leave room for emotion or, you know. The answer is holding space for defying gravity.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, no, no, no. That would be awesome. Also, like, I don't know when these come out, so I'm like, that's already an old joke. Wicked riddles. Wicked riddles. Riddles from Boston. Wicked riddles. So what kind of room has no doors and no windows? Oh, I've heard this riddle before and I completely forgot.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
A butt room. What? What? Oh, a broom. A broom. You know what? A butt room. You're on the right track.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
In terms of lateral thinking for this riddle. I mean, I can give you the answer at any time as well. I give up. I give up. A mushroom. Give me a break. I know. Some of these are... I'm going to skip past the food ones. What?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's add in mushroom. I'll write them. It's not a type of room is what's confusing about it, right? It falls under the mush category for sure.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That just pisses me off. How can five plus nine equal two? You know, they just figure it out.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's a Neil deGrasse Tyson one. Oh, well, it's two numbers. It's two numbers. Now, how can five plus nine equal two?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I was like, you don't even have to pay me. I'll do this. And I'm like, wait a minute. That's called hanging out. I'm playing Lies of P right now, actually. How's that? It's great. It is the spiritual successor to Bloodborne, except you play as Pinocchio, literal Pinocchio.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
There are two numbers, man. On account of those two numbers. And I was like, did that teach anything? This is your thesis review. What the hell? Didn't do it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
We also got to the harder stuff. At the beginning, it was very like. How can five plus nine equal two? Would you like the answer? Minus 12, you know? Because there are two numbers. Yeah. When discussing time. Five plus nine hours is 2 p.m. Give me a break.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I use military time, so it's hard for me to decipher that. It's already 15 past 14. Time for me to get to PT. I'm on fire watch tonight. Why do we have the hard one? A couple more and we'll move on to riddles for adults.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
How are you supposed to survive when minimum wage doesn't pay your living needs? Okay, we're in numbers ones, and if you want me to move away from numbers, that's fine too.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
We'll do one more numbers, and then I'll move on from that. I love numbers ones, because one's a number. If two's company... Go away. Three's company is a great show. Three's company is a great show. If two is a company, and three is a crowd, what are four and five? Too much. I'm saying.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Four and five? If two's company and three's a crowd, what are four and five? Numbers. That's great.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
They can't show this episode to aliens or they won't come down. They're like, no. Or they'll give up on humans. We'll give them another thousand years.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You're going to be mad. I'm going to be pissed off at this one. Fours? The answer is nine. Give me a break. Four and five are nine. Okay. This is why I don't want to do numbers. By that logic, your answer's correct, too.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
They are numbers. And they are numbers. Some of these are puns. Let's see. Okay. What has a thousand needles but cannot sew? Porcupine. That is correct. Wow. Yeah. You haven't given him a shot.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That's his sword. Yes, actually. You have to tell lies and then hit people with it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The alphabet goes from A to Z, but I go from Z to A. What am I? Zebra. That is correct. We found the niche.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Are there actually adult riddles? Oh, yeah. We've got a bunch more riddles.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I was like, I'm going to have to really slow down through this list. Car insurance. No, we have plenty. Guys, we have one from Reader's Digest. We have one from Woman's Day. We have one from Good Housekeeping.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yes. It was really cool. I don't think we ever had it, but I remember, like, just being in, like, whatever checkout aisle in the grocery store.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's like Sailor's Fish Wife. I wish that was a soap opera. It's gotta be. I was almost on a soap opera. Like, Days of I... Okay, Damien, I feel like you guys have probably heard this one before. The person who makes it has no need for it. The person who buys it has no use for it. The person who uses it can neither see nor feel it. What is it? Nothing. The person who makes it has no need for it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The person who buys it has no use for it. The person who uses it can neither see nor feel it. What is it? Oh, a name. Just kidding. No. Poop. No. It's also poop. I think you're going to be mad, Damien. I think you're going to wish me.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's not hope. One more time. The person who makes it has no need for it. The person who buys it has no use for it. The person who uses it can neither see nor feel it. What is it? The person who makes it has no use for it. The person who makes it has no need for it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Great. Guys, before we get into what we're going to do today, which is solving riddles. That's why I'm wearing glasses. You got to be smart. That's why. Dark souls.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The person who buys it has no use for it. The person who uses it can neither see nor feel it. What can you make? What is it?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's the buying that makes me, because I'm like, oh, we make all kinds of things, but it's the buying.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I haven't seen that. I'm going to have to go Google that.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Jamie, can we get that up on the... Do you give up?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The person who buys it, though. I feel like I will be frustrated, but go for it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
My life is like a movie, man. I keep getting evil clones. It sucks. It's just how it goes, you know?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No. I'm kidding. That one I disagree with. Let me hear. Why? I'm working on my own coffin. And I'll need that one day. Is that been your big project that you keep talking about? It's one of the ones I won't let you see.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I think if you buy it, you can just have it. Okay. No, my meds are for my tics. I'm not blinking as much. It's pretty cool.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You think they just took it? They either made it or they bought it, and they need it. Check this out. You walk into a room that contains a match, a kerosene lamp, a candle, and a fireplace. What would you light first? The room? Because you're... Hold on.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
We found a bunch of websites with a bunch of riddles. So we're going to go through and just see how many we can just figure out. Just for fun.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
A candle and a fireplace, what would you light first?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Oh. Whoa, what did I just say? I like this one. If your uncle's sister is not your aunt, what relation is she to you? I don't like this one. What? Your mom. Yeah. Yeah. Yeah, man.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The answer was your mom. Yeah, I actually didn't say that right. Your mom.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, that's your once removed, right? There's that second cousin.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I don't know. I just don't talk to my family. That's helpful.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Does this have challenging riddles? Challenging riddles, and then it goes down to easy riddles.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The Paul brothers walk into a room. Which is heavier, a ton of bricks or a ton of feathers? Brex, because Brex Harry Arden, fellas. I don't get it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, I have to show you. It's a sketch from a Scottish comedian, and it's just him having a breakdown about a very basic riddle when people are trying to explain it to him.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
He's like, what's heavier? A kilogram of steel or a kilogram of feathers? That's right. It's a kilogram of steel. Castile's heavier on feathers. Then everyone's trying to explain to him, like, no, they're both a kilogram.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Thank you. It was when I got there. But thank you.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
How much dirt is in a hole that's two feet long and three feet wide? None. It's a hole. That's right. Huh? Talking about hole faces here.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It is a hole, but you take the dirt out of it to make it a hole. And if you put the dirt back in, it's not really a hole anymore. I guess you can't really make a hole in the ground. Yep. You want to read some? Sure. I didn't look at the internet. Do you want to read some? You want to read some too? You read some.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
If you get to the end of these, you can move on to a different list.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Okay. This is, I have cities, but no houses. I have mountains, but no trees. I have water, but no fish. What am I? Map. Yes.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Can I tell you a sketch idea that I have?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That I've had for a while. It has to do with maps. So have you ever heard about people being like, oh, we're going to throw a dart at a map and we're going to go. So it's like, okay, honey, for our anniversary gift, take this dart and I want you to throw it on this map and we're going to go to wherever the dart lands. She's like, oh my gosh, okay. And she throws the dart and it perfectly lands.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's like, oh, it's on Los Angeles. Oh, let's get closer. Oh my gosh, that's crazy. It's Derek's house. Yeah. I have to go to Derek's house. I guess we'll both go. She's like, I guess I'll probably just go myself. I think I'll just go by myself.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And she's like, yeah. Because when I heard someone do that, they're like, oh, he threw it and it landed on Italy. I was like, that's lucky. I was like, what if it landed on your own city? What if it landed in the middle of the ocean? What if it landed in Milwaukee and you just go there after your anniversary? It was Chernobyl and we kept throwing more darts and it kept landing on the same dart.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Somehow like Robin Hood splitting it into Chernobyl. You want to share Noble? That's hilarious. This one's fun. It's also, it shows up in the game The Lies of P, which is just like Bloodborne, but with Pinocchio.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What gets shorter as it gets older? A person. See, that's what I said. A person does.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Can I say something about, this reminds me. I wish you would. Riddle related. Some of my favorite movies, the Indiana Jones movies, the OG trilogy. I was rewatching Last Crusade. And there's a part where they're in this library in Italy. And it's like, there's like this whole riddle. It's like, and X marks the spot.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Okay, from here on out, for every episode of Smosh Mouth, I need to have like 10 basketballs here.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Every time I crush it on this podcast, I need to grab one and just...
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Then you get to have 10 of something too.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
At the end of every episode of Smosh Mouth, you're just so drunk and I get traded to the Mavs.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
In exchange for first round picks six years from now.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You're like, yeah, you got traded to dropout, but they get first round pick for six years from now. It's crazy.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Just a couple of dudes. Fellas. I like this one. What do you lose the moment you share it? Secret. Yeah.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The artifact. The artifact. The amulet. The amulet. I think I unfortunately got that from the chosen because it's been a thing for me for a while where I'm just like, oh, dude, the amulet. Like, I need the amulet. You've said the amulet for a long time. I think I took that. I definitely lifted that from you, and I'm proud of it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I... I don't think so. I think you've been mentioning the amulet since I met you. So he stole. So you stole. Wait a minute. Borrowed. This is actually very important. Did someone look like me ask about the amulet? Shit. My God, he's escaped. We gotta get to Kosovo.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Sob, you know, what's crazy is I did imagine your space work was so good I thought it was a glass goblet when you said crushing with your hands. Yeah No, I did. Oh my god.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yes, you got it. What is taken before you can get it your order for at a restaurant? Okay, what is taken before you can get it?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah. What is taken before you can get it?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
My freaking virginity, dude. Ew. Let's fucking go.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I lost my virginity, so now I'm good enough so that you can get it. Okay. Oh, no. Being for real now.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
This is a weird question. Test results. I also think order at a restaurant.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I'd say it's like your food at a restaurant. Your order.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
But I'm saying he's right. Yeah, and I agree with Shane.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Well, then I give up. Email the Riddler.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Not with how fast digital stuff is. Haven't you heard of live streams? Yeah. Zero latency. Read the next one.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Or 10, like X. And he's walking around this library and he's trying to figure it out. And suddenly he's like, wait.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's now worse. It's not about the riddles anymore. It's just that we're messing with... It was never about the riddles.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
On the ground. A stump, but never dirty. I know. No. What is on the ground, but never dirty? Stumps are dirty. Well, can dirt be dirty in the same way, like, is water wet? No, guys. No. What is on the ground? My jaw. No.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And you guys are like, oh, my jaw. If I can get it, my jaw is on the ground because your mom's your uncle's sister. Amanda's like, do you know why I pulled you over?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
My jaw. Okay, I don't know. But it's on the ground, but it's never dirty. Yeah.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
and he like runs up the stairs and looks down and the entire time they were just standing on a giant x that was on the floor of the marble floor of the library i'm like you guys are dumb i'm like at that point you guys are dumb but that's also riddles literally look down that's riddles that's kind of riddles.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah, look at that. The hedgehog from Sonic. Good job, guys. Thanks. That's a big hint. Sometimes I stand near walls as the sun is setting, and that's where my shadow is. And it's real dirty. I cough on it. You know Pigpen from Charlie Brown? There's always that cloud of dust. You see that in my shadow as well. That's you? Wow. Great.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Also me. Also Shane. When I get out of the bathtub, I'm just a little bit littler.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I knew. You're like, I really exfoliate the bottom of my feet real hard. I'm a Russian nesting doll. I knew. I'm going to move real quick to Reddit. Do it. Am I the asshole for putting my wife in a Saw-like situation?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Where can you finish a book? A typewriter? No, a sentence.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Oh, jail, because you can read in jail, but you're not done with your sentence.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Shit, I'm sorry guys. Sorry. Can you hear a legitimate window break over there? I once lost a friend in middle school because I threw a basketball and was so bad at it that it almost hit him, but I started laughing out of nerves, so he thought it was on purpose. That'll do it. I was just like, no, I didn't mean to. You know what? Give me another basketball. This is our fantasy.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I need to reown this. Here you go, man. Thanks, man. You really have to work through these. If you lost a friend from that, then he was not your friend.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Where can you lose a friend, but in a song? Did we talk about Trevor singing that? That was so sweet.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That'd be awesome. We need to pitch a movie, a horror movie, where every time someone pretends to be you online, there's like, Amanda, fan, whatever, and it's like their profile pic. It actually makes another you in another universe.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
He's really cool, man. He's so good. He's really cool. I hope he knows how cool he is.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The murderer chasing him? The man in the mask.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
But also like we have the advantage of living in a world where that movie exists and you grow up with it and you're like, well, now I know if when someone says there's an ex, I got to look for an ex. That's true. And your shitty ex-girlfriend's just standing in the corner like, I'm supposed to give you something. And that's what it means.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The umpire. The umpire. He's in a mask. The catcher. It's actually the catcher, yeah. He's in a mask because he's home base. But the catcher never really does run the bases, so it's kind of a... Because the man runs the bases, and the man in the mask is there waiting for him at home base to be safe.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
well, if this person is going through something, it's going to be something like, you know, it doesn't matter. I'm good with anything. But then when I throw something out, it's like, well, we had pizza last year. And so I'm like, so I guess it does matter.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I do actually have a fix for that. Whether it's text or in person, you go like, hey, I'm going to put out five food genres, and it's your job to eliminate one. Oh, I love that. So you text, and they'll be like, all right, here's the four we're keeping. I'm like, here's the three we're keeping. Here's the two we're keeping. And I'm like, seafood.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah. It's you gamify. You take out the stress. I love gamifying things to take out stress. I'm happy to do the thing. You do it. Gamify, take out stress. You just keep scrolling into later comments just like, yeah, what the fuck does my girlfriend want from me? There's a riddle.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Take me out of a window and I leave a grieving wife. But stick me in a door and I can save somebody's life. What am I?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I'll read it one more time. Take me out of a window and I leave a grieving wife. But stick me in a door and I can save somebody's life. What am I?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Take me out of a window and I leave a grieving wife. But stick me in a door and I can save somebody's life. What am I? This is the kind that you can definitely get, but it's so clever that I don't even think you'll be mad if you don't. It'll just be like, that's good.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The answer is two numbers. No, I'm kidding. I don't know, man.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That's very clever, and I hadn't thought of that. That's not this. This one is a little more lateral.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah, Cheryl's here. Like, I've been sitting here for 10 years because of the prophecy. Because the prophecy. The extra riddle that they don't get into for that, if you watch like an Indiana Jones deep dive, Italians can't read. That's true.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That's clever, and you're now thinking more lateral, so that's a little more... A lock? No. No. Do you want to know the answer? Yeah. It's, strangely again, the letter N. Take me out of window, I leave a grieving wife. Widow. But stick me in a door, I save somebody's life. Donor. Oh, wow. It's really clever, but I think without reading it, it's a little hard to get. Did you guys know that?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Did you guys all know? Yeah, they did. Did you all know?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
We all knew. We just didn't want to tell you. Here, I'll take this. That was really good. That was good, right? One of the top comments to answer that was, a penis?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
In fact, it's a lot to deal with. What if there's a hostage situation and someone's like, someone better show me a penis through a mail slot right now. I'm going to kill everyone here.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Hey, didn't say saving a life. No good deed goes unpunished.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Oh, thank you. Oh, this one's simple, but I think it's good. How far can you walk into a forest? Until the center and then you're walking out of it?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I'll give it to you. It's halfway. Oh, yeah, halfway. Because you can only walk into a forest halfway, and then you're walking out of a forest.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You got it. Thanks. I don't know what Trevor's up to.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Probably singing the fray. Also, I saw, I think it, cut this if it's not cool, but I think I saw on the announcement for it that he's doing Creator Clash. He is doing Creator Clash.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I know. He's fighting a guy from Corridor Digital, right? That's so cool.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Well, I think he'll train. I think he'll be training.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
We're just gassing up Trevor this episode. I'm going to move back to the good housekeeping. Finally.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Because the Reddit ones, they were kind of starting to be repeats. How can you clean up a room?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Who has married many women but was never married? The priest. That's right.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Guys, get this one. What does a man do only once in his lifetime, but women do once a year after they are 29?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What does a man do only once in his lifetime, but women do once a year after they are 29? Probably like a mammogram.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Like, why is there a library? Wow. In Italy. Before we pull up these riddles, we got to talk about a couple weeks ago, a couple episodes back, I challenged our fans to show Smosh Mouth to animals.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Do they? You're never going to guess this one.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, it's dumb as hell. It's as good housekeeping as it gets. Is it like actually contribute to cleaning the dish? No.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Vacuumed. The answer is turn 30. What does a man do only once in his lifetime, but women do once a year after they are 29?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Because it's like, oh, I'm actually just 30. I'm turning 30. Like, lol. Lol.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Diane, you gotta check this out. Diane. She's like, I told you not to call me, bitch. I heard the best insult the other day about that, where they were showing off the, not to get political, the White House press secretary, who's only 26, and they kept showing photos of her, and someone was like, in what, Celsius? And it was like, god damn! They were like, ooh! I'm like, that's really funny.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
These are so funny. Keep going. That one stands alone. I can't find others that are like that. The cheese. I want to find another one that's fucked up like that.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What is the longest word in the dictionary? Is it just another one where it's longest? No, it smiles because there's a mile between each S. Oh, my God.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Highlights. Highlights. Highlights was great. Highlights was awesome. There was a very big turning point in my life where the allergist I'd go to like once a month, I always used to look at highlights. And then one time they had Shonen Jump, which is like the compilation of like, okay, it's Yu-Gi-Oh and Dragon Ball Z and all that. It was like the comics. And I was like, I think I'll read this one.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Comic strips. Gallant makes his bed on weekends. Goofus sets fire to the neighbor's yard.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And then highlights. Those are like joke riddles, though. Yeah, I wanted to find more of the joke riddles. These are so good. Then go back to animals from the first one. Hey, guys, what two keys can't open any door? A-flat and B-minor.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah. This is also wrong. Piano key? This is also wrong.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What two keys can't open any door? Keys to your heart. What two keys? Keys to your heart. Keys on Van Nuys.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And maybe people have. We don't know. Well, we won't see those pictures. But I was like, I want Smosh Mouth to have been seen by every kind of animal. Oh, that's great. Like a Noah's Ark, but Shane and Amanda's Hubris. But this podcast. We're the Noah's Ark of podcasts.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, you want to know the answer? Chastity Bulky. A monkey and a donkey. A monkey can totally open a door. And a donkey just goes straight through.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I love these riddles. Go back to the first one. The first one had all the animal ones where it's like, which animal cares the most? It's like this one because it loves you and us a lot. Oh my God. It's all those.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
A bear, because they always want to call you honey.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Is that her pen name though? Oh my God, you're so right.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I am a bird, a fruit, and a person. What am I? Kiwi. It's a kiwi. Kiwi birds are so cute. What kind of fruit must have a large wedding ceremony with a lot of guests? Kiwi.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah. Yeah. A grape, because they've got a large family tree. That's pretty good.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You could just say that for most fruit. Like, that one crazy fucking apple. He'll do it, too. What fruit never cheers up? A sad banana. A forlorn banana.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And people have gotten to work on it. It's unbelievable. So we have someone named Nervous Big showed it to a deer yesterday. How freaking cute is that? That deer is just watching Smoshmouth. I love that.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Well, actually, it was that boat trip, and I threw up the whole time. Oh, yeah.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Hey, what fruit is never alone? Can't elope. Bananas, because they're attached. Because they're coming in a bunch.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Grapes, because there's a bunch of them.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Guys, be real. Okay, sorry. I'm sorry. Be real.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Real. I'm sorry. Oh, pear, because they always come in pears.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Why did the citrus tree go to the doctor? Because it was feeling sick.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You've got to be careful about that. You've got to be careful around deer ticks. What kind of foods are the most fun at parties? Oh, I saw this one. I know this one, but I saw this one, so I'm going to zip it. Can you get it, Amanda?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What kind of foods are the most fun at parties? I'll give you a hint. This one's not a fruit.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's a fruit. It's not a fruit. It's not a vegetable. Some people would say it's a vegetable. It's not a vegetable.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It is in relation to the answer to the room that has no windows or doors.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What is the wealthiest nut? I saw this one too. Sorry, when I was scrolling.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You're like, well, you're stuck with me. You nutted.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
User Ucius on Reddit showed it to their guinea pigs. One of the guinea pigs is watching.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Wealthiest nut. Wealthy. Rich also counts for this.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
There's a Chris Rock routine about it. He's not talking about rich. He's talking about wealthy.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And I also... I refuse that answer. I like chestnut.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And I also would say Mr. Peanut because that's generational wealth. He is a brand, but he has a company, and monocles aren't cheap. You're right. Good housekeeping doesn't go there, though. You're definitely right.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The turning 31 was insane. Yeah. Fully insane.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Amanda, when we were talking about this episode, you were like, oh, do I need to come up with riddles? And I was like, sure.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I think the answer is supposed to be like, you know, let's, oh, wait, I actually do know the answer to this one, so I'm not going to take your joke.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Let's see. Diana Rance showed it to her dog.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Are you sure? Yeah. I hope, like, let's never let some shit come between us.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Okay. Yeah, I've heard that one before. Isn't that one pretty sick? Pretty gross. I got a clever one I like. Okay. I would have expected it to be on this list. It's the rich need it and the poor have it. What is it? Love. Nothing. Nothing. Nothing. Rich need nothing.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Banana! I have a joke that I used to say when I was a teenager that was always a hit. Boobies. I used to be like, why is six afraid of seven?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And I'd be like, because seven is fucking crazy.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Oh, that's a bunny. Oh, sorry. I thought that was like a little chihuahua. That's a bunny.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Oh my god, you should do comedy. I want a lot more anti-riddles. Like the Riddle of the Sphinx where it's like what walks on four legs in the morning, two legs in the afternoon, and three at night. And like what is the answer is supposed to be a human because like it's a baby that crawls in two legs and then it has a cane when it's in the night of its life.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
But I just want to be like, oh, that one like the fucked up monster of the sands. They're like the fucked up monster of the sands. That one guy. That one guy. Wow. Tony is very ill, but we like him.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What I like about it, too, is you see this a lot on, like, Smosh games, especially in, like, Deception games. But, like, everyone has different ways of thinking. Some people are more direct. Some people are, like, sound-based. Other people do, like, lateral thinking. So there were ones here where I'm like, I don't get it. That's hard. And you're like, oh, silly joke.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And it's like, oh, I didn't think about it. So we're kind of the dream team. I got the silly joke. We can handle any riddle.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Give us your riddles. Comment your riddles and we'll answer them. Gimme them. Okay.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's a very dark photo. Wow, look at it. The phone was definitely like, we're looking at the TV today. Bumble V showed it to her cat. So we got a cat having seen it. Then a user on TikTok showed it to a magpie. So we can show a screenshot of that. Those remember faces. Yeah. They're going to mess you up.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Thanks, Amanda. Oh, yeah, this was so much fun. We loved having you. Also, I love that we pitched videos that actually could just be us hanging out. So if you ever want to kick it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Just hang out and play Dark Souls. Bloodborne. I think Lies of E might be more Amanda's cup of tea.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
They're going to be into it. So keep showing them to animals. My big request is I want to see monkeys watching. Yeah.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Extra points if the monkey is holding the phone. Why? If the monkey is holding the phone watching Smosh Mouth. No.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I got more. Before we started, we were talking about Resident Evil. We were talking about how fun it is to watch you and Angela play that with Spencer. I was saying, and this is not from like a casting perspective. It's from like an audience viewer perspective. When I watch those, I'm like, I want to do that. I want to show you the games. Not as though like Damien of Smosh should do that instead.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Step one's done. They also love taking apart scarecrows. What? What? Especially if they can fly. Yeah. And the Scarecrow's like, whoa.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The Wicked Witch was one of my hear-me-outs.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And they fix them. You know what? They'll update your phone even if you don't want them to.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
So the fawns can do it and just fix a jukebox, but a monkey can't fix my camera.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I would request, if we're going monkeys, have you ever seen the one that's like a perfect sphere and it just sits there?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And you present him with fruit. Yes. Like an old lady.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, maybe. I guess I'm not up to, monkeys have never been my thing. He could be a man. We don't know. We got a capuchin, that's a bonobos ape, and that's just Richard. That's Richard, that's a guy. He's like, they'll never know. This monkey's so funny. He's gotten so accustomed to his life. Wow. I would request, I think having any kind of actual attention of sea life is going to be difficult.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It could even be a sea mammal. I'll give you that, but like...
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I want one of those deep sea submarine videos. They're like, oh, we got eyes on this. I've never seen one like that before. Is that a nautilus? It's watching Smosh Mouth. Smosh Mouth, yeah, literally. If someone can show Smosh Mouth to a live angler fish, hundreds if not thousands of feet deep into the ocean.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I've got to call in a favor, and I'm real sorry to Italy about the thing I said before. I did eat a football fish while I was in Italy, and that's like an angler fish, so I'm assuming it doesn't die and then they pull it up for 10,000 feet or whatever. I think it's got to have its last few gasping moments on land. No, they have to be alive. I know, I was like, where am I?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I have a website here, 105 Riddles for Kids. We want to solve... What a transition. These are for kids?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
The episode is about solving riddles, and I have some riddles. We're going to start easy, so 105 Riddles for Kids. Just in case these are really easy, are you going to be mad if we're like... No, I think we could breeze through a lot of these. I'm telling you... It's going to get harder.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Okay. I'll let Amanda. Amanda, I've got the first one for you. This is the first one under easy riddles. And if I know it, I'll be quiet, but I'll also go. Okay. Are you ready? Sure. How many months have 28 days?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That's not a riddle. That's like a. How many months?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What's the first president of the United States? You're not asking me that, right? No. That's not a riddle.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I mean, like, I'm like, oh, those are my friends. Because we're just...
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
That's incorrect. I don't know what to tell you. That's wrong.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I said, how many months have 28 days? One. All of them have 28 days.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
See, I think that one falls into the realm of like, yes, it's a riddle, but it's more of like a tricky, it's a trick question. As opposed to like, I was expecting like, greater than four be I, but six is too far from my I. What am I? I'm like, the number five? Like, yeah.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I've got some more. These next ones are a little more riddle. Sure, sure, sure, yeah. Okay. I have many teeth, but I can't bite. What am I? It's a comb. It's a comb.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I'm not gonna be this good at it either.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Do you want me to not do that? No, do it. What can you hold in your right hand but never in your left? Your left hand. That is correct.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
There's so many games too. I mean, a pitch that I threw out a long time ago. We'll see if we do this or something like it. Damien, you and I sitting down with Amanda and letting her play Dark Souls, but you and I can't say or do anything. We have to just sit there and just let you play.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
You get to have your moment in the teen drama movie where you take off your glasses and we go, Egbert?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
And you've actually been so good at riddles the whole time. Amanda. Amanda.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
There's only one word in the dictionary that's spelled wrong. What is it?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Hey, what's full of holes and still holds water? Your fucking story. How? Your alibi. Your alibi.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Holy water? I... I'll give it to you. I respect that.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, because at first I thought it was a cup because I'm like, there's one hole on the top and a straw also has two holes. So there's one on the bottom or one hole depending. But then it's a sponge. It's a sponge. Yeah. What has a head and a tail but no body? Coin. Yeah, there you go. Sorry.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What can fill a room but takes up no space? Silence. Noise.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Thank you, Amanda. Bring out the guest. No, thank you. Hey, welcome. And another Damien walks down and sits down. If I had a nickel.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
What can you catch but not throw? A cold. or these hands.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I mean, I'm going to be so real with you. You do riddles for fun? No.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Riddles? It just comes with the territory. I'm not going to figure out necessarily who's mad at me and when, but this shit is on lock. That's incredible. That is incredible. What two things can you never eat for breakfast? Lunch and dinner. There you go. I don't know. I've had struggle meals. I guess as a social person, I'm not going to do well. You got the light thing. Remember Ron?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I don't know why the light on this iPad goes in and out. That can fill a room, but it doesn't take space.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
It's also rain, Wilson. Gravity sucks for him.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Yeah, it's hard. What goes up and down but never moves? A roller coaster or an escalator or the stock market. But it moves. Yeah, what goes up and down but never moves?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No, that moves. Up and down. What goes up and down but never moves? The tone of your voice. Yeah.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
No. But it doesn't move. It's not changing locations. What goes up and down but doesn't move?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Shane, is it your anger? Amanda, get out the letter that we both prepared. You don't get it. It's a stairway. No. No.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Because that assumes that you're a human, and if you're a cow, you can't go downstairs.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Well, we can say stuff, but we just have to be chill and just let you... Here's the stipulation. We can't help you. We don't backseat game. We don't tell you what to do. I don't know if I can help not lore dropping. Because... Dark Souls does so much environmental stuff where I'm like, see that dead body in the corner? Actually, that implies that this entire order of holy figures.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Their little legs. Their little legs. Think of them. Which question can you never answer yes to? I think I disagree with this one. I fully disagree with this one. This one's wrong. Which question can you never answer yes to? Something like can you answer no or is this question right or are you lying? Is your next sentence a lie? Oh, is your next question a lie? No.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I think this is definitively wrong. It's are you asleep?
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I have answered yes to that, and I have not remembered it because I was asleep when I answered yes to it.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Does anyone else want to take the... Yeah, I do.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
If you want to scroll down further, I think they get a little more challenging.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
Go to tricky. Yeah, if this is not Saw level where you have me hooked up to a device... And you bring up something from my past.
Smosh Mouth
#82 - Solving The Hardest Riddles We Could Find
I didn't know there was more. I'll do Beopardy rules. You gotta get through it.
Smosh Mouth
#83 - Don't Say The Secret Word...
Who is it that showed the guy's nudes? Who? At lunch.
Smosh Mouth
#83 - Don't Say The Secret Word...
You guys weren't there? No. Somebody was like, I didn't know about this.
Smosh Mouth
#83 - Don't Say The Secret Word...
Selena's making marks on her notepad. There's some secret words. None of you guys have said my secret word, and I'm totally screwed. I know what the word is. Nude. Penis. Don't say it. I think that first word you said is it. I think that's 100% it.
Smosh Mouth
#83 - Don't Say The Secret Word...
Is it Jeff Probst? I don't... That would be genius. Like you on this show. Damn. You brought it up. Wait. It's relevant.
Smosh Mouth
#83 - Don't Say The Secret Word...
My secret words are douchebag, civ, C-I-V as in civilization, Anthony, minivan, and wine. Bonus points for Cabernet Sauvignon. My words are dynamite, George Bush, meme, island, and Jeff Probst. Or however you say his name, Probst.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yes, he did. Where? You haven't seen it? No. They're old. They're old school. Okay, so I said... Like, they're old school. Like, they're... You know, it's like... I just want to say, for HR purposes, I did not... I refused to look at it because it was at work. But then yesterday... Actually, I shouldn't promote people because I think that was a leak. So maybe I shouldn't be promoting that. But...
Smosh Mouth
#83 - Don't Say The Secret Word...
I gotta say, I think it was pre before everyone started taking cell phone nudes. Because it definitely feels like he set up an old Polaroid. It definitely seemed like he set up a camera on a table. How does he have the time? He's in Fiji 24-7. He's just standing like this. Oh, no. It is full body Jeff Probst.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's just fully naked. And he's just standing there with the whole hog out. He's shown whole hog.
Smosh Mouth
#83 - Don't Say The Secret Word...
That would have been a good one. That would have been a good secret word.
Smosh Mouth
#83 - Don't Say The Secret Word...
My favorite thing on Survivor is at the end when it's like, all right, it's time to go to the final thing. Tribal council? He leaves the island by going through the jungle with a machete and he gets on a helicopter and then he jumps out of the helicopter into a plane and then takes the plane to LA and parachutes out.
Smosh Mouth
#83 - Don't Say The Secret Word...
I can't believe. So you've seen every season of Survivor.
Smosh Mouth
#83 - Don't Say The Secret Word...
I like. Is it still like are people still starving in the show? Because like I remember like.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, like you would see those before and after photos of people on Survivor and it is shocking.
Smosh Mouth
#83 - Don't Say The Secret Word...
You're admitting it. I just dived into my deepest... Ian is so far in the lead right now. We have to really... None of you guys are going to say my words.
Smosh Mouth
#83 - Don't Say The Secret Word...
Amanda's words are like cardamom. Blue, Purple Mountain Majesty.
Smosh Mouth
#83 - Don't Say The Secret Word...
Love is Blind sucks, though. I think I said this on the podcast before, but what I appreciate about, because Courtney watched all of Vanderpump Rules. I never watched that. I think she's on the final season, right? Wow. But it's a spinoff of Real Housewives, right?
Smosh Mouth
#83 - Don't Say The Secret Word...
And there's all these reality shows like Real Housewives and Vanderpump Rules, which are, and I don't mean this in a bad way, they're trash TV. You're watching a bunch of douchebags duke it out. I don't mean it in a bad way, it's trash. But it's fun to watch. And then the reunions, they really call everyone out. They make a point of being like, you did this shitty thing.
Smosh Mouth
#83 - Don't Say The Secret Word...
You need to answer for it right now. That's the sell of it. But with Netflix, the way they're doing their reality shows pisses me off so much because there are heartwarming reality shows, right? That's Extreme Home Makeover. Love on the Spectrum. Yeah, like they have these shows where it's like, oh, this is about feeling good and understanding people.
Smosh Mouth
#83 - Don't Say The Secret Word...
They try to sell Love is Blind as a heartwarming show, but it is trash TV. It is so nasty. It is absolutely trash TV. A lot of the contestants on Love is Blind are just as bad.
Smosh Mouth
#83 - Don't Say The Secret Word...
There hasn't been a season of Love is Blind where I haven't seen someone just outright manipulating people and then not getting called out on it. In the reunion, they act as if it never happened. And it's so frustrating to watch. I think the reunions are the biggest miss on Love is Blind because... One of my favorite things about Real Housewives of Salt Lake City is the reunions.
Smosh Mouth
#83 - Don't Say The Secret Word...
Andy Cohen goes in. They get into every little piece.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's the best. One of them gets arrested on camera. Yeah. They full on arrest her. So she doesn't get arrested on camera because she gets some kind of tip off and then mysteriously leaves. And then Homeland Security and the NYPD show up in Salt Lake City and they're like, we're looking for Jin Shaw. And they're like, we don't know where she is.
Smosh Mouth
#83 - Don't Say The Secret Word...
You said... You said... Beyonce. Beyonce. Fuck. If you're trying to guess her secret words, you're going to say them, and then she's going to get points.
Smosh Mouth
#83 - Don't Say The Secret Word...
So like she gets like a call and then she's like, she makes up some bullshit and she's like, oh, Sharif's in the hospital. I have to go right now. And then they get footage. They get footage of the police raiding her home with like assault rifles.
Smosh Mouth
#83 - Don't Say The Secret Word...
So she was running, allegedly, or was she convicted? No, she was convicted. Yeah, she's in prison. So she was running a telemarketing fraud scheme that was defrauding old people.
Smosh Mouth
#83 - Don't Say The Secret Word...
And because she lives in this giant mansion and her husband is like an assistant coach to like a call it like a like not like a high, not like a D1 college team, but like a smaller college. So it's like, where did they get this money? I don't know. That's how. Don't mess with old people. And the best part is, like, so they were all going to go on this trip to Vail, I think it was.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. And they were all going to get in this. Mark it down.
Smosh Mouth
#83 - Don't Say The Secret Word...
Anyways, so they're all going to get on this bus to go there. And that's when she like as they're like loading in. That's when she gets a text. She leaves. So all the other women decide to still go on this trip. And as they're going on the trip, all the news is coming in. So they're reacting to it in like real news about her. Yeah. And they're like, oh, I knew something was wrong.
Smosh Mouth
#83 - Don't Say The Secret Word...
And then this one woman who always makes everything about herself is like, I got to call my lawyers. I got to call my lawyers. You cannot make this shit up.
Smosh Mouth
#83 - Don't Say The Secret Word...
Angela's locked in on all of this. Oh, it's how she unwinds. To a wild degree, because as Courtney was watching Vanderpump Rules, she would watch like a specific episode and be like, yeah, this thing. And Angela would be like, yeah, that episode where this happened and they said this to this person. I'm like, you know this all verbatim. And it was...
Smosh Mouth
#83 - Don't Say The Secret Word...
I didn't hear about this because I'm not as locked in on reality TV, but they got to a season where Scandaval happens. And I guess Scandaval is just this huge... Scandal. Yeah. So one of the main guys on Vanderpump, Tom Sandoval, who's just the most ridiculous human you've ever seen. I now know this watching Traitors.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's truly like, he's locked in, but on all bullshit.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. I was just like. Wearing like a bowler cap or something.
Smosh Mouth
#83 - Don't Say The Secret Word...
Like, what are the names of the members of the Backstreet Boys? Ooh. Ooh.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's just so... He's an alien. Like, I truly believe, like, Tom Sandoval is an alien. But so many women are upset with him because... Oh, yeah, because it's revealed in this one season that he was having an affair for, like, eight months with one of the other cast members. And they, like, they... So what happens is they find this out at the end of the season.
Smosh Mouth
#83 - Don't Say The Secret Word...
They discover that... On camera, right? Yeah, basically it's kind of revealed on camera that he was cheating on his partner for eight months. And so they're like, we need to get another episode in. So they bring in the crew from Real Housewives to film a whole other episode. And they're cutting back to footage. They're showing how far this all went. And they're constantly catching him in lies.
Smosh Mouth
#83 - Don't Say The Secret Word...
Where he's like... Yeah, I think it started around here, but then they show footage from earlier when you're like, oh, wait, you guys were having an affair. Then it keeps piling up, and then the reunion is just insane.
Smosh Mouth
#83 - Don't Say The Secret Word...
Ian, you would make Chris Kirkpatrick one of your secret words. Maybe I did. Everyone's probably like, who's that? Seriously. He's full of the goggles. Yes. Oh, I only know it from the Eminem lyric.
Smosh Mouth
#83 - Don't Say The Secret Word...
No, you know what it is? I realized he was a model for a long time. He's just Zoolander. Truly. He's actually of Zoolander was kind of a piece of shit.
Smosh Mouth
#83 - Don't Say The Secret Word...
They're amused by him. He gives me the energy as somebody who got D's in every class.
Smosh Mouth
#83 - Don't Say The Secret Word...
What's going on here? For some reason, I can just so clearly picture him in high school just getting straight Ds.
Smosh Mouth
#83 - Don't Say The Secret Word...
so the reality show people are such an interesting type of person i mean we i talked about this when tommy was on forever ago but like i'm like it's not easy to nail this like archetype because like tommy's obsessed with abby lee miller and i'm like abby lee miller is a horrible person but entertaining to watch and most horrible people are not entertaining to watch you you don't want to watch a horrible person yeah they have to like
Smosh Mouth
#83 - Don't Say The Secret Word...
Traitors is fascinating, though, because you have people from Survivor who are used to playing games. Yeah. And then you have Real Housewives. You have people from Survivor, The Challenge, and Big Brother who are good at the game.
Smosh Mouth
#83 - Don't Say The Secret Word...
And they do it well. And then you have Real Housewives and Tom Sandoval who just have no idea what's going on. Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
yeah i love how the editors in that show because like i'm sure like every at some point everyone's giving attitude to everyone but like the editors in that show make sure to point out every time people are just so fucking done with tom chrishell or i think that's my name she's just like i'm voting for tom because i just you cheated on my friend it's like yeah yeah okay and tom's like
Smosh Mouth
#83 - Don't Say The Secret Word...
Chris Kirkpatrick, you can get your ass kicked. Yeah. Whoa. Yeah, dude. Yeah. He was cool. Luckily, Eminem's one of my secret words. Shit! Really? No. Come on, guys. I wouldn't just tell you. It's all rappers. He just wrote it all.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah, he's just like I think he actually thinks people are being murdered He's like Sierra you came back from the coffin it's such a it's I love the show cuz I'm like Oh, they're just playing werewolf.
Smosh Mouth
#83 - Don't Say The Secret Word...
What do we do? They try to row the boat and it just immediately goes into the shore. Yeah. It's incredible. I wonder if they like, I kind of get the feeling like those games aren't actually on a real time limit. I don't think so.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, they're so bad at the games, and I feel like they're actually, the producers are like, just give them another 15 minutes. They haven't done shit.
Smosh Mouth
#83 - Don't Say The Secret Word...
When they were not doing anything for the first 20 minutes.
Smosh Mouth
#83 - Don't Say The Secret Word...
I assume they have a stylist. I think they have a stylist. I think they have a stylist that they pay for. I think Alan Cummings said that they are picking all these outfits for him. Well, they're definitely picking Alan's outfits. It's very cool. I mean, I'm going to be real. Not all hits.
Smosh Mouth
#83 - Don't Say The Secret Word...
Some misses. That might be a hot take, man. That's a hot take.
Smosh Mouth
#83 - Don't Say The Secret Word...
That might be a hot take. People might be really upset about that. Look, a lot of them hits. Some of them, eh.
Smosh Mouth
#83 - Don't Say The Secret Word...
whoa trying a little too hard but like the quilt like it's perfect i think this point i think the point is that he's trying super i think he's supposed to be like do you think he lives in that castle i think he lives there where is he from that castle i think he's scottish he's scottish i'm pretty sure yeah yeah do you think he lives there No. Yeah, that's his castle. Let's say yes.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. Yeah. Yeah. No, it's a weird reveal whenever, like, because they, I saw some back behind the scenes stuff where it's like, oh, they go to a hotel at the end of the night, all the contestants.
Smosh Mouth
#83 - Don't Say The Secret Word...
I don't even know. With traders, do they have, like, wine at the castle? Do they have alcohol? Oh, yeah. Yeah, they have a bar. Oh, yeah, they're drinking. I feel like they're not... I wouldn't want to drink.
Smosh Mouth
#83 - Don't Say The Secret Word...
The Highlands? I think I looked it up. They're in the northeast or kind of north middle of the Highlands. I always wanted to go there. Highlands right down? It's beautiful. I mean, there's... No! Just kidding. There's so many castles up there, and you can stay in them. A lot of them have been converted into hotels, so you can go to... I stayed in a castle that looked a lot like that.
Smosh Mouth
#83 - Don't Say The Secret Word...
No, probably. Are you just saying they have a Starbucks in a castle?
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. I feel like your friend just saw an old building that a Starbucks was in. Castle! This must be a castle.
Smosh Mouth
#83 - Don't Say The Secret Word...
Everything looks like a castle there. Everything's old as hell over there. I went to Edinburgh and it was just like, you can't walk into a building that wasn't built in the 1700s or earlier. It's so rad. It's incredible. There's like photos. They have like a... they have like photos from like the 1800, like late 1800s of like Edinburgh. And it looks the same. Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
You're correct. That's NSYNC. Oh, you're giving me another point, huh?
Smosh Mouth
#83 - Don't Say The Secret Word...
Like, yeah, it's truly, there's no new buildings around there. You, you walk around and it's like, yeah, it's all old. You feel like you're transported back in time. Yeah. It was incredible. I love that place.
Smosh Mouth
#83 - Don't Say The Secret Word...
Uh, Courtney and I went, uh, a little over, uh, over a year ago. It was, it was right before Anthony came back. Um, Is this when you also went to London? We were there And then when we came back It was the following month that Anthony returned So you went to London You went to London and Edinburgh And it was so awesome. Nice. Just a lovely time.
Smosh Mouth
#83 - Don't Say The Secret Word...
We took a train. Oh. Which was lovely. So easy. All I want to do is take a train. It was incredible.
Smosh Mouth
#83 - Don't Say The Secret Word...
I actually took Metrolink for the first time. I liked it. Yeah. It's like 10 bucks.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. Oh, yeah. I've done that a lot. Love that one. So great. The surf liner. Love that one. Surf liner? You just go along the beach the whole time. Surf rider? It's incredible. I forget what it's called. Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's not 24 hours, but they do have like early trains. After 8 p.m., you got to hop in the minivan and get down there.
Smosh Mouth
#83 - Don't Say The Secret Word...
That would be fun. How do we get to trains? Scotland's great.
Smosh Mouth
#83 - Don't Say The Secret Word...
Anyways. Anyways. What's going on, man? Who's president when... No. No. No, man. No.
Smosh Mouth
#83 - Don't Say The Secret Word...
Who's president when Survivor started? If you truly hate one of your... You would make one of your words... I am not saying a president's name. It's because you don't know.
Smosh Mouth
#83 - Don't Say The Secret Word...
Survivor was like 2000, 1999. Was it Bill? Was it Bill Clinton?
Smosh Mouth
#83 - Don't Say The Secret Word...
I feel like a year ago, Ian, we wanted to get you on here and talk about reality TV because you're a big fan of reality television. Yeah, I'm kind of like a I still consider myself a reality TV baby. I didn't get into reality TV until the pandemic. He's a baby. Love is blind is oddly what got me into it because I was like, this is the worst show ever. I'm going to watch it.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's not Bill Clinton. It's not Bill Clinton. You're giving him what he wants right now. Selena's not writing anything down, but she's pretending to. I don't know.
Smosh Mouth
#83 - Don't Say The Secret Word...
What was the first reality TV show? Was it Real World?
Smosh Mouth
#83 - Don't Say The Secret Word...
yeah i watched all that yeah my brothers are obsessed with the challenge which is like mtv's reality summer games it's yeah it's it's insane um but uh it's a hardcore one that's why wes was like so intense i was like well that's that's their vibe i get it but like dude read the room i want to say he's one of the mellower ones on no i was just like read the room But that's how he plays.
Smosh Mouth
#83 - Don't Say The Secret Word...
He was like, yeah, I'm intense. You guys can't take that. F you.
Smosh Mouth
#83 - Don't Say The Secret Word...
I feel like we didn't really spoil anything from Traders. I don't think it's not too bad. I don't think it matters.
Smosh Mouth
#83 - Don't Say The Secret Word...
I had a lot of stuff spoiled and I still really enjoyed it. It's fine. And as of recording this, it's not.
Smosh Mouth
#83 - Don't Say The Secret Word...
You guys want to talk about video games? You guys want to talk about memes?
Smosh Mouth
#83 - Don't Say The Secret Word...
You're literally, right after this, you're about to go play Resident Evil for a bunch.
Smosh Mouth
#83 - Don't Say The Secret Word...
You guys are about to live. Spoiler alert. We're recording this on the day of the live stream of Resident Evil.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, that messed me up. Oh, we're past the scary baby. Yeah, I know. But that part messed me up bad.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, my God. No, it's crazy. But also the, like, walking thing that's... Oh, yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, you're with Lady D, yeah. That was eight. I thought that was... Oh, that is eight. We already defeated Lady D. Have you gotten to the dolls?
Smosh Mouth
#83 - Don't Say The Secret Word...
Show a photo of him. Tell me that's not young Jerry Garcia.
Smosh Mouth
#83 - Don't Say The Secret Word...
I played a Grateful Dead fan for seven years on television. I had to do a little research.
Smosh Mouth
#83 - Don't Say The Secret Word...
No. No. Now we're just making shit up, man. I almost believe that. No, it is.
Smosh Mouth
#83 - Don't Say The Secret Word...
No, but Cherry Garcia. You're thinking Cherry Garcia. Yeah, that's what I thought.
Smosh Mouth
#83 - Don't Say The Secret Word...
They make deals. They strike a deal. Every time someone orders that ice cream, his ghost gets a handy. No one really gets it.
Smosh Mouth
#83 - Don't Say The Secret Word...
I don't know how... Well, because I was like, what would a ghost want as a residual?
Smosh Mouth
#83 - Don't Say The Secret Word...
Anyways. I think ice cream flavors have gotten out of hand. Did you do like a bunch of acid to prepare for your role as the Grateful Dead?
Smosh Mouth
#83 - Don't Say The Secret Word...
I've never seen it. Nobody, I've talked about this before, but I think I gave off the vibes that nobody ever offered me drugs. Yeah. So.
Smosh Mouth
#83 - Don't Say The Secret Word...
You give off those vibes. I just give off the vibes that it's just like, don't offer him drugs.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. And I've seen all the American ones. I watched Love is Blind in Japan, which is incredible. Did you watch the Brazil one?
Smosh Mouth
#83 - Don't Say The Secret Word...
Unfortunately, you do give off the vibes of an undercover cop. And I did when I was 15, too. No, no, no.
Smosh Mouth
#83 - Don't Say The Secret Word...
My father's a cop. My father's a cop. Yeah. They're the ones who do. I just gave off, like, just don't. No. They're like, oh, this guy, this guy. Don't waste your acid on that guy. And I'm over here just, like, sitting in the corner with a mountain dude. Like, I'm really getting a buzz off this one, guys. This party's crazy. I got to go home. I'm getting real zooted off this mountain dude.
Smosh Mouth
#83 - Don't Say The Secret Word...
Hello. So I was just trying to figure out which camera was mine. You okay? I think it's that one.
Smosh Mouth
#83 - Don't Say The Secret Word...
Same. And it's really sad. I need to start. Y'all have fallen into my traps so many times.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. Like that's not fair. I made mine interesting. Like what? Oh, my God. Amanda? That's not one of my words. You could say it. No. At the end, we're going to guess each other's words.
Smosh Mouth
#83 - Don't Say The Secret Word...
I think we should. I think I guessed one of your words earlier, but now I forgot it.
Smosh Mouth
#83 - Don't Say The Secret Word...
Anyway, who's y'all's favorite president from the early 2000s?
Smosh Mouth
#83 - Don't Say The Secret Word...
But I think it's a ruse. I think it's a red herring. I think he throws. And what are we supposed to say? Red herring was my word. What? It would be. No. That'd be incredible. No. That'd be incredible.
Smosh Mouth
#83 - Don't Say The Secret Word...
good i i i'm regretting my words as well i thought i picked them i picked them wisely but i wasn't wise i was stupid what's y'all's favorite ben and jerry's ice cream i i it's not like something i go i think vanilla and chocolate are the best i think he said wow he said it earlier i think cookies and cream as well i think we said i think we said it earlier
Smosh Mouth
#83 - Don't Say The Secret Word...
I'll have to think about that one. Love is Blind, yeah, I didn't watch a lot of reality TV for a long time. I used to watch a ton of it when I was younger. In the 2000s, you know, you had that stretch where reality TV was... Like what?
Smosh Mouth
#83 - Don't Say The Secret Word...
You think I would write Cherry Garcia as my word? I would believe that. I would believe that, and it would be incredible. I don't know. That would be insane. No, because the conversation steered that way outside of your control. I think that would just be extreme luck.
Smosh Mouth
#83 - Don't Say The Secret Word...
I was kind of hoping that my words would naturally come up. Me too. And they just haven't.
Smosh Mouth
#83 - Don't Say The Secret Word...
You're trying to get us to say VPR. Aren't you? No. I never watched that show. Which show? that show. That's crazy. Then this is more of a game of picking smarter words.
Smosh Mouth
#83 - Don't Say The Secret Word...
I know. I should have picked smarter words. He listens. It's not mine. It's not my word. But I think it's your word.
Smosh Mouth
#83 - Don't Say The Secret Word...
messing with you right now. I'm so paranoid. We're literally playing traitors right now.
Smosh Mouth
#83 - Don't Say The Secret Word...
Okay, I've been thinking about this a lot. I think I would be a pretty good faithful.
Smosh Mouth
#83 - Don't Say The Secret Word...
But the problem is, if you're too good at... I'd have to... I would... Go in there, and I'd be like, I need to act like Tom Sandoval. I need to be the biggest idiot. Because, okay, this is a little bit of a spoiler, but anyone who's decently good at the game, gone. By the end of the show, it's idiots. Of course. All the dumbest people are left. Well, not necessarily. Except for the traitors.
Smosh Mouth
#83 - Don't Say The Secret Word...
Or people who are playing dumb. It's rare that someone who's outwardly playing a great game... Yeah, but Zac Efron's brother is doing a good job. But I think he's going to die. He's done an okay job. He's had misses, but... If I'm going on Traders, I am pretending to be...
Smosh Mouth
#83 - Don't Say The Secret Word...
so dumb i'm i'm gonna be clueless or like quiet or boring i think the issue is like if you go in too hard on somebody that yes is a traitor you're gone and you don't get rid of that traitor then you're done then you're done but i think also if you are not contributing at all then you're safe to kind of kill because people are like well i mean
Smosh Mouth
#83 - Don't Say The Secret Word...
Everything. I mean, from 2000 to 2008, reality television was at, I think, its most insane, right? That's when they had zero empathy for people.
Smosh Mouth
#83 - Don't Say The Secret Word...
So for the people that aren't watching Traders, so it's all reality TV stars. And then one guy who's like three steps removed from the royal family. Princess Diana or something. And he's like, quote unquote, the first gay royal ever. And he's this old guy. There never was any before him. Yeah, right. Yeah, exactly. There never was an history.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's this old guy who is like, I don't want to say senile, but he's really not there.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's just kind of chilling. It's like, who let this random guy wander onto the set? And he's old, so the physical challenges, he's not pulling his weight.
Smosh Mouth
#83 - Don't Say The Secret Word...
Sam, who is, by the way, Britney Spears' ex. Sam S. Ashar? It's just like some random people who just don't say anything. And they're kept around because they're just not really a threat to anyone.
Smosh Mouth
#83 - Don't Say The Secret Word...
Tom Sandoval's still there because nobody's worried about him.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's smart to keep somebody like Tom Sandoval on the game because he's pointing fingers everywhere. At the wrong people. And sometimes they might be right, but a lot of times they're wrong. So if you keep him in there, he's going to throw people off.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yes. So the first five. And like some of the worst. Oh, horrible stuff. I was talking to someone the other day about the swan.
Smosh Mouth
#83 - Don't Say The Secret Word...
But because I think I'd be such a good faithful is why I think I should be a traitor. Because I think everyone like I would I would what I would happen is if I'm a traitor, if I'm a traitor, I'm going to go in there and just be like, I'm going to forget that I'm a traitor. And I play this like I'm like I'm a faithful as best as I can.
Smosh Mouth
#83 - Don't Say The Secret Word...
I'm going to be in that mindset all the time and and just go with it.
Smosh Mouth
#83 - Don't Say The Secret Word...
Let's get rid of him. I'd have to be really dumb and hope that nobody else on the show watches Smosh.
Smosh Mouth
#83 - Don't Say The Secret Word...
And it's like, oh, there's some like guys. There's some like weird like accusations on Sierra where they're like, you're like you're like cursing.
Smosh Mouth
#83 - Don't Say The Secret Word...
What do you think would be your victory line? Oh, I would. That'd be fun. Oh, yeah. And boom goes the. No. I'd be like, and guess what? I'm a traitor. Oh! And I'd friggin... Did you have that set up for this moment? Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
So it started with extreme makeover when they're like, we're going to just make you a better person by doing all this plastic surgery, doing all these things on you. And it was like, okay. And then they were like, let's make the swan where it was that, but just dialed up to 15 and Well, it's like we did it with Holmes. Now, why don't we do it with people? No, it's so terrible.
Smosh Mouth
#83 - Don't Say The Secret Word...
That fits perfectly for Boom Goes the... Boom Goes the Dynamite. Yeah. Which is my secret sentence. Just kidding.
Smosh Mouth
#83 - Don't Say The Secret Word...
Disqualify him. Have you seen... Boom Goes the Dynamite? Have you seen Boom Goes the Dynamite? This is not... My secret word is boop, boop, boop. No, this is not Harambe level. This is an old viral clip. Boom Goes the Dynamite.
Smosh Mouth
#83 - Don't Say The Secret Word...
Um, do you want to explain? Do you want me to explain? You can explain it. So there's this old clip and it's a, uh, like a college, like, uh, sports announcer. Like he's recapping sports. Sick.
Smosh Mouth
#83 - Don't Say The Secret Word...
I love that word. So he's recapping some sports highlights for the basketball team. And what happens is I think his prompter goes out. So he doesn't have any of the words coming through. Bad. So he's now just seeing this highlight clip of like... at basketball players and he's just like, and they made it down the court and he shoots there and boom, boom goes the dynamite.
Smosh Mouth
#83 - Don't Say The Secret Word...
He just keeps saying boom goes the dynamite whenever they make a shot. It's so incredible.
Smosh Mouth
#83 - Don't Say The Secret Word...
I don't know who I am. Yeah. Scary. I mean, luckily for him, it was sports, which is fine. But if you're talking about a heavy subject, you'd have to just say, oh, the teleprompter.
Smosh Mouth
#83 - Don't Say The Secret Word...
No, he clearly did not know ball. He was not a ball knower. Unlike me.
Smosh Mouth
#83 - Don't Say The Secret Word...
I always have had these. So for those that are listening right now, Shane is pulling small basketballs out from under the table and just shooting them across the... Into nowhere. Into nowhere. And it's friggin' sick, man. That's crazy. But every time you do that, you have to say the line. Boom goes the dynamite. Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. Can you imagine if that guy was doing the play-by-play of JFK in Dallas? And then his teleprompter went off.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, come on. That's one of your... You made one of your words... Hold on. You made one of your words... That? Wearing. You would. Are you referring to the Scottish dress? No. Oh. What? You are. No. Well, we know it's a piece of clothing. I'm not going to say any clothing anymore. What?
Smosh Mouth
#83 - Don't Say The Secret Word...
You're so far behind because Shane said my word like six times in a row.
Smosh Mouth
#83 - Don't Say The Secret Word...
Extreme Homeroom was the spinoff. It was extreme makeover and then extreme home makeover was after.
Smosh Mouth
#83 - Don't Say The Secret Word...
That's insane. Guys. There's an element of luck here. Get your ass. It wasn't luck. I walked you right into that trap.
Smosh Mouth
#83 - Don't Say The Secret Word...
You get all those, Selena? Okay. This was a really good creative. This is a really solid idea. We've got some good ideas we're doing. I still want to do, but the one I'm most excited about is the psalm. Psalmier. Oh. Yeah. I want to do that soon. Wait, we bring a...
Smosh Mouth
#83 - Don't Say The Secret Word...
It should be maybe us, Angela. We need people who are experts. Let's compromise. We could just go, like, there's closer wine country. There's closer wine country. Napa's overrated, y'all.
Smosh Mouth
#83 - Don't Say The Secret Word...
I think that's one. Hour and a half. It's like closer to where James Dean died. Paso Robles. Paso Robles. Paso Robles.
Smosh Mouth
#83 - Don't Say The Secret Word...
I think it'd be really awesome. Paso Manos. I'm not a big... I don't really like wine, but I'd like to give it a shot and understand more.
Smosh Mouth
#83 - Don't Say The Secret Word...
Because, obviously, like, I could decipher the difference between a white and a red. But, like, when you boil it down further...
Smosh Mouth
#83 - Don't Say The Secret Word...
Could you just know a region? Could you know a region? Could you taste a wine and know where it's from?
Smosh Mouth
#83 - Don't Say The Secret Word...
Are you a super taster? What's a super taster? Like someone who just really tastes stuff super. I super taste it. I'm super tasting wine a lot. Or like they could sense like taste.
Smosh Mouth
#83 - Don't Say The Secret Word...
They're not allowed to look at a mirror the entire time. And I mean, it was just risky. It was so extreme. And obviously there's nothing wrong with people getting plastic surgery, but the way that it went about it was, was just kind of terrifying. It was shocking. It was such a bad show. I think they followed up... I remember listening to something and they followed up with one of the contestants.
Smosh Mouth
#83 - Don't Say The Secret Word...
I'll be honest. I thought there was only three types of red wine. Sure.
Smosh Mouth
#83 - Don't Say The Secret Word...
There's like three. No. I mean, I know that's not true, but I can see how you could. What did you think the three types were? Because if you go to Olive Garden, there's three types. There's a Malbec. There's a Cab. Nice. And there's a Chianti.
Smosh Mouth
#83 - Don't Say The Secret Word...
Not like a cab. I can have a cab all the time. Wow. Take a cab.
Smosh Mouth
#83 - Don't Say The Secret Word...
I would really love to see, though, if you and Angela, who would win?
Smosh Mouth
#83 - Don't Say The Secret Word...
yeah less crowded less crazy like of course we like decided to go to um francis ford coppola's and we're just like yeah that's like i feel like that would be like going to like the star like the starbucks like reserve no it was like it was like disneyland yeah when you went in you were like oh my god it's disneyland can you imagine like do you think yellowtail has like a winery that you go to
Smosh Mouth
#83 - Don't Say The Secret Word...
What's that? It's Australian. It's just like a very like basic, it's like a very cheap one. Yeah. Barefoot.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's gonna be B. We start rolling, and I forget the cameras are here. That's cool. I'm just in the moment, living my real life, having an actual conversation.
Smosh Mouth
#83 - Don't Say The Secret Word...
Sounds like you don't want me to come. I didn't say that. You asked that like when like one friend is like walking towards a group of friends and they walked in on them talking about like a sleepover and they're like, do you want to come?
Smosh Mouth
#83 - Don't Say The Secret Word...
I'm going to leave it. Can I come to a sleepover? No. He'd come. He'd just play Civ in the other room.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's going to become immortal? Yeah. Oh, he's doing the Immortal difficulty?
Smosh Mouth
#83 - Don't Say The Secret Word...
And... she was very positive about her experience. It's like, great. Like, you know, if that, if that, if that worked out for them, I'm happy because like, I think a lot of the people like in Biggest Loser, which was another wild show from that time.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, that's pretty good. Whoa, do you do that? No, I find that Emperor is the difficulty that I like to play in. I couldn't get into Civ. He's reaching Immortal level. Is he playing Civ 7 or is he playing Civ 6? Because Civ 7 just came out.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's like, I'm done. I'm retiring from running civilizations.
Smosh Mouth
#83 - Don't Say The Secret Word...
I know you're paying because, yeah, I have it on Switch. I had Civ VI on Switch and Xbox, and on Switch alone, I put in over 400 hours.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, yeah. Yeah. It's part of the marriage. It's okay. Yeah. We've talked through it. Anyways. I didn't know that Civ was such a sticking point. Civ and Dota.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's apparently incredible. Yeah. One of the best games of all time. Taking my husband away. But I hear Civ 7 sucks.
Smosh Mouth
#83 - Don't Say The Secret Word...
Civ 7 just came out, and it's not complete. It'll get better. I think it'll get better, but the UI is atrocious. It's really bad.
Smosh Mouth
#83 - Don't Say The Secret Word...
What did I eat? Amanda's words were like bowler cap oysters. I had a delicious. I think it's oysters.
Smosh Mouth
#83 - Don't Say The Secret Word...
I had a delicious half chicken with lemony potatoes. Oh, that sounds delicious. I had a really tasty salad that had tomatoes.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, I had probably one of the worst prefix menus of my life. What was on it? It was like, God, it was just bad. It was just bad.
Smosh Mouth
#83 - Don't Say The Secret Word...
It was like this, one of the courses was this abarico pork over like a blue corn grits. Okay. It was disgusting.
Smosh Mouth
#83 - Don't Say The Secret Word...
The other one was like, it was like the squid ink tostada. It was bad. It was bad. It sucks. Do we want to call it? Do you want to keep going?
Smosh Mouth
#83 - Don't Say The Secret Word...
Quit while I'm ahead. All right. Let's call it. The game is over, but do you want to try to guess each other's words really quick? We'll try to guess yours. Okay. So one of yours was kilt.
Smosh Mouth
#83 - Don't Say The Secret Word...
I think he might have been wearing a top hat. I thought it was a bowler cap, but it might have been a top hat.
Smosh Mouth
#83 - Don't Say The Secret Word...
No, I think you're right. It was either him or it was...
Smosh Mouth
#83 - Don't Say The Secret Word...
Do you remember that intro? No, but I can imagine it. But like a lot of those people wound up because like the mechanisms through which they lost weight didn't really work out for most of them in the long run. A lot of them after the show gained all of their weight back.
Smosh Mouth
#83 - Don't Say The Secret Word...
Top hat's not bad. You should have brought up gentleman.
Smosh Mouth
#83 - Don't Say The Secret Word...
You said werewolf, and then you said, oh, the gentlemen and traders.
Smosh Mouth
#83 - Don't Say The Secret Word...
I know, I know, it's tough. Hard. You had a food in there. Was it like salad? Ceviche. Ceviche was one of your words? You know what's crazy? I did have ceviche. I did have ceviche.
Smosh Mouth
#83 - Don't Say The Secret Word...
Well, no, I went to a ceviche place, but then they didn't really serve any ceviche. You're right, because I told you about that. I know.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah, I went to a ceviche place, but it was also a prefix.
Smosh Mouth
#83 - Don't Say The Secret Word...
Sunrise? Oh, because you were trying to talk about the train. Yeah. Because you were talking about sunset. But you're not going to see the sunrise come over because it's the wrong coast, honey.
Smosh Mouth
#83 - Don't Say The Secret Word...
We were talking about beaches and stuff at several points. Oh, that's brutal.
Smosh Mouth
#83 - Don't Say The Secret Word...
Slippery Slope. You know, a good one. One that's not going to be said a lot, though. Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
I feel like y'all can guess most of mine. Oh, I messed up. Was it Jeff Probst? Jeff Probst was one. Damn, we're so screwed. I hate you.
Smosh Mouth
#83 - Don't Say The Secret Word...
survivor oh tom sandoval y'all are so fucked okay tom sandoval no oh vanderpump was it vanderpump no was it uh was it lisa oh see i thought you had a vanderpump on your no i told you i didn't was it housewife no should i just tell you yeah yeah okay so i can't believe i gave you the fucking layup on this one so many times dynamite
Smosh Mouth
#83 - Don't Say The Secret Word...
How did we end up... You perfectly brought up that clip, and of course I'm going to talk about it. I had basketballs here. Did you know that he was going to have basketballs? No, I didn't know he was going to have basketballs. It literally was so... You literally had the assist. Sports terms. Devastating. You tried to avoid saying this, but you still said it. George Bush.
Smosh Mouth
#83 - Don't Say The Secret Word...
I said George Bush Senior. Oh, you just had George Bush. I just wrote George Bush.
Smosh Mouth
#83 - Don't Say The Secret Word...
You shouldn't have said a president name. I know. I know. This one, somehow we never said this, and I'm surprised. I tried to bait you into it. Meme. Wow, you did. You did. When I go, we could talk about video games, and you said we could talk about memes.
Smosh Mouth
#83 - Don't Say The Secret Word...
All right. And then this last one. I mean, I feel like I feel like I already won the game like five minutes. Yeah, you did. Island. No.
Smosh Mouth
#83 - Don't Say The Secret Word...
So good. Okay, his words were good. Temptation Island. His words were good. I'm surprised we actually didn't really talk about Love Island that much. That's what I originally wrote island for. Okay.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yes. I had a good late game. I had a bad early game. Okay, good late game. I don't know if any of my words were said in the first 30 minutes. Wow. I don't think a single word was said.
Smosh Mouth
#83 - Don't Say The Secret Word...
I have no guesses. Yeah. I thought these would come up, and they didn't.
Smosh Mouth
#83 - Don't Say The Secret Word...
No. No, mine, I should have done more around reality.
Smosh Mouth
#83 - Don't Say The Secret Word...
Wine is one of them. Now here's what sucks. Here's what sucks. Who am I? I was going to get extra points. We agreed I would get extra points if Cabernet Sauvignon was said. But you said every wine. And I was sitting there and I was like, it should be a specific wine. And I was like Zinfandel or something. And then Cabernet Sauvignon. And then you said Zinfandel, Merlot.
Smosh Mouth
#83 - Don't Say The Secret Word...
You said all these other frigging kinds. Except for Cabernet Sauvignon.
Smosh Mouth
#83 - Don't Say The Secret Word...
And if you knew wine, you would know that was basic. So wine, I had minivan, which I tried to bring it up.
Smosh Mouth
#83 - Don't Say The Secret Word...
I know, but you didn't. I didn't. We never mentioned his name, Anthony. And I was hoping it would come up, but it didn't.
Smosh Mouth
#83 - Don't Say The Secret Word...
Douchebag. I did hear that word. I said it because I was trying to just get it out there.
Smosh Mouth
#83 - Don't Say The Secret Word...
Well, apparently not for this past hour. Whoa. Yeah, because I got a weird reaction when you said douchebag. I was like, oh, that's such a good word.
Smosh Mouth
#83 - Don't Say The Secret Word...
I was going to be... Absolutely losing, getting zero points. But this last word came in clutch at the end, which was sieve. No!
Smosh Mouth
#83 - Don't Say The Secret Word...
That's a good question. She's probably still working out. But you guys haven't mentioned the sexiest of the reality shows from back then. The sexiest? Let's see. There's Survivor.
Smosh Mouth
#83 - Don't Say The Secret Word...
I knew if I had Civ that Ian, if I just made it happen. And now me. But you said it. You said it the most.
Smosh Mouth
#83 - Don't Say The Secret Word...
And I was like, what? I might have gotten second place only because of Civ.
Smosh Mouth
#83 - Don't Say The Secret Word...
Three points. Shane got 21 points. Oh, my. You guys were saying Civ like this and that. Oh, no. And Ian, you're going to have like 50 points. I don't think so. 33 points.
Smosh Mouth
#83 - Don't Say The Secret Word...
Shane, can you explain the basketballs? It's just there.
Smosh Mouth
#83 - Don't Say The Secret Word...
Boom goes the dynamite. Boom goes the dynamite. You can't see, but off camera there is a hoop and I've made every single one of those shots. No, there isn't. Guys, thank you for watching. Thank you for playing along. Ian, congrats.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. All right. Pitch some words down below. Okay. All right. See you later. Bye. Bye.
Smosh Mouth
#83 - Don't Say The Secret Word...
There was The Challenge. Those aren't sexy. No, it's the one where they're trying to get people to cheat. Oh, wait. Oh, Temptation Island? Yeah. Dude. I never watched that. I never watched Temptation Island.
Smosh Mouth
#83 - Don't Say The Secret Word...
Well, that was later, because that's, like, a Netflix one. Okay, Temptation Island. Temptation Island started forever ago, and it's just absolutely horrendous.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yes. Yeah. I'm pretty sure it was on Fox, and it was, like... This was before Netflix and all that shit. Yeah. Yeah. And I think it was, like, they were getting people that were... Were they engaged or something? I just think they're in long... They were in long-term relationships.
Smosh Mouth
#83 - Don't Say The Secret Word...
Dude, should we move Smosh Mouth to a garden? That would be so sick.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah, they take people who are in long-term relationships, right, men and women, and they split them off, and the women live in one house, and the men live in another house, and then they bring a bunch of single people, single hot men and women to be in the opposite houses.
Smosh Mouth
#83 - Don't Say The Secret Word...
And the way it also works is, so the women are in this house with a bunch of hot guys, the men are in this house with a bunch of hot women. There's a red light in each of their houses, and the red light goes off whenever someone's fooling around in the other house. I did not know this. Yes. I never watched the show. It is devastating shit. I never watched the show. And get this.
Smosh Mouth
#83 - Don't Say The Secret Word...
Shane watched a lot of it. No, no. There was some recent drama with Temptation Island in Spain.
Smosh Mouth
#83 - Don't Say The Secret Word...
That'd be incredible. And we're just picking fresh tomatoes and just chomping on them. Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's happening, and it's happening all over the world.
Smosh Mouth
#83 - Don't Say The Secret Word...
So in Temptation Island, Spain, I got served all these clips on TikTok. They had these two houses on the beach, and there's this couple. They've been in a relationship for 10 years. And what they also do is they do challenges that kind of force the people into the zone. So it's like, oh, we're doing a challenge where the women give the men lap dances. And that's the challenge.
Smosh Mouth
#83 - Don't Say The Secret Word...
And so you have no choice. But then they're also constantly showing each other footage. They're displaying footage to the other houses. And so they show this footage to the other house of like, here's your boyfriend getting a lap dance from this girl. And so the girl then sees that and goes, oh, well, if he's doing this, then I'm going to go do crazy stuff.
Smosh Mouth
#83 - Don't Say The Secret Word...
And then what it culminates in, what it culminates in is he gets the opportunity. to go and get to watch a live stream of The Other House. They're like, you can go watch what The Other House is doing live. And he's like, okay, I want to go see what's going on. Are the houses, are they on separate islands? No, they're on the same beach, just on the opposite side of the beach. This is important.
Smosh Mouth
#83 - Don't Say The Secret Word...
Is it an actual island? I don't think it's an island. I think it's just some place, right? But this is important that they are... on like the same beach. So he goes and he's like, I'm gonna go check out this live stream. And of course, she is in bed with another man. And he's sitting there watching it. He loses his mind in the most like Spanish fashion. He's ripping his shirt off.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah, just that squirting tomato sound. Scott's life would be horrible. Your mic is just crusted with seeds everywhere. You're just like, oh, this one's mine. No, but we're going to do that. Okay.
Smosh Mouth
#83 - Don't Say The Secret Word...
He's screaming and he bolts onto the beach towards the other villa and the production crew is chasing him.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's like night. It's like him sprinting across the beach and they're like, Montoya! And he's just like, running and he's screaming, yelling her name and he gets to the other house and confronts her.
Smosh Mouth
#83 - Don't Say The Secret Word...
They weren't expecting him to go over there. They probably couldn't catch him. They end up staying together. Sorry, spoiler alert if you're interested. What season is this? It's happening now. This is a couple months ago.
Smosh Mouth
#83 - Don't Say The Secret Word...
I don't know what happened by the time he got to the house. I didn't see that clip. I only saw the clip of him sprinting down the beach away from production. Wait a second. I love a good reality TV sprinting moment. Oh, my God. It happens in a lot of reality TV shows, and it's so funny seeing the whole production crew trying to keep up with the person.
Smosh Mouth
#83 - Don't Say The Secret Word...
Because that happened with The Bachelor when he leapt over the wall.
Smosh Mouth
#83 - Don't Say The Secret Word...
Never got into it. Was it you who told me that Survivor has more babies than The Bachelor? That's so funny.
Smosh Mouth
#83 - Don't Say The Secret Word...
More people have gotten together and had babies from Survivor than Bachelor.
Smosh Mouth
#83 - Don't Say The Secret Word...
But was it just because they all saw the host nudes? Yeah.
Smosh Mouth
#83 - Don't Say The Secret Word...
Anyways. This episode of Smosh Mouth is brought to you by Quip. Amanda, your smile's been looking incredible lately. What's the secret?
Smosh Mouth
#83 - Don't Say The Secret Word...
Smosh Garden. Before we continue this conversation, we're playing a little game today. Today we are playing Secret Words, something other podcasts have done. Selena pitched this idea to us. Sounds like a lot of fun. So each of us have five secret words that we have written down. And whenever someone else says one of those words, you get a point. And we all have five. Here are our secret words.
Smosh Mouth
#83 - Don't Say The Secret Word...
It's really incredible, and if you don't love your Quip 360, you can return it for free within 30 days, but I don't know if you're going to be doing that because they sent me one too, and I'm amazed by it. Just for listeners of Smosh Mouth, get 20% off site-wide and a free travel case and countertop stand at getquip.com. Q-U-I-P dot com slash SmoshMouth.
Smosh Mouth
#83 - Don't Say The Secret Word...
Free your mouth today and save 20% site-wide plus a free travel case and countertop stand at GetQuip, Q-U-I-P dot com slash SmoshMouth. GetQuip, Q-U-I-P dot com slash SmoshMouth. Back to the show. Let's do it.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah. It's such a good season. And The Bachelor is a crazy one because I actually got to talk to someone who worked on The Bachelor at one point, like 10 years ago. What did they say? They said they're like, oh, it's real. They're like, no, it's real. But they're drinking so much. They're just handing them wine constantly. Of course.
Smosh Mouth
#83 - Don't Say The Secret Word...
That's really, and that's what, like, that's what makes me so impressed with Love Island, because, like, they're only allowed, like, one drink a day or something. Yeah, they're not drinking as much. Love Island in general, they're really not drunk.
Smosh Mouth
#83 - Don't Say The Secret Word...
Yeah, Casa Amor. Casa Amor. Love Island doesn't feel as bad because they're all showing up and meeting each other there, right? So it's all contained to the house. I don't love any show because Netflix also has the ultimatum. Any show that's about, hey, we're bringing couples in and then we're challenging you. I'm like, that's weird. I think that's weird. I think it comes from such a bad place.
Smosh Mouth
#83 - Don't Say The Secret Word...
I love the mess. I mean, look, when you start watching it and you have to keep watching it, but it's a morbid curiosity. I do think the shows are just bad. I'm like, I don't believe in this experiment. And I kind of dread Netflix's whole thing of like, this is an experiment.
Smosh Mouth
#83 - Don't Say The Secret Word...
Oh, 100%. Very toxic relationships. You legitimately have to be in a toxic relationship to go on that show. That's true. This is what I... I think someone should do, though, and maybe someone's already done this. If you are in a relationship, if someone listening here is in this situation, this is what you need to do.
Smosh Mouth
#83 - Don't Say The Secret Word...
If you're in a relationship where you guys are friends, but you're deciding like, hey, you know what? We're going to break up. We're splitting our ways. We're going separate ways. But we still respect each other. We still like each other. go onto a reality show and then pretend that you're not about to break up.
Smosh Mouth
#83 - Don't Say The Secret Word...
Pretend you guys are gonna get engaged and then give the world the most dramatic, insane storyline, even though you guys were already planning on breaking up. It's like, hey, just might as well.
Smosh Mouth
#83 - Don't Say The Secret Word...
This actually feels like a perfect rom-com premise where two people are going to break up. And then they end up. And then they find out that they actually love each other at the end and then they get married.
Smosh Reads Reddit Stories
Congratulations Are In Order! | Reading Reddit Stories
Hey, das ist für dich. Egal wie du frühstückst. Ob mit deinem Lieblingsmüsli, einer fruchtigen Bowl oder cremig schaumigen Kaffee. Mit Alpro wird jedes Frühstück einfach für einen gesunden Start in den Tag. Mit wertvollen Vitaminen und Mineralien. Ohne Zuckerzusatz. Und immer phantastisch lecker. Alpro.
Smosh Reads Reddit Stories
Congratulations Are In Order! | Reading Reddit Stories
Hey, das ist für dich. Egal wie du frühstückst. Ob mit deinem Lieblingsmüsli, einer fruchtigen Bowl oder cremig schaumigen Kaffee. Mit Alpro wird jedes Frühstück einfach für einen gesunden Start in den Tag. Mit wertvollen Vitaminen und Mineralien. Ohne Zuckerzusatz. Und immer phantastisch lecker.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Hello, and welcome to Smosh Reads Reddit Stories. I'm Shane, and today we have some real scary stories. They're not true crime, but they are really scary, so viewer discretion is advised. None of these get to extreme levels, but there is some disturbing things in here, so just be warned. But I'm joined with two people who do like true crime and scary things, Amanda and Angela.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Immediately, I could tell they had been drinking from the way they spoke and smelled and asked them to hand over any alcohol they had. One of the boys, call him Stuart, started protesting. He said the following, and I'm 100% sure this is what he actually said. Come on, miss, don't pretend you won't open that bottle of Bailey's when you get home. Feet up in your dressing gown watching the new TV.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Give us a break. Now, as soon as he said this, I felt my heart drop into my stomach and got cold all over. I had just bought a bottle of Bailey's Irish cream for myself the weekend before the dance. I am in the habit on nights where I don't have much marking slash planning and want to treat myself of having a bath and watching a movie slash series in my dressing gown.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
And my husband bought a new television over Christmas. I asked him how he knew those things and he feigned ignorance basically saying it was a lucky guess. I was so shaken that I left them and a short while later they both left. But that night, I could barely sleep, and my paranoia kept growing. I simply cannot believe that he could have guessed all three of those things.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
One, maybe, but no way all three. My husband is away for work currently. I phoned and told him about it, and he basically downplayed my concerns, saying I probably mentioned those things to my class at various points, and the student has just remembered it. But I would never mention those things. I just wouldn't, and I'm sure I haven't. I've become more skittish at home when I hear noises.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I only live in a small house, but when I arrive home from buying groceries I check every single room and cupboard before I lock the doors. I've also arranged to have the locks changed. When cars stop outside the house I turn all the lights off and peek at them through the blinds. I'm having trouble sleeping.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
In class, this student is quiet and the same as ever, not completing homework assignments, distracted in class. My husband is growing increasingly exasperated and worried for my mental health than the possibility this student could somehow know details of my personal life.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I mentioned it to my supervisor as well, and she also basically reasoned that I had either misheard what he said, it was a coincidence, or a combination of the two. What's the play here? I'm seriously freaked out and don't know how to even begin putting this to rest.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I mean, I think regardless, something inappropriate happened here, right? Yeah. Like, you know that he knew information he shouldn't. Yeah. So either someone she trusts somehow was telling this information, that's like the best case scenario. Worst is... Worst is like he was... Stalking. Stalking her or spying on her in some way. I... I mean, I don't know. But that's a terrifying thing to say.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Terrifying that he goes back to acting normal afterwards. Just like, ugh.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah. I think the best thing, I mean, it's, like, what do you do in these types of situations? But the best thing is to, like, believe them and you can try to, if you want to try to downplay or offer up, possibilities as a means of making them feel calm. But your action plan should be about worst case scenario. It's like, okay, well, in case, if he did, let's set up a camera.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Let's figure out, should you go stay somewhere else? If you're feeling this way,
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It's not just, well, whatever. You're by yourself. Who cares? I don't believe you. It's like, no, I believe that this is weird. Okay, there's other possibilities that could be at play. Yes. But let's take the action plan of worst case scenario.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah, because now she's just alone. It's like, what if she's right? You know, it's like, if someone's like, hey, I think I'm being followed. It's like, okay, maybe the signs don't show to that. But it's like, but let's take the steps together. If that's the case.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I can understand liking true crime if it's been solved and you get to watch how it gets solved and you're like, yes.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
But he said three very specific things, you know, Bailey's and a new TV. He said a new TV? He said a new TV, and she had just had a new TV.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
What are we debating? And a new TV. I believe her. And a nice gown. I believe what he said. He knows this information. So it's like, I mean, all signs point to the most horrifying possibility. Creepy. Comments, my thing is, why would he say new TV?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I could believe it if he said drinking some wine, watching TV in your dressing gown, but being extremely specific about your drink of choice and new TV is a little scary. Wine is the trope slash TV is what you would think people do slash dressing gown is cozy. but those extra added details make it not a coincidence. OP says, exactly, exactly.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
You like mystery. You like solving a mystery. I understand that aspect.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
If it was just, you're going to have some Baileys or even you'll have some Baileys in front of your TV, like, okay, but those comments plus the new TV? Someone else said, is it possible that you or your husband were observed buying the new TV and the Baileys? The student's parents could have seen either purchase and said, oh, OP just got a new LG 65-inch.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I agree, you should do a sweep for cameras or ask a techish friend for help, but that would necessitate figuring out how all the cameras got there, which opens up a larger conspiracy.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
OP responded, because this was another thought that I kind of had was I'm like, what if he's not physically there spying on her, but what if there's like, what if he put cameras somewhere? Because OP responded to that comment saying, how can I do a sweep for cameras? I genuinely want to know. Someone said, open your Bluetooth and see if there are any weird devices.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Obviously, if you live in an apartment building, this probably won't work because you'll pick up your neighbor's stuff. They sell devices that look for hidden cameras, but I think it's just something that emits a beam of light that would bounce off a camera lens. I've never seen one that seems worth buying. Otherwise, I don't have any suggestions.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Opie responded, there are some devices I don't recognize. In the morning, it's late here. I'll go ask my neighbors to try and rule some out. Thank you.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah, I mean, that would be my first.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I mean, these aren't great predictions. Like, I don't love this, but when would he have had the opportunity? I don't know. Okay, let's get into this update. I wasn't expecting this post to receive so much attention. I'm really grateful to so many people who have validated my concerns and helped me develop a plan of action.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I got home a little while ago and I'm going out shortly with a friend to try to rule out Bluetooth and Wi-Fi devices with my neighbors. After that, the two of us will try and conduct a meticulous search of the house for any concealed devices using the lights out phone camera trick some people recommended and some other tips I found online.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Just to clarify a few points that I've seen raised a few times. Dressing gown is a really common term here in England for what Americans might call a robe. It's absolutely common parlance. Here, most people I know would associate a robe with something a wizard might wear. In terms
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
In terms of it being a lucky guess, if he had just said relax with a glass of wine, I might have assumed so, but the dressing gown comment plus the Bailey's comment when I had just bought a bottle and the explicit mention of a new television, which I am 100% certain I did not misinterpret, these things make it so much harder to write off as a coincidence.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
As far as social media goes, I have Instagram which is set to private under my maiden name and my profile picture is not of me. I am not in the habit of connecting with former students. I only have three who have all gone on to study English at university and have used me as references. I also have a Snapchat which I use only with my husband and very close friends.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I have posted nothing about my new television and I also don't think I've mentioned this to colleagues, let alone to students. Certainly I said nothing about the Baileys I just bought. Okay, so that wasn't really any new information. Okay, here's where I'm at.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Here's where I'm at. That's it? No.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
There's another update. Update number two. But before we get into it, where my head is going is not necessarily, I'm not sitting here going, oh, she's wrong. No, for sure. I'm like, something bad is happening here. I don't trust her husband. I don't like that he's playing this off. And it has me worried what he could potentially be in this. I might be so off, right?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It's definitely captivating. I like horror movies.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I just, I don't know. That's just where my head goes, but that's also me thinking like, I'm like, someone said this to your wife and you weren't immediately like, what the fuck? Right? Like, that's where I'm like, what are you doing? Yeah. I just, but I also know like, with a movie or a TV show, that would be where this would go. It's like, oh, actually your husband was doing some weird stuff.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I'm hoping I'm wrong. I don't know what I'm hoping for here. Update number two. I wasn't going to post an update here, but the number of worried people who have reached out to me made me reconsider. Thank you. After a thorough search of my house, I found two devices. They seem to be camera devices. I don't know if audio is included.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
One of them was in the smoke detector in my bedroom, while the other was concealed in the wall of my living room. Looking at an old picture of my bedroom, it looks like the smoke detector itself has changed very slightly. I think that the new one is a device in itself, which the culprit somehow switched with the old one without us noticing. The matter has now been referred to the police.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
So these are some scary stories. These are, according to Reddit, these are real. These are not fiction. There's a lot of fictional subreddits, but these aren't from them.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
If it wasn't for so many of you taking me seriously and giving me practical advice, I wouldn't have had the courage to check, especially given my husband downplaying the concerns. He has been very apologetic and is coming back from his work trip early, but I've asked to spend some time apart and will be staying with my parents for a while. No!
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Thank you again to everyone for affirming me and making me feel sane.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
We're in this. This story was posted like a year ago. So we found it a year after.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah, she doesn't feel safe with him. I mean, she's saying he's being apologetic. She does say there's a paper trail. So my understanding is that whoever did this will be found out. I mean...
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Your little blankie. Tuck your pancakes over your little face. Oh, my God.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Actually, the story was pretty recent. It was from January, so it's only a couple months ago. This year? Yeah. So we don't know, and I'm assuming, you know, if there's a legal case, they're not gonna be posting anything about it, because.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
All right, this next story comes from Best of Redditor Updates.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
OP writes, everything in my house is turning green, including the ham and the eggs.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
This is what your TV sees when you're watching a true crime documentary? Stop talking, just salt it. Go to that. Okay, so this came from the subreddit of Cleaning Tips, which we've never done a story from Cleaning Tips before.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah. All right. Oh, my God. it turned green.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Okay. Are we ready for some scary stories?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
This is so funny. We have a picture of OP's cats. And I gotta be honest, am I...
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Here we go. This first one comes from Am I the Asshole? Am I the asshole for being angry that my roommate was sleeping under my bed for months without telling me?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Okay. Okay, so we've got a little bit of green all over the place.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
You know, sometimes things get a little green. Okay, so there's green all over the place. And, you know, sometimes there's green all over the world. And people just, like, they deal with green. Sometimes things are green. Oh, God. Some comments, I've seen stories about industrial materials like copper from roofing materials turning cats green.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Are your cats indoor cats or do they have access to industrial or cleaning materials that might be stored in your garage, closet, or laundry room? Someone else said long shot but maybe check under your bed if you have box springs or under any furniture. Sometimes the material used under furniture will degrade and break up over time and dye things.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I had it happen with a chair once and it took me a while to figure out that's where the color was coming from. Someone else said, or maybe you bought some new jeans from Old Navy. LOL, they stain everything.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
OP said, haha, me and my husband are not jeans wearers.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
You could have said my husband and I don't wear jeans.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
What do we think the green is? I didn't know about the copper. At first I was like, oh, is OP having some sort of neurological thing going on where everything's looking green to them? But the way that the staining is happening, where it's like splotches of green, has me not thinking that's the case. And we have a photo of the cat.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It's a leprechaun. Update, it was a leprechaun.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
That's where we're starting. Just so you know.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I, a 24-year-old man, have lived with my roommate Carl, a 24-year-old man, for two years. A few months into rooming with him, he told me he was pansexual. I said, okay, cool. I'm not interested in that personal information, nor am I judgmental. I said, all right.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
A few times over the last year, he has asked me if I had ever considered experimenting with other men. I said no. Also, I said I didn't feel comfortable with him asking me such a personal question. It's not like we are close friends. We are only roommates by happenstance, basically. Anyway, every time I said this, he basically said, we'll see. I was like, what?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Anyways, last night, I had a horrifying experience. I heard a noise under my bed. It was movement. At first I thought I was imagining things, but then I heard it again. I thought, oh God, is it a mouse or a rat or some shit? My God, this was like 3 a.m. So I got out of bed and looked under with my phone flashlight. Now this here was the most startling moment of my life.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I guess I am lucky because I have never before this moment felt true terror and fear as a physical sensation, but I was completely jolted. There, under my bed, was my roommate staring wide-eyed at me, and he screeched when I looked under the bed.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I think OP already knows this is bad.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Like, writing out all that information, you know this is bad.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
You're going to try to find every reason why it's not the worst case scenario in this situation, especially when it's like, but I've known him for 10 years and I have no... indication of this in my experience.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It's such a, it's so horrible how this does happen a lot and like, a lot of people really hide their true selves from their partner. It's so sad.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
My thread was locked before I was able to respond to any of the comments, but I was able to read them this morning. I got up at 5.30 to go to the gym before work and my husband was still awake playing video games. I presented him with the very good idea someone suggested of sending me an email with the details, but that it wasn't acceptable to shut me out of this situation since it affects me too.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
His response was basically, the paperwork is in my car, go get it if you want to read it.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I asked him to go get it so we could look at it together and he said, you're going to believe what you want anyways. All of this is unusual for our marriage because I'm a pretty patient person, I think. We went out to the car together and he got in his car, handed me the papers and left. For about two hours, I was panicked because I didn't know where he went.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
If he was okay, if he was thinking of hurting himself, but his mother texted me at nine saying he was over there, asking me what happened, if everything is okay, et cetera. His parents live about 15 minutes away and I guess he told her he's going to be staying there.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
So the paperwork. According to the paperwork, he sent her multiple harassing emails from anonymous email accounts. The emails are printed out and attached. He apparently did this while at work and they have been monitoring his user account for three months.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
The emails aren't sexual or romantic in nature and are all anonymous and about how she sucks at her job, wouldn't be there if she wasn't a woman, how she should quit before she gets fired, and how everyone in the office hates her. He made fake user accounts for his company's product that she works on and submitted bad reviews of her work. He also did this while logged in at work.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I literally thought I was having a heart attack. I then just started hearing, sorry, sorry, sorry, sorry, sorry, sorry. My roommate crawled out from under my bed, crying, apologizing over and over. I was so creeped out and afraid that I ran out of the apartment in my pajamas. There was a Dunkin' Donuts that was open 24-7 a few blocks away.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
He sent an anonymous email to her boss saying that she was sleeping with a senior engineer on another project. He put a gun catalog on the windshield of her car. I don't know what this gesture means, but I obviously understand that it was meant to be threatening. Unfortunately, inside was a subscription card that the company autofilled with his name and address.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
She also says she has been harassed for the same length of time, about three months, on Twitter. He only logged into one Twitter account that harassed her at work, so they can only say one was him. all telling her to quit her job. So I don't know what to do now. This is all terrifying to me and I feel so bad for this woman. I have no idea what this is all about.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
He works with other women engineers and he has worked with male engineers who don't pull their weight and he's never done anything like this. I would have bet a million dollars that he'd never do anything like this. He's at his parents right now and I don't know what my next move here could possibly be. This is so scary and out of left field to me. Dude, did she reject him?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Like, why is he going so hard? You know, unfortunately, man, some dudes hate women. You're telling me.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Write it down. I'm saying that he doesn't need a reason. Like, he's just, he might just.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
He might have just came up with a reason why he hates her. And she never did anything wrong to him.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
There was another story that I've read that we haven't read on the show where a woman finds out that her husband has a Reddit account. where he goes and he just hates on women. Like, just finds posts, women posting things, and he just hates on them, hates on their looks, is just disparaging women all over the web, and he logs off and he goes back to just being, but he just, it, it,
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
He's scary, and he's also an idiot because inside was a subscription card that the company auto-filled with his name and address. That's what I'm saying. It's like, what a loser. I want to know why. I just want to know why.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
There could be any number of reasons.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah. You said it. I mean, look. Quote that. I've been on YouTube for 10 years. Like, it's astounding what little a woman has to do to make swaths of men just fucking hate them.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It's also just real. I mean, we all see it, right? And I mean, everybody, everybody at home watching or listening to this is like, oh yeah, you pull up the internet and you see an example of it every day. And I mean, hate goes around all over the place. I'm not saying that only men are doing this. I'm just saying there are so many men out there who are
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
So I just sat there with a decaf and a breakfast sandwich with my heart thundering away. My roommate kept texting me asking to talk. I ignored it. In the texts, he found a way to horrify me even further. He confessed he had been sleeping under my bed a few nights a week for three or four months and that he was doing it to get closer to me and physically saturate each other. The fuck?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
waiting for the excuse, like they have so much pent up hatred for whatever reason that they just, once they find a target and they're like, this is my outlet.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It makes me think of so many stories when people are just letting their hatred get the better of them. I'm like, Look at all this time you're spending on this. I'm like, bro, get a hobby.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I guess I'm just like, damn, dude. Dylan, Darren. Fuck. Fuck.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It reminds me of when I like, I will find an account, like I will see like a hateful comment somewhere on the internet. And I'll go down the rabbit hole of looking at this account. And it's kind of cathartic for me. Because I'm like, okay, who's this person who just left a piece of shit comment somewhere? And I go and I'm like, oh, you just leave hateful comments all day.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Like you're just going around finding things to hate on. I'm like, damn, damn, man, like... You could live life.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Played some video games. Anyways, our next story and our final story. This one comes from True Off My Chest. Hairstylist has been taking slash keeping my hair.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
OP writes, I'm weirded out. I'm also going to be vague because obvious reasons. I'm a woman in my 30s and my stylist is in their 40s. I got my hair cut today at a stylist I've been using for about nine months now. I think this is my sixth appointment with them. I usually do a trim or cut slash style. Today I went from long hair, high lower back to an A-line bob.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Again, since I started seeing this person, I usually get maintenance slash trim. This time was a dramatic length adjustment, so they took a picture of the cut length on the floor to add to their social media, intending to take before slash after pictures. That's all totally fine and normal. They go grab a broom, sweep up the hair, and place the dustpan on the counter for a bit. Again, normal.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
They grab the broom and pan and head to the back of the shop. They're gone for a few minutes, no biggie. Then they go out to smoke. But here's where it gets weird. The bathroom is in the back of the shop. I need to go and step into the back. I don't really notice anything on the way into the bathroom. I go and start to head back out. But I notice my name on a small clear tote on the table.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It has no lid and it has my hair in it. At first, I didn't really think much of it, but I looked closer and saw it's not just today's discarded hair, but looks like at least a few of my trim sessions mixed with, it looked like potpourri and a little sand or something, and printed pictures of the cut hair with dates.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
The printer is sitting right next to it with today's discarded hair pick in the tray. There didn't seem to be any other containers like this when I looked around. It was fucking weird. So I took a picture on my phone. I honestly didn't know what to think or do and went back out into the salon.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
They came back in and I mentioned that I went to the restroom and they seemed to freak out a little but didn't mention it. I didn't really know what to say so I just let them finish styling my hair, paid and left. As a socially anxious introvert, this was my nightmare. I got home and the more I looked at this picture, the more sick I got.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I ended up texting them an hour ago, sending the picture and requesting they remove the weird box of my hair and asking for an explanation. I said, hey, so I saw this and didn't know what to make of it. Can you help me understand what this is and why you have it? I'm not comfortable with you having this and request you please discard the contents.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Also, even though I loved my cut, I believe it's best if I find a different stylist. They haven't responded. Fuck.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I waited for him to go to work and I ran into the apartment, got my essentials and left. I am currently crashing with a buddy. Our lease is up in one month. My intention is simply to not renew. This dude is blowing up my phone and I am getting texts from other people, some friends of mine and some bozos who are friends with him.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
The ability for her to see that and go and sit back in the salon and get styled after. No.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Awful bold of the stylist to keep it in the salon. Next to the bathroom. Where I'm like, you're going to get found out.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Comments. Wow, that sounds strange. I'm curious as well. Good for you for sending the text message. I see your message as mature, fair, and calm. OP says, I appreciate that, but full disclosure, it took me a few hours to get calm enough to send that. I'm totally skeezed out. Someone said, you absolutely handled it better than I would have. I would have taken it and confronted them.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
This really is the beginning of some crazy I survived episode. Thank God you're not going back. Opie said, I honestly have no clue how to respond. The whole situation was so bizarre and I can't imagine what the purpose of this would be. I told my husband about it and he got goosebumps, which was super scary for me and made me feel like I may have underreacted to the issue.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
But I guess I am glad I got out of there without a confrontation because who knows what might have happened if I'd brought it up to them. Someone said, hair in small containers with other items makes me think of spell jars.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
You know, I'm a skeptical person. I don't necessarily believe in magic. But if someone takes my hair and they're like, yeah, I'm going to use this for spells, I'm going to be like, no, you're not. No, you're not.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Absolutely not. Like, I don't necessarily 100% believe in that, but I don't want to find out. No. You know, I'm not going to find out with my hair.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It's been about a week, and with the holiday, I've been all over the place, but I ended up going to law enforcement to make a report last Monday. I'll likely end up going back if this person keeps contacting me like they have been. Sunday, the day after I got my haircut, I woke up to a bunch of texts from the stylist.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
He is going around telling people I shamed him and that I am rejecting his apologies. Some people are claiming I am overreacting and invalidating his feelings. Most people agree he was improper but think I should work it out with him and give a second chance because he's sensitive? I feel like I am losing my mind.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It woke me up because even though I have do not disturb on my phone, I have a setting that overrides that if there are repeated contact attempts over three in case of emergencies. Here's what I got. 3.49 a.m., Eee! 354AM, why did you send the pic? I know what it looks like, it's mine. 4AM, you need to respond to me because I think it's a misunderstanding about what this is.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
It's no big deal and saying you're switching stylists has me triggered. I do good works, you said so.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah, come on. 4.04 a.m. I also charge a $350 client separation fee. So yeah, you can't just say you're switching stylists without more consequences. What? And I know you said you already tried a few people before me. There aren't many beauty people in the area. 4.11 a.m., asking for an explanation for a stylist having hair in a salon is crazy. Where else would you find hair?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I didn't do anything wrong, but I will get rid of it if you're gonna cry about it, but only if you say you won't be switching to anyone else for your hair care. You mean a lot as a client and always tip well, and I do good work, so it doesn't make sense.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Maybe don't threaten someone who does your hair or hurt their feelings by making accusatory statements. I didn't respond to any of those that morning because it was so insane to me. I need to process things fully before I make a decision on how to deal with it, so I just didn't respond. Sunday afternoon, I started getting phone calls. This person called me 14 times that afternoon.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
About every other call, they left a voicemail. Most of the voicemails just said, call me back or text me back, but two of them were unhinged. I'm going to paraphrase, but the gist of the first one was, call me back, I'm getting scared you won't come back to me for your hair for real. I just like how your hair feels, that's why I kept it, call me. It sounded like they were crying.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
The second unhinged message was left late Sunday night at 11.38 p.m. and it said, I got rid of it except for one lock. I found out I like watching your hair burn more than I liked keeping it. I didn't respond to any of those messages, calls, or texts. The whole thing has me freaked out now. I decided by that time I was taking Monday off work to go to the police.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I am seriously 20% convinced I am experiencing a long lucid dream of some sort and wondering if I'm going to wake up or I am in a coma or something because this shit is so insane to me. Like, not really, but maybe really. I mean, what the fuck?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Even if they couldn't do anything, I wanted to file a report for the weirdness. I woke up Monday to an email from the stylist with an invoice for $375 for client breach of contract fee.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
As the chargeable line item. The email body was just, for being a bitch. I'm sorry, that's unfortunately hilarious. It was sent from their business email too, so they're really doing everything they can to ruin themselves. Even if I had a contract with them, which I don't, The original amount was for $350. They can't even get their extortion fees right.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I did email them back stating that we had no contract and to cease all further communication with me from this point forward. I got ready and started heading to the police station around 9.45 a.m. Monday morning. I live in a rural area so there are portions of my drive to and from our main town that don't have cell reception. Potentially. Yeah.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
The officer advised I contact a legal representative in case this person tries to take the bogus invoice to a civil suit court. And they said I'm welcome to change my number, but having the piling evidence if they continue to contact me after I explicitly told them not to in the email would only help me. I reached out to a lawyer Tuesday and left a detailed message regarding the situation.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
They are apparently out of the office until next Wednesday for the holiday, so we'll see if they have any advice. I've since received many texts and calls from the stylists. They sent a happy Thanksgiving text on Thursday morning as well. Regardless.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Regardless, they are giving me a lot of evidentiary material to work with, but I'm so unsettled. I can't wait to hear from the lawyer this week. I'll leave you with a text from this past week, one I think you'll all enjoy. 5.12 a.m. December 4th, 2024. Don't ever say never. You're never coming back. Don't make me laugh. I don't want your ass back. You can beg me, though. Might help.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
This situation and update may not be as satisfying as many would have hoped, but here it goes. I met with law enforcement again this past Tuesday. My husband and I drove over early that morning because I was also meeting up with the lawyer I'm working with. Aside from the near constant text calls, emails, I wanted to pursue legal action for a specific issue.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Allegedly, the stylist tried to have my credit card canceled. Apparently they used the last four digits of my card, called the customer service line for the card, and tried to cancel it. I got a call from the fraud department shortly after this person attempted to do this, trying to verify everything to see if I actually wanted to close my account and dissolve my credit card line with them.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
To be clear, the stylist was not successful in their alleged attempt. They couldn't provide the basic information you need for such things like my actual last name. It's unusual and they gave a name that was almost similar. Date of birth, address, et cetera. Apparently they thought they could accomplish this with just my name, phone number, and the last four digits of the card number.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I didn't cancel the card, but did request a new one for obvious reasons. I had no clue why they would want to cancel my card. To inconvenience me? Yep, that's exactly why, allegedly. When I spoke with the credit card company,
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
They agreed to send over the recording of the person that called as well as the phone number the call originated from as long as the request came from law enforcement with a warrant. They gave me a phone number and reference number for the police to reach out to directly. The officer began working on that immediately, so that is in progress. phone company over the weekend.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I had my phone number transferred to an old phone so I could still receive calls and texts there, but got a new phone number for my actual phone. The old phone and phone number has been turned over to the officer assigned to my case. They did go and speak with this person yesterday. Apparently they are horrified.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I went to the police and had no idea any of what they'd done could be chargeable offenses. According to the officer, there have been no further communications via text or call since their visit, and I haven't received any other emails. A temporary protection and no contact order has been issued against them until the first court date.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I have also reached out to the state board of licensing with all this information and my complaints. All I can say is they are investigating. Outside of that information, I'm limited to any other information I can share since a legal process against this person has officially begun. We're just waiting to see how this all plays out now. It's been a long few weeks. I'm hoping for the best here.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I'm already so relieved to no longer be getting calls, texts, or emails constantly.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
We're not going to figure out what she was really doing with... I mean, people said spell jars. Kind of doesn't matter. It's so invasive and weird and everything she's done afterwards.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
If you're texting someone... four or five messages in a row without a response. What's going on?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
But I'm saying, like, if you're in a fight, like, if you're set, like, and then, like, time goes by, and then you send more, and then time goes by, and you send more.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Oh, God. What does that, what? I don't know. I don't even think I fully understand what it means and I don't want to know.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
But if she had a reason, she would have given that reason.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah, that's when you know this person is... A non-exclusivity agreement with your stylist. I will say sending an invoice to someone and the body of it reading for being a bitch... It's almost legend material. This person is not a legend. But that sending an invoice that says for being a bitch is really funny.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
That's a really funny thing that people could do in other circumstances, and I would think is a legendary status. Not in this situation.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
These were intense. These were a lot.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
They're scary, yeah. These are scary.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah. They're creepy. These are all like people doing like unexplainable behaviors.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Um, so these are real scary stories, but you, what do you like about true crime or just watching? Cause I, I have a hard time with it. I like horror movies, but I like supernatural stuff.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Yeah, you're either crying or throwing up here at Reddit Stories.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Well, thank you both for joining me on this horrifying expedition.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Oh my God. I am very curious how anyone is trying to defend this and what they were told. Because it's like, there is no version of, yeah, so they were sleeping under my bed for a couple months without me knowing, where I'm like, Oh, well, you know, they're sensitive.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Like a demon. Thank you for watching. Let us know what other themes and subreddits you'd like us to cover on this show. And we'll see you next Saturday.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
If I woke up in the middle of the night and Courtney was under the bed, I'd be like... I don't know about this.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Sometimes I wake up in the middle of the night and my cat is under the bed and I'm like, you're freaking me out. You're freaking me out. You can't do this.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Just simply him going into his room uninvited, that alone, under any circumstances, is enough to be fully kicking that person out, not trusting that person. But this? I mean, this is so horrifying that I want to not believe that this story is real. But I also know that roommates out there do some weird stuff.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Don't. Roommates can be horrible. It's really hard to watch. The verdict was not the asshole. No, definitely not.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
They were just physically saturating. Comments, dude is not mentally stable and you need to get out of there. Sounds like he'd end up wearing your skin or some shit to physically saturate with you. Someone said, yes, you did shame him. Yes, you rejected his apologies. Why? Because he crossed so many boundaries of common decency, privacy, and basic human respect. This is the behavior of a predator.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
A stalker would do. Whatever trust you had with Carl has been broken, shattered into a thousand pieces. Not the asshole. Lastly, someone said, why would anyone say you should work it out with someone who is hiding under your bed every night? Yeah, I don't know what these people are hearing because there is no world where I'd defend that.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Are you talking about from ghosts or people?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I will say, though, having cats makes me not as scared of that stuff, because my cats are under the bed, so they're making sure there's no ghosts under there. And also, the nice thing about having pets, cats especially, is if they're freaking out, then I'm freaking out. Because they're so sensitive.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I mean, my cat's right there.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
My cat will eat any ghost that's out there.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I think having a cat has made, I used to be, when I lived alone without pets, I would be scared at night sometimes because you hear a noise and you're like, what is that? Whereas luckily cats, they do this thing where at 3 a.m. they decide, hey, I'm gonna fuck everything up.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
And so anytime you wake up in the middle of the night and you hear a noise, you're just like, yeah, that's Bones being a fucking weirdo somewhere. Like he found a bottle cap and he's throwing it around the room. It's like, okay.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Truly, like, a ghost could be around. I'm like, I don't care about you right now. Sorry. My cat's being weird. This was awful.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
There's no update. That's where that ends.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
You know, it sucks that the texts, everything before and after that this guy said made it all horrible, right? Because he did also say the things of like, are you open to experimenting? He's like, no. And he's like, we'll see. We'll see. I'd be like, what? Excuse you? You need to continue. What do you mean by that? We'll see. But the...
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Because otherwise, I'd be like, what if this is like a Larry David situation? Where like, he, something happened.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Like, he dropped his glasses. Like, he's like, oh no, I left my glasses underneath my, they fell underneath my roommate's bed. I need to go get them. So he's underneath the bed late at night. And as he's crawling out saying, sorry, sorry, sorry, you hear, dun, dun, dun, dun, dun, dun, dun, dun, dun, dun.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Not with that jacket. A couple lives ago, you were a lawyer in the 90s.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
No, that's what I mean. Everything he said. Why did he give up that information?
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
No, it's awful in every sort of way.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
You know the boogeyman is underneath that bed and he's like, I'm not even the problem here.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
Boogeyman's like, you are messed up, dude. This episode of Red Stories is brought to you by ZocDoc. When it comes to booking doctor's appointments, we've all made excuses. I'm too busy. It's too complicated. I don't know which doctor to go see. We've made them all. I know I'm guilty of that. But with ZocDoc, there's no reason to delay.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
They make booking an appointment with a doctor who's just right for you simple and easy. ZocDoc is a free app and website where you can search and compare high quality in-network doctors and click to instantly book an appointment.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
We're talking about booking in-network appointments with more than 100,000 doctors across every specialty, from mental health to dental health, primary care to urgent care, and more. Plus, appointments made through ZocDoc also happen fast, typically within just 24 to 72 hours of booking. You can even score same-day appointments.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I had delayed doctor's appointments for a long time because I thought finding a doctor in my network would be just too complicated to handle in the span of like less than an hour. But with ZocDoc, they made it so simple to find an in-network doctor that was nearby and that I could see pretty soon.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
So stop putting off those doctor's appointments and go to ZocDoc.com slash pitreddit to find and instantly book a top-rated doctor today. That's Z-O-C-D-O-C dot com slash pitreddit. ZocDoc.com slash pitreddit. Back to the show. All right, moving on to our next story. Let's see if that's the creepiest one of the bunch. Our next story comes from Relationship Advice. It's a 30-year-old woman.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
My student, who's 18, 18-year-old boy, made a super creepy comment. My husband, a 35-year-old man, thinks I'm being paranoid. I'm a high school English teacher and have been for a few years. In that time, as a woman, I've been used to teenage boys behaving awkwardly around me sometimes, and pheromones are part of the deal.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
There have been occasional comments, but generally in the vein of, miss, so-and-so has a crush on you, or miss, would you be so-and-so's valentine, it's all in good humor in front of the whole class or a large group and is well-meaning. My school throws a January ball for seniors, or 16 to 18, which is basically an opportunity to celebrate the start of another calendar year.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
As it's after hours, not every teacher has to attend, and this year I was asked to chaperone. There is no alcohol permitted, but obviously some of them sneak in hip flasks and so on. During this month's ball, two students were huddled at a table in the corner of the hall, not dancing, just keeping to themselves.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
And you're saying that lawyer died, you had a couple other lives in the 90s, they died, and then you were born.
Smosh Reads Reddit Stories
I Do NOT Feel Safe | Reading Reddit Stories
I know them well as problematic students who have difficulties socially, but also perform poorly academically, so they don't fit in with the popular crowd or the nerdy crowd. We have some of these every year. Poor hygiene, greasy hair, long fingernails, that sort of thing.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
And then the one who's got it all figured out, they just kind of go, oh, yeah, you're fucking fine. I don't know, it just seems like she's being punished for some reason.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
20 and 15, she's 23, her brother's 20, her sister's 15. And it's like, she's doing a bunch, and we don't know how much the siblings, the other siblings do for the mom, or help out around the house.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, no. But no. Yeah, the brother is 20. And it's not a big age gap between them all.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
And in this situation, they do all live close. And the mom, the family, they asked if she wanted to come and she said, I can't afford it. And that was that. But then she's paying for the others.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, so she bought four, she's accommodating four people. Rather than her own. But can't accommodate just one.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It really sucks. That's awful. The verdict is not the asshole, obviously. It's like, why are you the asshole here? Comments, not the asshole. I'd stop doing extra favors for her since she doesn't seem to appreciate it. Someone said, I get that this might cause drama, but it's not about being petty or causing drama. It's about communicating what's okay and what isn't.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Your sibling is 20 and getting their trip and their friend's trip paid for. This is the biggest issue here. Yeah, I mean, that's the first step here is to... confront the mom and say how it's making you feel. Do I have much faith that that'll do anything? We've seen these stories so much.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Usually the mom just completely sides with the others and just makes her feel crazy and like gaslights her but
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah. Sucks. Yeah, it sucks for you. My brothers are so much older than me, I don't think I dealt with that. They were like,
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It's just wild logic because at the end of the day, it's like, if you're the mom, wouldn't you want all your kids to go? It's not a matter of principle at that point. It's just like, oh, I want the whole family together, so let's all do this, but... There's gotta be missing context here. Probably.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I feel like we're missing a lot, so maybe we're gonna get some stuff. My younger brother and his friend were meant to share the room with my sister and her friend, but he decided he wanted to book his own room using his own money, so he did.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Then when I heard there's a room free in the apartment, I asked if I could just add on flights and stay there, but my sister was having none of it because they wanted it to themselves. So I rang my mom and was like, I can't afford a whole separate room. Like, let me sleep on the couch in my sister's room. She refused. I then said, well, can you pay for half of it with me? Because that's not fair.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
You may get whoever, insert sister's friend's name, is to do anything you want for you. My mother then said, yeah, okay, I'll go halves with you for it. So all sorted now, and I'll be sunning it in Spain in July.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It's like a conversation was had. It just sounds like all these people are like, okay, yeah.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She got a coupon on the family vacay. Okay, so this sounds like the ultimate in not communicating and not understanding the situation. It's because it sounds like she heard some stuff and came to further conclusions about what was going on when really it wasn't as intense as she thought. She talked to the mom and was just like, can we go house on it? And the mom was just like, okay, yeah.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
They're like, they're not threatened by me.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Like that was all, I think there's just not a lot of like communicating or thinking going on here.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
They're all sharing a room. And then the brother is actually paying for another room. I like how she called the sister and was like, can I share a room with you? And they're like, no.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It just sounds, I don't know. Just FOMO.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
This sounds almost a little bit more like an ego battle at this point. Yeah. A tiny bit. Because a part of me is also putting myself at 23, and I never had younger siblings, but it's one of those things I'm like, I get that it's a vacation, and it's probably really cool, but there's also the element of, like, All right, you guys go do that. I'm gonna go live my life.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah. All right. Okay. Next story. This comes from relationships. Boyfriend's mom called my blind brother, 25-year-old male, excess baggage. I, a 28-year-old woman, called her a piece of shit.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah. Yeah. My brother is blind, has been since birth, and he lives with me. Not that he needs someone to take care of him, just living with me makes his life much easier, and I like it this way. He is pretty independent and has a great job and great future. I am proud of him big time. Last month, we went to visit our parents back in our home country. We live in Europe, but we are from East Asia.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
My boyfriend is from here. So on the way back, my parents filled our luggages with stuff, gifts, food, etc., At the airport, we had to pay some excess baggage charges. Last night, I was at my boyfriend's parents, and I was chatting with his parents and sister. Boyfriend wasn't in the room when these all happened, so he didn't see anything firsthand.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
They asked about my trip and all, and I said it was all good except that we had to pay a lot for excess baggage, which was unexpected. She started laughing, which made everyone wonder. My boyfriend's dad asked what's so funny. She said that she just can't stop appreciating the irony that excess baggage had to pay for excess baggage.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I didn't get it at first, nobody did, but she clarified that your brother is like an excess baggage on you. You took him on a trip and had to pay excess baggage on the excess baggage as well. It's like double dipping just the other way around. I wanted to punch her in the face, but restrained myself, just told her that she's a piece of shit, apologized to the sister and dad, and came out.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Texted my boyfriend that I had to leave and we'll talk tomorrow. He came out and we talked a bit about what happened. He offered to go back in there and try to sort things out, but I refused. I told him that he's heard my side, so go in there and hear them out as well, and we'll talk about it again tomorrow. We haven't talked since, but we will tonight.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Sure, that's how siblings go.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Knowing him, I guess he will suggest some way to sort things out and make peace, but I don't think I'd want to, even if she agrees to apologize. What? Oh my god. What was that comment? It wasn't even that good. It's for people to say something so awful, and then when someone's like, what'd you just say? To be like, oh, so what I was doing was insulting your blind brother.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Mm-hmm. Before we begin, we have something exciting to tell you. We had a confessions episode months back where Trevor said he would confess something he's never told anyone if the video got 150,000 likes. And as of now, it has over 150,000 likes. So at the end of this video, Trevor, you are going to confess.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Just doubling down, let me explain. I was referring to him kind of like luggage.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Dude, oh my God. Oh, God.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, like, dude, read the room. Like... I can't imagine saying a joke of that nature, but it's like, saying a joke and you go, oh, you get that response, you go, I'm sorry, I don't know why I said that. I don't know why I said that. But not even that, she's like, oh, let me keep going.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
And she clearly says it in a way where she's like, this is like a deep down belief. And we all agree on this, right? That your brother is just excess baggage. Like it's not.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I guess we don't technically know. I'm not getting that from this.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
But yeah, the work this out mode, it's like, he's saying we could go back in there, somebody to sort things out. See, if I'm the boyfriend, it's like, no, you go in there by yourself and you confront your mom because that is on another level and she shouldn't have to go in there and face that. I would have a hard time believing that the mom just suddenly said something so awful.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
That is so awful, right? Was the boyfriend surprised? I'm wondering. He's not sounding horrified by this.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
When someone says something out of character, you don't respond in a way because you're trying to compartmentalize or figure out and make it all make sense. But the fact that she did respond so quickly saying you're a piece of shit means it's like, yeah.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
God. Comments, I wouldn't say you did anything wrong. She should apologize. He's a fucking human being. Someone said, you didn't do anything wrong except lose your cool, but I think most of us would agree that's acceptable under the circumstances. Hopefully your boyfriend will handle the situation with her appropriately.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
OP left a comment saying she just posted a Facebook status update saying, my son's girlfriend called me a piece of shit because she disagreed with how I described what happened on a trip. A Facebook status? That's crazy.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah. We're dealing with a kaiju here. Oh no. Okay, update. Oh, let's go. The next day. I foresee we're about to see even greater depths of hell from this lady. Yeah. Yeah, no, I don't think we've even scratched the surface on how awful she is.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
God. Okay, okay, this is the next day. She posts this the next day. Okay, this isn't good. Okay. I didn't realize it's a full moon. She's gone full beast. Oh my God. In case you missed it, yesterday she posted a message on Facebook explaining an edit in yesterday's post. So I talked to my boyfriend last night. He acted as I suspected he would. He suggested that it was a moment of madness.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She started it and I responded. We're both, okay, hold on. He acted as I suspected he would. He suggested that it was a moment of madness. She started it and I responded. We're both at fault and we can both apologize and move on from this. That's such a funny way to put it.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She went mad. Oh my god. This is bad. Yeah, you know, she doesn't think blind people are people and you called her a piece of shit, so. Hard to gauge there.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Sorry, no way after her post on Facebook. We had a long discussion. He doesn't want to take a side. All of these are besides the fact that she doesn't even want to apologize. I'm very disappointed in him.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
His dad called me yesterday as well, apologized for the mom's comment and said that she wasn't speaking on behalf of everyone there and that they found her comments to be very inconsiderate as well. I also apologized to the dad for the way I reacted, but he said it wasn't necessary. His sister called as well.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I think so. Let's get into this first story, shall we?
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She said it's not the first time she's making comments like that about disabled people, and she said she's ashamed. I decided not to engage in a social media piss war and stayed out. But while the mom's friends were commenting like, the young don't know how to respect these days, the sister commented that, mom, you left out what you said to her first, kind of proving her point.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Please put this down and stop. A few hours later, the post was gone.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Boyfriend let her down hard. Saying you're both at fault. Like, oh my God, dude.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
All right, here we go. This comes from Am I the Asshole? My girlfriend called me brother while having sex. It's not quite the sibling story we thought we'd start with. What if it's like a Hulk Hogan, like, oh, brother. I, a 28-year-old man, and my girlfriend, a 29-year-old woman, were in the middle of having sex. We were nearing climax when I went to grab her hand.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Mm-hmm. And that comment is unbelievable. And it was a comment, it was like, oh, she said something, you respond. It's like, your mom said something, and then doubled down and explained what she meant by it. Like, this was not a moment of whatever. This was a fully thought out thing. The sisters now agreeing, like, oh, she's,
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Horribly ableist and says horrible shit all the time awful, so yeah, I'm disappointed in my boyfriend if he had the balls of his sister He'd been great, but sadly he doesn't his dad and sister stood up to the mom, and he didn't I never make a decision Impulsively so I didn't break up with him although.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I'm leaning towards that decision I just need to think and any advice to this all is also very welcome and
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
You live with your brother.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
The brother lives, yeah, the brother lives there with OP. So like, yeah, they hang out all the time.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Her calling her a piece of shit is kind of going light on her, too. I agree. It's like, dude, when someone says something of that nature.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Okay, some comments. OP, in response to another comment, said, he always believes in keeping the peace between people and finding compromises to work things out no matter what. Sometimes though, keeping the peace is just siding with the bad person.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
He doesn't do anything, yeah. Someone responded, in that case, I think you explained to him in no uncertain terms how much his mother hurt you and how much he hurt you by not sticking up for you. Let him know that when he said nothing, it was as good as agreeing with her. Maybe, just maybe, he'll see where he's gone wrong and change, but if not, I guess you have your answer.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
His reaction to this doesn't seem so much about keeping the peace as being scared to stand up to someone. There's a big difference between those two things. Keeping the peace would have been, mom, come on, that's out of line and you know it. Apologize so we can all get past this, not silence.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I wouldn't believe any apology from them all What she said is deeply offensive Yeah, and she went to Facebook afterwards. So that's the nail in the coffin. Once you go to Facebook. Once you go to Facebook, it's done. It is done. You're telling me you post on Facebook all the time and you're ableist? What a strange. That's so bizarre. In other news, water is wet. All right, our next story.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
This comes from the Two Hot Takes subreddit. Shout out to Morgan. Over at Two Hot Takes.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
All right, here we go. My brother-in-law confessed feelings for me after I went wedding dress shopping with his fiancee. Wait, wait, read that back one more time. Check this out. My brother-in-law confessed feelings for me after I went wedding dress shopping with his fiancee. Let's fucking go, dude. Hell yeah, brother. Hell yeah, brother. Love this awkward shit. Let's go. Oh man.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
This just happened today and I'm using a throwaway because I promote my small business on my main and I want to be anonymous with this. Okay, I'm pretty overwhelmed, so I'll start with some background. I have been with my husband for five years. We've been married for two. Since early on in the relationship, I've been great friends with his older brother, partially because I always wanted one.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
When he started dating a girl about two years ago, I went out of my way to make sure she knew she had a friend in me if she wanted, since we're the only girls in the family. We're great friends now and since they got engaged three months ago, I have been helping with wedding planning and was asked to be a bridesmaid. We went dress shopping today and had a blast.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She quickly clasped it and pulled my arm toward her in the style of friendly handshake. She brought it in and said, hell yeah, brother. No! I couldn't anymore. My erection died, and, well, I felt like I just gave one of the boys a good old bring it in, pat on the back, and go get beers handshake. Had to tell somebody, thanks, Reddit, for listening to my misery. Dude, there's nothing I can say.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
We went to brunch, had some mimosas, found the dress, and went back to their house to celebrate. I ended up alone in the kitchen with my brother-in-law a bit after being there and he said he just had to tell me something before I kept eating at him. I was a little buzzed and confused but was not at all expecting him to say what he did.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I think I've had feelings for you for a few years and I've never been able to tell you and just needed to know if you have ever felt the same.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She's been married for two years. Oh, wait. But she's known this brother-in-law for years, and she's like, I've always wanted an older brother. So, very much. I completely froze and just shook my head. I told him that no, I have never thought about him in any other way than as a friend and a brother and I never would.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Before he said anything else, I bolted back to his fiance and the other girls there and very discreetly told her I got my period and wasn't feeling well and would have someone come get me and then come by soon for more wedding planning. She thought nothing of it and called my best friend to come get me. She dropped me off at home.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
My husband is working right now and there is no question that I'm going to tell him as soon as he gets home. But I just have no idea where to go from there. Do I tell his fiance? Do I make him tell her? Do I leave it? Do I have my husband talk to him? Has anyone ever had something like this happen or have any advice? Anything is appreciated.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Oh my god, bro. It's always crazy to me, betrayal is so intense, but when people make a decision that betrays multiple people at one time is shocking.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
That's really scary to be like, wait, I don't know you. And that's also a betrayal. It's a betrayal to his brother. It's a betrayal to his fiance. And it's a betrayal to her because she's like, oh, I thought we had this dynamic. You're my family. So it's like, oh, so you're suddenly, you're putting me in this situation now too. It is so... unbelievable to do to a bunch of people.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
But this is not her business. He made it her business by telling her this and
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
He's like, I have feelings for you. It's like, okay, well that's, your feelings for me is my business. Especially if you're cornering me when your fiance's in the other room.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, there's not much to say to that one.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
That's fair, go to the husband, talk about working at his unit, because it's also his business, because that's his brother. And that's your wife. As soon as she bolted out there, he's now probably gonna be like, how do I cover my business?
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, I have to get ahead of it. How the hell do people get married when they have this amount of feelings?
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I don't understand it.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It does happen all the time. And do people just have, I think, I wonder if people have no concept of time or the understanding of what a good man actually is. Because I'm like, wait, you understand what a marriage is. You understand what you are planning on doing. I don't know. I don't think people think about, I think this guy doesn't think about the next month.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Okay, it's better than I thought it was going to be. I thought it was going to be a weird fetish thing, and then it was like, no, she was joking around. No, she was joking around. But joking around in the middle of it, which... Unfortunately, it's funny as shit. It's amazingly funny. It's actually really funny. Yeah. I think it's kind of endearing. Yeah.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I just can't imagine getting married and having any thoughts of feelings for someone else or being unsure. I'm like, then don't do it, then don't do it. Oh my god.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
There's another, there's a possibility of like, he's settling, he knows he has doubts, he doesn't wanna do it, so instead of just, not doing it, he's trying to sabotage it.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, people sabotage their life in wild ways.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
No, not at all. And it's also that unfortunate thing where it's like, if the fiance knew this, obviously she wouldn't want to marry this guy, so she doesn't even know who she's marrying. And that's so sad.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I've fortunately just never been in this type of situation, but I... can't like, people know, even when we play werewolf, how I am with lying, but I'm like, I can't live with a secret like that. I'd just be like, I either have to remove myself and never see you guys all again, or these cards have to be played.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I do, it's crazy. Oh my god. Comments, you tell your husband first, discuss everything with him, and then make a plan. You are a team. Listen to what your husband thinks about talking to his brother first versus telling the fiance. In my opinion, you and your husband should talk to his brother together and let the brother tell his fiance.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
If he won't tell her, then tell the fiance before they get married. Someone said, brother-in-law knows she fled. He knows it's highly likely she'll tell her husband. Damage control on his end would be immediately to tell his fiance that OP confessed feelings to him and then fled when he turned her down.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
He doesn't necessarily need his brother to believe him if he can get his fiance and the rest of the family to believe his version of events. In fact, he doesn't even need the family to firmly take his side. It's more likely they'll forever doubt who to believe, which will make everything awkward from now on. Hmm. It caused a huge mess in our family for about a year.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
We all kind of moved past it and still see each other at get togethers, but it is awkward to say the least. I'm sorry you're having to deal with this too. It's a hard road to navigate.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah. Ugh. That sucks. Yeah. No update on it, too.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Our final story comes from Confessions. My daughter's friend in elementary school was actually her sister. In our younger days, the ex-wife and I would get drunk and have foursomes with a coworker and his wife.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
All right. They were never able to have kids. Suddenly, she became pregnant. My wife also became pregnant. No one ever really said much about it. After several years, I had a new career. We moved away, then came back to the same area. One day, my daughter came home and said she has a twin sister in her class and named the girl. Yep, it was her.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
We all denied it, but now she's an adult and I'm pretty sure she knows.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
You're getting there.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Awesome. The other couple that they were having foursomes with couldn't get pregnant, but suddenly she got pregnant.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Is that what we think? OP is probably the father of both.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yes. That's what's going on.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It's not twins, I just think this other girl looks exactly. They both got dad's genes. Yeah, and they both probably got pregnant at the exact same time.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I don't know either. I mean. Just having fun, I guess. I don't know how long they've been together. That's true. But I don't know. Some people, they like to joke around.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
We all denied it, but now she's adult, and I'm pretty sure she knows. So this other girl is like, yeah, I figured it out, and it's not great. She's like, I've done the math and the equation is definitely. And she's an adult. She's an adult now. So this is many years ago that this happened. And so now.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Dude. There's the other one where... He knows what I'm talking about. Oh, immediately where... Oh, that one's so much worse. That's somehow worse. Yeah. You read some wild stories. The one where the girlfriend finds out that her boyfriend had a threesome with her parents like 10 years ago. 10 years ago.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Unfortunately, in that story, we did the math, and she was 13 when this threesome happened, because her boyfriend was older than her.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She might have been in the house. Maybe not. I don't know. Dude, that's crazy. Oh, no, that's brutal.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Look, man, if you're having threesomes or foursomes, there's a lot of people involved. A lot of things can happen afterwards. Things can happen. Just do your research. Yeah, there might be results years down the line. Some comments. Plot twist. OP isn't the father of either. The other guy is. Someone said, did this stop the foursomes or not?
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Someone else said, well, she has a ready-made spare for a kidney if she ever needs one, so there's that. Lastly, someone said, literally what's done in the dark will come to light.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
These Redditors are like, I've never had sex, but this sounds crazy.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
But no, they're just going for it. They would get drunk and have foursomes, so they're just, that's crazy.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I can't believe it all happened and they're just like, we're all just not gonna discuss this.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
They moved back. And then suddenly it was like, oh.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
That's why I've never been back to Tucson.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Tucson. Nothing good happens in Tucson.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Well, that's it for all the stories, but Trevor. Your confession.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I need to know what happened after all that. Because he ends it right there and just says, like, oh, my erection died. And, well, like, that's okay, cool. How did you guys reconcile that afterwards? Like, did you guys both laugh, whatever? Like, you know, I think that can be a growing moment for both of you. He's just like, that was weird. Yeah.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, I'd say all right guys.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
To go into a bathroom and just go, everywhere's my toilet. Yeah. And to just start spinning around.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Just drop down and spin. Maybe you were like...
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
That's incredible, man. Do you feel better? I don't know. So you literally haven't told anyone this. No. So do you think any of the teachers from that school might watch this show and are now like, yeah.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
And she just takes off the ring.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I don't know why I was doing it I was in my life I think it I think a child or developmental therapist would be able to figure it out like within one session of why you were doing it because I think it's just like a control thing or like a Soggy toilet paper makes me sick. Oh, that's crazy.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
So you'd have to get down under and pee up anyway.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Someone peed perfectly on the mirror that says piss boy.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
You're like the Zodiac Pisser, but you're like leaving marks on the walls that they have to decode.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Dude, once Angela watches this, you're done, dude. Dude, it's over, man.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I don't have a story. I wasn't in fourth grade, but when I was like five, I've told this story before, forever ago. My brothers are half-brothers, so on the weekends, their dad would come and pick them up for the weekends. And I didn't understand it. I'm five, so I'm just like, oh, my brothers are just leaving for the weekend. I want to go with them. And it was like, no, you can't.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I was in Virginia when this happened. So maybe it's a Virginia thing that you miss everywhere. So they take them, I'm on the front porch, and my mom's like, no, you can't go with them. She goes back, she's like, come on, come back inside. I'm standing on the front porch, and I'm so mad. That I'm like, my brothers are gone, I don't get to hang out with them.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Comments, when his erection died, he should have tagged in someone else. Someone said, man, I misread the title of this post. I'm sitting here wondering why she'd call your brother, and now I'm just here disappointed that you'd lose interest in your girlfriend who just pumped out an all-time Hulk Hogan impression. You're the asshole.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I, on the front porch, drop Trow, and just start peeing off the porch.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
You don't have much.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
When you're a kid, you don't have many resources. But you do have piss. You have piss.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Look, when you're five years old, you can get away with a lot. If I did that now, I'd be in prison. And then it was funny. Oh, my God. Fucking A. All right. Incredible. Trevor, thank you for your confession.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I hope you're all happy.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah. Appreciate it. We really appreciate it. Thank you for watching. Let us know what other themes and subreddits you'd like to see on the show. And we'll see you next Saturday. Bye. Bye. Oh, that was great.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It's not even an asshole post. This guy is asking if he's the asshole or not. It's like, what? Someone said, if you're not laughing and having fun while you're fucking, you're doing it wrong. I love this guy getting roasted in the comments. Like, you're going down, brother.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I actually ended up finishing.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
She walks into the bedroom one day and there's just a whole ring set up. He's like, all right. Okay, our next story. Am I the asshole for refusing to buy a gift for a kid because it's their sibling's birthday? Okay. Last week, I was invited to my friend's house to celebrate his kid's birthday. When I asked what I should bring for the brat, my whale, damn.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Last week I was invited to my friend's house to celebrate his kid's birthday. When I asked what I should bring for the brat, my friend informed me that they like to give both kids gifts so no one is left out of the celebration. I said okay, and when I arrived, I gave their birthday kid a gift and my friend a six pack.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
His wife mentioned that the other kid is going to feel left out, but I informed her that although she's welcome to raise her kids how she likes, it doesn't mean anyone has to subscribe to the same parenting style. Am I the asshole?
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I got a brewski for you, kid. I mean. Happy fifth birthday.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Yeah, I'm like, damn, okay, dude.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I don't feel like that's conducive for prepping yourself for life. Because it's like, hey, man, once you're an adult, there's going to be situations where people are going to get shit and you're not. And you better be emotionally prepared for that.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I understand that's a lot to be like, hey, buy two gifts. It's like, whoa, okay, man.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I don't have a kid, but like... I never, as a kid, expected my parents' friends to bring me anything. If a friend of mine is coming to my birthday party, I expected a gift from my friends. So their parents would be helping. But if it was just some random person that was a friend of my parents, I'd be like, cool, dude.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I just am like, I don't know. I guess it's also the principle of it all. I'm just like... This sounds to me like you're avoiding like parenting by just alleviating the situation. Like it's easy to just be like, oh, this makes you feel bad. So we're just gonna like make you feel good instead of teaching you the lesson of like sometimes. Sometimes it's someone else's day and it's not your day.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Hello, and welcome to Smosh Reads Red Stories. I'm Shane, and today, the theme, siblings. And I'm here with my brother and my sister. Hello.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
But I feel like this is gonna make this kid a nightmare.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It's a lot. I agree with his sentiment of like he doesn't have to subscribe to other people's parenting style. I agree with that. Did it say how old the kids are? I'm assuming pretty young. Brat age. Brat age, yeah. Imagine it's just like 16 year olds. He's a lot. He's not the asshole. I don't think he's the asshole in this situation, but I'm like, hey dude, okay.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
The verdict was not the asshole. Comments, not the asshole. The parents are being entitled. Asking for an extra gift just so the other kid doesn't feel left out is out of order. An extra present costs money and it's the birthday kid's day, not a free for all. If the other kid feels left out, that's on them, not you. Someone said, I have relatives who did this.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
The oldest was eight when the sibling was born and had been spoiled before. The older one always wanted a gift on the sibling's birthday but got mad when the sibling got a gift on their birthday. The older one really took up the entitlement in college, now hardly ever contacts the family. Wow.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Someone else said, LOL, I would take one of the six-pack cans and give it to the kid. He wouldn't be able to drink it, but it's the thought that counts, right? Exactly. Someone said, everyone sucks here. It's good for kids to learn that not everything is about them, and it's entitled to expect people to buy gifts for the non-birthday kid.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Siblings, everybody always gets along, right? Siblings, there's never a problem. Everything's always good.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
But if you're referring to the birthday kid as a brat, you should just stay home. I think we landed on that too.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
It's kind of purely an ego thing. It's just like, I'm mad that this person's getting a day and I'm not getting a day. It's not, because yeah, you're right, at a birthday party, no matter where you're at, there's so much shit everywhere. But.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
No, those videos of a younger sibling wanting to blow out the birthday candles of their older sibling.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Okay, our next story. Am I the asshole for crashing out because I'm not invited on the family holiday? Whoa.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Crashing out. Crashing out.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Are you familiar with crashing out?
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
So you have sisters, you have a brother.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Okay, crashing out.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
Hi guys, 23 year old woman. My family recently booked a holiday and asked if I wanted to come. I said I couldn't afford it and that was that. Recently I was talking to my mom and she said that both of my younger siblings are bringing a friend that she is fully paying for. My brother is 20, like he lives at home and she is paying for him and a friend.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
and my sister, 15, and her friend get to go on an all-inclusive holiday to Spain. It was the same last year. They all went on holiday without me, but last year they didn't bring anyone else. I was fine with it until I heard my mom's paying for other kids to go but wouldn't bring me, so I'm annoyed with her. I do so much for her as well, like way more than my other siblings.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I live 10 minutes down the road, so I am always picking up slash dropping to school or doing things around the house for her, but I'm butthurt that she clearly had this extra money to spend to bring other people's kids on holiday, but not me. Am I the asshole? Edit.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I initially asked her a few weeks ago for her to tell me how much it would be if I booked on it, because I would have went if it was affordable. She got back to me saying it's $900, and I just said I couldn't afford that anyways, and that was it. Until I found out she's paying for two of my siblings' friends. She said in convo who was going, and I just said what?
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
You could have paid for me to go, but instead you're paying for two other children. And she ignored that comment. I love how I know this person's crashing out based on the writing style of this. Like they're writing this for roaches. Ah, dude, I don't, there's a lot, I mean there's not much missing. Like it does suck that the mom is paying for two siblings and friends, but won't pay for her.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
I mean, I don't know. It just... I don't know. It might be one of those situations where the oldest is like been responsible and is kind of getting punished for it. Like the mom is babying the younger two. I don't know. It just always seems like in Reddit stories, and I don't relate to this because of my family dynamics. I never had this type of situation.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
But in so many Reddit stories, it seems like the like... the children who just are struggling or are kind of assholes, the parents just do everything for them. It's almost like maybe out of desperation of like, oh, well, I have to be there for them. I have to give them this life because I don't know.
Smosh Reads Reddit Stories
Brother From The Same Mother | Reading Reddit Stories
You made your older brother cry?
Smosh Reads Reddit Stories
Why Would You Post This Online?? | Reading Reddit Stories
When you think about businesses that are selling through the roof like Ello or Allbirds or Skims, sure, you think about a great product, a cool brand and brilliant marketing. But an often overlooked secret is actually the business behind the business, making selling simple. For millions of businesses, that business is Shopify.
Smosh Reads Reddit Stories
Why Would You Post This Online?? | Reading Reddit Stories
Nobody does selling better than Shopify home of the number one checkout on the planet and the not so secret secret with shop pay that boost conversions up to 50%, meaning way less carts going abandoned and way more sales going.
Smosh Reads Reddit Stories
Why Would You Post This Online?? | Reading Reddit Stories
So if you're into growing your business, your commerce platform better be ready to sell wherever your customers are scrolling or strolling on the web in your store, in their feed and everywhere in between upgrade your business. and get the same checkout Allbirds uses. Sign up for your $1 per month trial period at shopify.com slash try, all lowercase.
Smosh Reads Reddit Stories
Why Would You Post This Online?? | Reading Reddit Stories
Go to shopify.com slash try to upgrade your selling today. Shopify.com slash try.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Hello, and welcome to Smosh Reads Reddit Stories. I'm Shane, and today's theme is liars. And I'm joined by one liar. Yeah! And one person who tells the truth. Good! Which one is it?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah. I mean, absolutely. Don't let him get away with that lie.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
No, I'm thinking more about the grand picture of this, of, like, where you guys are at as far as, like... I think it's really complicated in a relationship to buy a house... And it's like, if you're not going in on that together, I don't even mean financially. Just like, it doesn't seem like they're together as a team doing this.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Like, you know, it's almost like, but I don't know how long they've been together for. Six years. Six years.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Because I guess the way I'm seeing it is like, you know, they've been together for six years. They're not married, but I'm like six years. I'm like, you're in a very serious relationship. I don't care if you're married or not. So it's like, but she bought this house. I'm like, you bought your house. But then he's claiming that he bought this house. I'm like, that's intense.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Because you didn't buy it as a team. You didn't even, it doesn't sound like they even discussed it together. So that's where I'm like, are you guys even really like, is this relationship serious in where you're going? And that's so disrespectful what he did. Like that is extremely disrespectful. I'd have a hard time being like, oh yeah, we can, this relationship can keep going forward.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Not only is he taking away all of her accomplishment and just making it entirely his own. Not even, the lie wasn't even we bought a house together. The lie was I bought a house. He's taking away her accomplishment entirely too. He's not even, it's one thing even if he said we bought this together, he could be proud of her. But I don't know, he's embarrassed.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah. They were funny.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I agree. the family brought it up. So he lied to them and said, I bought this house.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It does bring up another, and this is what I talk about with cheating and all this stuff. I'm like the layer of disrespect of like, and you're going to go along with it. Right. My girlfriend's going to go along with this lie. It's like, Damn.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I see that. I can't fault her for what she said. No, no. It is also pretty badass and funny what she did. It's really funny. But he started this. Like, he lied. He premeditated lied. It wasn't a momentary, like, that maybe. But he thought this out and he lied to the family beforehand. He didn't even tell her, like...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That would... I mean, buying a house in today's world is an extremely hard thing to do. And it's... Not only that, it's like a big risk. She put all her savings into it and everything.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And here, the most important person in her life, who's supposed to respect her more than anyone else, blatantly disrespects her. Like, I... I'd be so pissed.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And this is just not gonna work. It's not working. It's not gonna work. Their values are just so different. You know, like they're...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay. Let's get into the lies. Our first story comes from True Off My Chest. I've been hiding a huge secret from everyone in my life for the past three years. Iconic. No, no. Oof. All right, what do we think this lie is? Three years they've been holding this.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And I do not think this situation is a deal breaker in itself. I know so many couples where one person makes more money than the other. That's almost how it's just going to always shake out. And I know that. And many different variety, right? Like, I know plenty of couples where a woman makes more than the man or whatever, and they're fine.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Because they're a team, and you can tell, like, they view it all as, like, we're working together. Yeah. And there's also just a level of security. Like, dude, it's a different world now. Right. Like, stop.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That's the big one. And to go to what you said, like, it's okay to feel insecure. What action you take upon that, though, which is what he did. Right. You know, it's like, if he goes there and he goes, you know, hey, sometimes I feel... I don't feel great about myself. I don't feel, like, good. She clearly doesn't care. I, at least I'm reading from this. Right.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I feel like she's okay with this situation.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
So, the verdict is advice needed. They just want more info. Hmm. But we have several comments here. Someone said, not the asshole. The fact that he said nothing actually speaks volumes. He wanted to look like a big man while riding his girlfriend's coattails. As for the breaking up part, I think it would depend on what he actually told his family.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Did they assume he contributed or did he tell them he did? If he told them he did, he's stealing your valor. Get him out. OP responded, Kate told me he said he contributed. Tomorrow, I'm contacting him to see where this all goes. All right, so I guess it depends on what he said. Okay. I think I'm going based on the assumption that he told them I bought the house.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Which isn't fair. I get where the advice is needed of what specifically did...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
She went under the assumption. And then also in the moment, she was like, wait, who bought the house? And he stayed silent.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Gave her nothing. Yeah. Because he could have in that moment been like, oh, no, we both contributed. Totally.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah. Someone said, soft, you're the asshole. Here's my question to you. Why was it so important to you to set the record straight when it came to who actually paid for the house? I would have probably raised an eyebrow at Matt with the inherent promise of we will be talking about this later, but I don't think I would have humiliated a man that I professed to love in front of his family.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I mean, did he actually tell them that he bought the house or did they just infer it in a sexist fashion? However, if this is all part of I'm getting tired of his fecklessness and financial insecurity, and his lies on top of that was the straw that broke the camel's back, then you should probably start to think about what life looks like without Matt.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I would have been disappointed that he did not correct them, but frankly, it's nobody's business who paid what for the house. That had 74 downvotes, so a lot of people did not. Yeah.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I do also, something I was thinking earlier was that I'm like, his family knows the financial, I would assume the family knows like his job and whatever, the financial situation, so like, I get that there's the sexism of like, oh yeah, we immediately believe you bought the house or contributed the most.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Borderline unheard of. Yeah.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I will say, like, I would view any couple who's buying a house, I'm like, oh, you guys bought this house. Together. I'm not going to do this thing of, like, you out of the two of you did this. Of course he bought the house. Yeah, that is also striking me as a little odd.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
OP responded to that comment saying, it was definitely more of a straw that broke the camel's back situation. As I said in the past, financial insecurity is a major problem in our relationship and shit like taking credit for purchasing small things has happened before. Never anything as big as taking credit for buying the house though.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
68 upvotes. There's a pattern here. A different commenter replied, imagine if you had kids with him, he'd probably take credit for giving birth.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Someone said, so it isn't worth breaking up over this specific thing, but this is now a pattern. You say, I'm the main breadwinner and that has always been a struggle in our relationship. I would say he's pretty insecure about earning less than me. This is why you break up. I had an insecure boyfriend who was threatened by my achievements once. It sucked.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
They constantly pick at you to bring you down to their level and or you start not talking about your achievements as much to lower their sulking and passive aggressive behavior. It is a very unpleasant way to live. There are literally millions of men out there. Why live your life with one that doesn't meet a reasonable standard? Now, I definitely would not have just left like that.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
This should have been a conversation between the two of you, ideally. But I do get wanting to set the record straight. I will say, not the asshole, but you could have handled it better. OP responded, this. I'm worried if I stay with him, shit like this will continue. Yeah, I mean, that's... Very possible.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I think that's what I was thinking from the start of this, is just like, this does not sound like it's going to work.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
If your partner's not your biggest fan, and isn't rooting for you to be the happiest, ultimate version of yourself, then what the fuck? What is the point?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay, some good guesses.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
One day later. Hi, Reddit. I'm back. Last night I posted an Am I the Asshole and it kind of blew up. I don't know Reddit standards, but I think 400,000 views is a lot. So some stuff happened today. Matt, fake name for boyfriend, came back to the house. I was assuming he was coming back to get his things and leave, but I was unfortunately very wrong.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He literally told me he could forgive me and that he was moving back in as if that was a good thing. I was so shocked, but he was dead ass. So as any sane person would do, I grabbed all his remaining stuff, gave it to him, and told him to get the fuck out. He got really mad at that and I was worried he would get aggressive, so I called Kate, sister-in-law, for backup.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Oh, you think it's a college thing.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
She was really helpful and drove Matt home. As soon as I can, I'm changing locks. As for some of the comments, I pay the mortgage and I don't even think Matt knows what a mortgage is. I live in Canada, so I'm not sure if I have legal rights to kick him out. He has stayed with me for just over a year. I am trying to seek some lawyer advice.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Thank you for all your help, and I will try to update if I can.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's worse than that, though. I pretended to graduate college. I walked across the stage, wore the cap and gown, had the family celebration, took pictures holding a fake diploma cover, the whole thing, but I never actually finished my degree. One semester before graduation, I just cracked. I was burnt out, failing a couple of classes, and too ashamed to tell anyone.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I feel like in these stories, Like, brother and sister-in-laws are often the ones who can end up being an ally in a weird way. Like, families you can't rely on a lot of times.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Sister-in-law's like, should we kill him?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
The pattern continued, and she clocked it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah, damn. All right, our next story. Am I the asshole for not telling my friend that the volunteer gig he flaked on was actually paid? What? No. So I, a 23-year-old man, and my friend Ryan, a 23-year-old man, are both in engineering. Last month, our department posted a call for volunteers to help run logistics at a local tech conference.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It sounded like a good networking opportunity, so I signed up and I told Ryan about it too. He was like, eh, not worth the time unless they're paying. Fair enough. I showed up the first day and to my surprise, they hand me a badge, free food vouchers, and say we'll be getting a small stipend at the end. Like, not huge, but still $300 for two days. Not bad at all.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Ryan texts me while I'm there like, yo, how's it going? And I just say, not bad, chill so far. I didn't mention the money because one, I didn't know how long I'd be staying and two, he already decided it wasn't worth it. Anyway, after the event, I got the stipend and posted a pic of the staff group on IG. Ryan sees it and asks, wait, you got paid? I say, yeah, it ended up being paid after all.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He flips, says I was shady for not telling him, that he would have come if he knew, and that I knew he needed the cash. He told a few people I set him up to miss out on it. But like, he made his call. I didn't know it was paid either at first, and I never lied to him. Am I the asshole? I love this person writing this thing.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
They're all holding the $300. Money!
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And free food vouchers. Yeah. I guess where I'm confused is like... I'm like, was he even able to join once he got through? I'm like, you're already on the job. You can't just show up.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
You set me up. It's like, dude, it's not like if he got paid, I wouldn't get paid. Right. It's kind of, I'm confused. Like, the flipping out, I'm like, hey, man, like... I don't know.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I think he's just upset that he did miss out now.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
The verdict was not the asshole. Comments, not the asshole. They needed you there in the beginning for a quick volunteer orientation, right? I've done this event work before. So when you found out it was paid, it was too late for him to get paid. Make sure he knows that, and that should be the end of it. And you were right, by the way.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
The networking opportunity was worth more than the $300, and I hope you got some contacts out of it. Maybe one day Ryan can decide an internship you go for isn't worth it and you'll find out it was paid too. Then later, Ryan will wonder why he didn't get a job offer. Someone replied to that saying, in this market, networking is worth months of employment.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
So instead of facing it, I faked it. I told my parents everything was on track. I bought a cheap gown online, faked the graduation date, and made sure the ceremony wasn't open to guests due to limited capacity. Since then, I've been working random jobs telling people I'm between offers or exploring different fields. It's a constant weight on me.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
When you spend months trying to find a job with no luck while the person who networked finds a contact that is looking to hire, OP's friend is short-sighted if they thought it wasn't worth it without cash up front. I love these commenters. One of them is like Ryan's mom.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
With almost any Reddit story about any sort of career, I, of course, am overall out of my depth and clueless because I've worked this job my entire life. But in the acting field, that is a very similar sentiment of, like, you do...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
When you move out here, you go under the assumption of you have to take every opportunity you get, whether it's paid or not, because you need to make a ton of contacts and friends.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Right. Someone else commented saying, you're the asshole. He didn't flake on anything. He said he didn't want to do it unless it was paid. If you're his friend, the moment you found out it was paid, why wouldn't you tell him? That's so weird. If he's some random dude you work with, who cares? But you yourself said my friend, so I assume you're, you know, friends. He made an uninformed choice.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
You then got more information and purposely withheld it from him for some reason. Sounds weird and definitely on you.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Someone replied saying, real talk, by the OP's justification, it doesn't even seem like he considers the guy his friend.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Because Ryan texted him while he was working. He was like, hey, how's it going? And he responded, not bad, chill so far. He said he didn't mention the money because he didn't know how long he'd be staying. And he already decided it wasn't worth it. That his buddy already decided it wasn't worth it. But that's not...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
The stakes are low for me a little bit, but it's like, it's like, okay, you decided it wasn't worth it when you didn't know you'd get 300 bucks, but now there's 300 bucks involved, so.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah, we don't have, this is a very short story. You know, it's one of those types of situations, and I think it's true for a lot, where I'm like, You're the asshole depending on the level of, like, friendship you got going here. It's like a random acquaintance. I'm like, you don't really owe them as much. But it's like, hey, if you guys are buddies, what has this guy done for you in the past?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I've had panic attacks just thinking about someone finding out. My parents still proudly mention that I'm the first in the family with a degree. Oh. I hate lying to them. I hate lying to everyone. I've finally re-enrolled and I'm taking night classes now, slowly fixing the mess I made, but it still feels like I'm living in a lie.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
What have you done for him? Like, hey, what's the trade-off here? Whatever.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But what I will also say is, I still don't think it warrants the reaction he got from his buddy.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
His buddy flipping out, like, you set me up. Like, you're, like, I hate you level. And it's like, whoa, man.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah, and it also depends on what's going on with this friend's life. If this friend is working and grinding nonstop and he's just like, oh, any chance he can get where he's not working, he's got to take it. He's like, I don't have the time to volunteer right now. There's those things too, but we just don't have that info.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
One last comment here says, not the asshole. Everyone thought it was a volunteer thing. Turns out that they actually paid the staff, which is awesome, but not your fault or problem. Ryan didn't want to give up his weekend, I'm assuming it was on the weekend, for free. And that's understandable.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Still, no one's fault here, but Ryan became the asshole for acting like you intentionally screwed him over. You even offered the opportunity to him and he rejected it. Yeah, I really see that one because it's the response after the fact.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I mean, I don't know these guys.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Dude, freaking Ryan, man.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
All right, there's a solution.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
You would kill. You would kill. I would kill people.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
All right. Our next story. This is a confession from the subreddit Confession. I've been faking an allergy for years. And now it's gone way too far.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Honestly, everyone with an allergy.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay, what's the allergy?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Faking pollen would be tough. Because that's everywhere. Yeah. Men.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I don't know if I'll ever have the guts to tell them what really happened. Damn.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay. This started as a dumb excuse, and now I'm in too deep. Years ago, I went on a date with this girl who was obsessed with peanut butter. She kept pushing me to try her peanut butter smoothie, even after I said I wasn't in the mood. Instead of just saying no, I blurted out, oh, I can't, I'm allergic. Big mistake.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
She was super concerned, asked a million questions, and I figured, whatever, I'd never see her again. But then she introduced me to her friend group, and they all knew about my allergy. At that point, correcting it felt too awkward. Fast forward six years. I'm still friends with these people. My allergy is a known fact. They warn restaurants for me. They check ingredients.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
One of them even threw out a peanut butter cake someone brought to a party just to be safe. The worst part, I love peanut butter. I eat it in secret. I have a stash at work. Once my best friend said, man, it must suck not knowing what a Reese's tastes like. And I just nodded solemnly. Best friend? His best friend at work. Or wait, no, once best friends, how, wow, okay.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Now, my girlfriend, who also believes I'm allergic, wants us to move in together, and she's super cautious about food. I'm terrified she'll find my peanut butter stash and think I've been lying to her. Well, she'll know you've been lying to her, which I have for years. I have no idea how to get out of this.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay, to be clear, Arasha, you thought this was a prank.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Do I fake a miracle recovery, a medical misdiagnosis, or do I just keep the lie going forever?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I don't think so. I don't think so.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
New girlfriend. He was dating a girl, but he met friends through that girl, and then it just spread like wildfire. Like peanut butter. And now everyone knows and everyone thinks that it's at work. it's invaded everything. Oh. Over not wanting to try a delicious peanut butter smoothie.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
However, can I also say, whenever someone's like pushing something on me and they're like, here, try this. I'm like, no thanks. And they keep trying. I'm like, no thanks. You gotta fucking stop.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
If I say no, if I say no, you gotta respect that.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
No matter how delicious the smoothie is.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But he then did this and he kept it going for six years.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah, he could have instead in that moment said, hey, please stop asking. Hey, please stop. Hey, fucking stop.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Don't allergies, is this a myth that allergies shift every seven years? So he could, hey, he could just say, hey, it went away.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It sounds delicious. your smoothie on people?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Look, peanut butter smoothies are delicious.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's really dangerous because this paints a horrible narrative for all the people who really have allergies.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's so serious that it's got to be terrifying because peanuts are fucking everywhere.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah. I was always confused by that. I was like, out of all the foods, you chose the one that kills a lot of people. I was like, you know, there's a lot of snacks out there, and you chose peanuts? Yeah, come on. I understand it's probably cheap and easy, but...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
So you think, oh, you can graduate. Their logic is, I'm going to graduate. And then it's all true. It was still a lie.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Come on, man, people, like, because I know, I knew of people who had severe peanut allergies where they had to wait for specific flights where they would, like, clean out the whole plane. Yep. And, like, vacuum, like, do intense cleaning because, like, they can't fly.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I mean, we're... Get out of here. We're... We have a lot of people, there's a lot of people at Smosh who have a lot of severe allergies and we're extremely conscientious of it. So it's a very serious thing. I do think lying about allergies is a very serious lie. It's a no-no.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I don't know, man. I don't think he can. He's in pretty deep. Compared to other lies, it feels like such an innocuous one at face value. But the length of time and the amount of effort they've all put in for this.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I'd be thinking about that shit. I'd be like, we threw away a delicious cake for you.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
You think they should confess once they get it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Also, like, he's got a girlfriend who he's going to move in together with, and he's been lying about a huge aspect. I'd... His life could blow up.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He might get hives just from the stress.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
There are so many things he could have done that would have been, like I said, I'm mad at the person for pushing anything on you when you say no.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But he could have also just been like, hey, I'm leaving right now.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But I'm allergic is probably the one you can't do. And then to stick with it, because he could have said, I'm allergic, and she could have been like, oh, I'll water. And then later been like, I lied, because you were pushing it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But lies make you keep lying.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I, yeah. Yeah. He's not going to be in the clear, though, because he's, for one, he's going to know that he lied for six years. But it's also going to be a thing. It's going to keep getting brought up of like, man, and you were so allergic to peanut butter for seven years. And then you were. And he has to keep being like, yeah.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He's dunked in peanut butter. He's kept his family a secret because they work on a peanut farm. Yeah.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
My great grandpa, Jimmy Carter. This is my dad, Dr. Jif. It's pronounced Gif.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay, comments, comments. Someone said, I'm going to be real with you. Misdiagnosis is your best bet. Your next step is telling her you're seeing an allergist who's been microdosing peanuts for you to get to eat them and voila, cured. It's actually a thing. And what's one more lie? Dude, come clean or do it quick before she marries you and has access to your medical records.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I didn't know that was a thing.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I would certainly hope so.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I hope that's the case everywhere. OP responded, okay, I actually didn't know this. Is this common knowledge to everyone? Someone responded, it's common knowledge to people who know people with actual peanut butter allergies.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Someone said, just say your parents told you you've had a peanut allergy since childhood and you went to an allergist to inquire about microdosing and they did some tests and you found out you've outgrown the allergy. Blame it on Dr. Jif. OP responded saying, I think this is the safe one. Mentioning microdosing and the tests will help for sure.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I'm not the best liar, but hey, I was lying in the first place and I just won it over with. I'm going to be real honest with you, man. I think you're a good liar.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That's a lot of practice. You know, they say it takes 10,000 hours to master a skill. And I think six years, you're pretty good.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I think you've actually done it. You've done it, buddy. I'm not going to do that math right now.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
His life will blow up if he tells the truth.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Well, that's what happens when you lie. Don't lie.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
No, this is awful. This is my nightmare. My nightmare is this.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Here's the best possible situation.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He, the seven-year mark hits, and he develops a peanut allergy. What if he actually started to develop one?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That would be like Twilight Zone. That's the Twilight Zone ending where he does develop a peanut allergy.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It could theoretically happen.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay, as far as we know. What?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Right. I feel so much more stress with any lie. I'd rather face all the other things, like the shame, the uncomfort, everything else. But knowing that I'm on the surface is so nice. Because I'm like, okay, this is all true. Like, you might lose out on a lot of things in life by not lying. You might. Like, people do go places by lying. But I'm like, yeah, but you're living a lie. It's not true.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And I don't like that.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah, man. That's the worst. Yeah.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah. You know what? Okay. You know what's another movie ending of this before I move on? Is like, he tells everyone, it all blows up. He loses all his friends. He loses his girlfriend. He goes home by himself and he makes himself a peanut butter smoothie and he tries it and he's like, that's delicious.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
All right. We're apparently going to love this next one. Okay. This story comes from the Two Hot Takes subreddit. Shout out to Morgan over at Two Hot Takes.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's like the best. There's some of the best stories. We love Morgan. Her fans submit some wild stuff.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's so good. Your parents show up and they're like, so this is the hospital? And you're like, yes.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
My husband lied about the reasoning for his tattoo, and he was having an affair. Oh!
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay, now that I've told you one lie, here's another.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
A year and a half ago, my husband got a tattoo. I don't have a problem with tattoos or anything like that, but he had never gotten one before or talked about getting one. He said he started thinking about it because one of his sisters married a man who had several tattoos. It made him realize he wanted one. He ended up getting a lily tattooed on the left side of his chest.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I didn't really like it, but I didn't comment because he is free to do what he wants with his body. A little over a year after he got the lily done, he went back and had some ivy added around it. Her name was Lily. My husband swore it was a coincidence. I had tried to ignore my feelings about him suddenly wanting a tattoo.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He eventually admitted they had been having an affair for the last two years. I was so shocked I was not even thinking about the Ivy, but my husband said that Lily had a baby she named Ivy, and he got the tattoo a few months after the birth. He begged me not to get a divorce, but I can't forgive this. We have to be separated for a year before we get divorced. Our daughter is turning 18 next month.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I feel bad because, you know, this isn't like a malicious lie. This is one of those lies where you're covering something up that you're embarrassed about. Right. And I feel bad for people in that situation, but...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
There will not be child support ordered for either of us by the time we are divorced. The divorce should not be complicated. We both work. So the attorney I consulted said there will not be spousal support ordered for either of us and our assets will be divided. Part of me is still in shock. He wants to go to counseling, but I can't.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
We have been married for 19 years, and I let him convince me my feelings about his tattoo were wrong. I never thought I would be 43 and getting a divorce, but here I am.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay, so the husband then got Ivy tattooed shortly after this woman, Lily, had a baby that she named Ivy.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It points to that. And the baby was born during the affair.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
The boldness is always shocking.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He begged me not to get a divorce. What?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
His first tattoo was for the woman he's having an affair with, and he got it in plain sight.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I'm incapable of doing something of this level because as they're explaining the guilt, just the weight, I'm like, life is going to suck so much more by doing this because now you got to do so much work all the time to cover it up.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That's wild. Absolutely insane. And they have a daughter who's now turning 18.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Everything about this is awful.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That's, I think, I've said this before, too, but, like, I sometimes wonder what's the more infuriating part about affairs and cheating. Is it's the affair and the cheating or it's the, please, let's not break up over this. Like, don't break up with me. Yeah, come on. I'm like, if you're going to cheat or have an affair, you need to at least be like, I fully understand if you're cheating.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah, you're gonna. But to think like, no, you'll stay with me after this is, that shows how much you disrespect this person.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Comments on this one. He seems pretty proud of his extracurricular activity. 6.7 thousand upvotes. Someone said, let's just for a second not even talk about just the cheating part. You go and basically get your affair partner's name tattooed on you and then have a kid with her. You also tattoo on yourself and then you expect your wife to work on the marriage. Like what in the world is he smoking?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It sounds like he's done with the marriage too. It makes no sense. Like how delusional is this dude? Someone said, so Ivy is your husband's daughter. Someone responded to that. That's what I came here to ask too. Why else would he add the Ivy to his tattoo right after the baby was born? OP, 43, is still young, trust me. Surround yourself with good people and plan yourself a nice vacation.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
You deserve to be treated with love and respect and when you're ready, you'll meet someone that is worthy of that trust. I've been there and it's really painful to get over that kind of betrayal, but be patient with yourself and you'll get through it. Sending lots of invisible hugs your way.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That's what I hate. It's an infuriating part, too, because I've heard this from a lot of people, and I felt this, too, of just like, you kind of know, You kind of know, but then you're also like, you know, if you're a good person, you're like, well, I don't want to be, I don't want to trust. I'm not going to do that. I'm not going to be the paranoid person. I'm not going to do that.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But you kind of know, because we pick up on body language when we don't even realize it. We're picking up on tons of signs and stuff. And yeah, you get bad vibes from things. Like intuition is real. Like our brain is so much subconscious that we do pick up on things that we don't consciously go, oh, here's what's happening. Like we know what's happening sometimes before we know what's happening.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah. I feel so bad for this person. And you know what, like...
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And it's some of the most infuriating parts of life. And so you sit there and you go, oh, I knew. I knew and I couldn't, either I was denying it or I just was convincing myself or just overlooking it. And it's so tough, but it's not her fault at all. I mean, you know.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's shifts in behavior, right? Like, there's no behavior that's suspicious except for complete changes. And you're like, wait, what caused this complete change?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
No, the signs are always there, but I never blame people for not. Like, picking up on it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Totally. Until it's, like, blatant.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And then you look back and you go, oh, my fucking God. You had, like, a billboard saying it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
those last like years of college are really hard like it's super easy to like crack and walk away from college and that's also okay if that's your decision like that's a completely fine decision and also like he's gonna graduate college and it's not like oh you didn't finish your degree like you just took longer to do yeah i took 10 years to do mine because i was off and on i took years off like yeah some people do take a couple years off and then go back and keep going i will
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Right. I want to know what his logic was behind the tattoos even more. You know, like, we know the logic, but I'm just like, so blatant, so there. Like, I wonder if it was like his way of kind of committing to this affair. Because she was probably like, are you going to leave your wife now? whatever, and he's like, no, I'll get it. He's like, no, but I got a tattoo.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But I got this right here, and I got this for our new child, too. Yeah. And I'm also like, you know, I'm sure his daughter, 18, is gonna figure this out. What was he gonna do? And it's gonna be like, okay, cool, you got a tattoo for your new child, like, cool. What was he gonna do? That's like... That's kind of what I'm thinking. I'm like, this is a betrayal.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Like, when you have kids, I'm like, you're betraying your kids, too.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Like, there's the added stakes there.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Damn. Update? No update. I think she's divorcing the shit out of him.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Unrelated, like, I'm always surprised by, like, the first tattoo people get and where they get it. And, like, a chest tattoo is a bold first. Bold. I think it's cool, but I'm just like, damn. People usually get a small one somewhere where it's like, okay, I'm starting out. But first, right off the bat, bam.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
There's not one that's... I'm in the same exact boat. I love tattoos. I think they look sick.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I've heard that, and I've also heard once you start getting tattoos, then you just want more. You don't care, the stakes are lower. Totally. Yeah, because I look at like Spencer has a lot of tattoos that I think are sick and it's just like video game and like Ninja Turtles. Ninja Turtles and like he's got the Squirtle Squad that looks so sick. Our final, final story. Whoa.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
This is another confession.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I lied to my co-worker about the cupcakes in the break room. Classic.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
My coworker can't eat cupcakes because she just got diagnosed with Crohn's disease and is on an elimination diet, but she loves to eat. She sounded very sad when she warned me that there were cupcakes in the break room, so I lied and told her they sucked and were dry and the icing was crusty, but they were perfectly delicious.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I even mentioned in passing to another coworker eating cupcakes, who is also aware of her stomach issues, to tell her they sucked. She later told me that she felt better knowing they weren't that good because she couldn't eat them, but they were good. I feel bad lying and roping someone else into it. That's so funny.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
They were trash. They were awful. My life is worse for having eaten them.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
The guy who made them was like, aw.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
This is where, you know, I have such a hard stance against lies, this is where I struggle. Because I'm like, you're lying to make someone feel good.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
But it's- And Bollywood movies, the logic fully sounds. It makes sense.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's, yeah, but it's- Is the resolution of the movie at all about that being wrong? Because if you're saying a buildup of- Oh, yeah. Oh, it's not.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I don't know, I stopped watching it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's also arguably a subjective lie where it's like, oh, we all think these suck. No, we all thought they were good. It's not an objective lie of like, this isn't happening kind of thing.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's a lot. I also have this view where it's like, okay, it's a lie that if they uncover the lie, are they going to feel bad or not? And it's like, in a way, if I found out that everybody was lying and saying they sucked so that I didn't feel bad, I'd actually be like... okay, that's actually also really chill that you guys did that. Like, that's sweet.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Finding that out wouldn't make me feel worse. It'd almost make me feel better. They'd be like, wow, everyone would do that just because I, you know.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And this lie kind of ends with today. Because once we move on, it's not like people are going to be talking about the cupcakes.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Comments, this was a lie for good, not evil though. Someone said, yeah, not all lies are bad. This didn't hurt anyone and actually made someone's day better. So OP, you have absolutely nothing to feel bad over. Someone else said, this kind of lie is perfectly okay, in my opinion, unless they were made by a coworker.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Then social norms dictate you say nice things because it would get back to who made them. Context from another comment by OP, the cupcakes came from a different floor, so not made by anyone close or around. Okay, in that case, unless it gets down to that next floor.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Floor five, hate it on.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I... I think a lot of people do that. A lot of people do take a year off or so. I think it's huge. And also I am, what I did and I'm such a huge fan of is going to community college because the stakes are a lot lower because it's not as astronomically expensive. It's still expensive, but you know, you can then, and then switching majors is a great thing. I think people should do it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I didn't hurt anybody. I'm not sure about this message.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Thank you both for being here.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Thank you for watching. Liar. Let us know what other themes and subreddits you'd like to see on the show. Let us know in the comments if you're holding back any big lies in your life.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Confess in the comments. And we'll see you next Saturday. Goodbye.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
So you thought Amanda would wear a fake baby bump every day for months, even in videos, just to fool you.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
It's so funny, too, at this stage in my 30s and everyone I know, the amount of people who have degrees that match their career is shockingly, like, not... that high. People end up in completely different places. Your life is gonna go so many more directions than you expect.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I think for this person, I'm even curious if their degree is going to change their job field that much, or if it's just kind of like a mental thing. Just something that they need to do for their own sake and their family's sake. Either way, I feel bad for this person. I hope they get the weight off their shoulders. The comments... My nephew did the same thing.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He forgot to get tickets for the family to attend the ceremony, even though they'd flown in from out of town. His dad, my brother, kept pressing to see the diploma, not because he was suspicious, but because he was so proud. Took my nephew a year or so to come clean. After the initial shock wore off, we all rallied behind him to help him redo a year or two.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
He's now truly degreed and we all love him so much. Anybody can crack. Someone else said, hey, I'm so proud of you. You're finishing. Honestly, I'm legit thrilled for you. You got all the congrats and celebratory backpats and you could have just not gone back, but you didn't. You're finishing. That's terrific. I also dropped out right before graduation and that was 25 years ago.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
My family knew and I was putting myself through school, so there was no surprise or disappointment. I still haven't finished because that last semester was so brutal emotionally that I've never really even considered finishing." I'm very happy for you. You're doing the hard thing and confronting a sense of shame you've lived with.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
You're legit my hero right now and I wish you the very best of luck.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
These are some great comments.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Me too. Hey, fuck you, pal.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Someone else said, I completely understand. I did the same thing. I was working on an associate's degree and I ended up failing. It was too much. I had some physical and mental health things going on. Mine was by accident though. I was told I was going to be graduating and was listed and invited to the ceremony. Got the robe, walked the stage. My family was there and it was so great.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Then I got a letter in the mail a week later saying I failed a class and I did not actually graduate. I was so ashamed. I kept it a secret from everyone for a long time, worked for a while and got things under control, slowly started taking classes again. I let my mom know, but kept it from everyone else. Eventually I got my associate's, bachelor's and master's degree.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I needed to go at my own pace, not pack on 15 credits in a semester, just one or two classes at a time so I could truly learn and do well. I graduated late from everything, but who cares? I did it my way and I'm so proud. Yeah, I mean, here's the thing. You don't have to list on your degree when you got it or how long it took you. You know, you get it, and you get it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Yeah, I mean, it's a bit for me. But I know for a lot of people, it depends on the field. Right, of course. A lot of jobs do require bachelor's, master's. They still probably pay shit. I mean, that's just the way things go right now. Yeah, yeah.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay. Heard. I also feel bad because I know this is very much the case. How many people are getting degrees just for their family's sake?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And I feel so bad. And I mean, how many things in life do people do? Like get married, have kids, all these things, big things that they do for someone else's approval.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
And it's like, hey man, if you don't want to finish your degree, you don't have to. That's your journey.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Okay. Before we begin, I want to point out, we are about one year after the famous story where we had both of you here, and we talked about the guy who was paying his wife for sex. And we lost our minds.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
That's so funny because you're such a touchy-feely person, but then holding your hand is too much.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
You said that about your husband even, right? Yeah.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
All right, let's move on to our next story. This comes from Am I the Asshole? Am I the asshole for telling my boyfriend's family that I bought our house, not him? Huh? Okay, so she's telling her boyfriend's family that she bought their house, not him.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
This whole thing started last month or so. Me, 27-year-old woman, and my boyfriend, 26-year-old man, who I will call Matt for privacy's sake, have been together for six years now. I'm the main breadwinner, and that has always been a struggle in our relationship. I would say he's pretty insecure about earning less than me.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
About a year ago, I had finally saved up enough to purchase a house in the neighborhood I really like. Up until then, me and Matt had been living in his apartment, which is cramped and not located in a nice area. Matt has never been too bothered about moving. He likes living in his apartment and he doesn't mind living elsewhere as long as he doesn't have to pay more than half.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Knowing damn well I could easily purchase the whole house and it was a bargain for the area, I bit the bullet and bought it from all my own savings. When we moved in, Matt loved the place and I thought everything was fine. Now this is the reason I am posting on Reddit. Two days ago, me and Matt went over to his mom's place for dinner.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Conversation was going fine until the topic of our house was brought up. Mother-in-law mentioned how proud she was of Matt for owning his own house at 26, which I was confused about, but obviously didn't want to start anything at the dinner table. Then Matt's sister chimed in about how much of an achievement it was. Matt looked over at me, not saying anything.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I'm not usually a petty or confrontational person, but something about the fact that I was the one who not only bought the house, but also paid the majority of the bills, and Matt didn't even drop a dollar, stuck with me. So I decided to say something. I asked Matt who really bought the house in front of everyone.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
We filmed that episode at like 6 p.m. on a Friday after filming so many videos that week. So cursed. And we were out of it.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
There is nothing. That's the most intense thing she could have done. Oh, yeah. Who bought the house?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
There is no better question or statement you could have done.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
I know, it was a dick move, but honestly, I was so riled up by that stage. Matt said nothing, and then I announced to everyone that Matt didn't even contribute to buying the house. Okay, good. Immediately after saying that, I packed up my stuff and went home. I have been texting with Matt's sister. I will call Kate, who seems to be on my side.
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
Matt is staying with his mom right now, so I have the house all to myself. He hasn't contacted me yet, and I don't know whether it's worth breaking up over a lie like this. Am I the asshole?
Smosh Reads Reddit Stories
Liar Liar, Pants On Fire! | Reading Reddit Stories
The situation is certainly a bit of a deal breaker in a lot of ways. Do you think she did the right thing?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Hello, welcome to Smosh Reads Reddit Stories. I'm Shane, and today we've got some classic Am I the Asshole stories. A lot of bullies this episode, so prepare yourselves. I'm joined by two people who are not bullies. You don't know that. I'm joined by one bully.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Very similar. There's just no narrative. Okay. So I listen to audiobooks, not erotic ones, though I do partake in audio-only porn sometimes because, as becomes important later, I have a thing for nice voices. But somehow, someone just reading smut off a page feels weird for me to listen to. No judgment to anyone else, of course, just not my thing.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
My boyfriend has recently gotten a bug up his ass about me listening to them, especially when he's home, even though I always use headphones and do my best not to disturb him. Also before anyone says it, my Audible account comes directly out of my own bank account. He has no reason to think it will affect his finances.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Anyway, he only ever gave little snide remarks until the latest time, so I let it go. Most recently, I had been making us dinner and cleaning up behind myself as I did it. And because he was playing video games and I get bored doing those kinds of things without something else to think about, I turned on my favorite audio book and picked up where I had been listening the week before.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I didn't realize he was in the kitchen until he jerked the cord on my headphones and asked if I was doing it again. I asked what he was talking about and he just sighed and said that he needed to talk to me. We sat down and I'll admit I was pretty pissed he had jerked on my headphones and not super willing to listen to anything right then, another reason I might be an asshole.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
He said that it really bothered him when I listened to audiobooks from a man's perspective because he knows about my voice thing and that it makes him uncomfortable.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I asked why and he said that he couldn't get it out of his head that I was thinking sexual things about the characters and that, along with the romantic elements, made him really upset and felt almost like I wasn't fully committed to him. I asked if he realized I was listening to a book for teens written by a literal Mormon and that none of the books I listened to have smut.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
He said that it didn't matter and started getting angry again, which just made me angrier. He dropped the ultimatum that he wanted me to stop or else we would need to break up.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I was so pissed at this point that I just shrugged and said, gladly, the minute you stop watching porn, I'll never touch any of it again, which had him pissed because he claimed he never said anything about porn, only the romantic and sexual parts of the books I listened to. I said that if he was allowed to make ultimatums of favorite pastimes, why can't I?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It's just the perfect size, keeps my food cold, and honestly, I think it's kind of fun. Recently, a new coworker, Matt, who's 35, started making comments about it. At first, it was just joking around. Stuff like, nice lunchbox, dude, my kid has the same one. Whatever, I laughed it off. But then he kept bringing it up, saying it was unprofessional, and that I should grow up and get a real lunch bag.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Then I asked if he would rather give up video games since that's closer to what audio books mean to me. He ended up just saying to fucking forget about it and went to bed, but has been pissed at me since. I talked to my friends about the situation and got mixed answers, so I wanted to try with strangers as well. What? Okay. Wow. What a hill to die on. Yeah, truly. I just think...
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I don't know what you do about that type of insecurity.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I mean, they're audio books. He's like, what?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And to just try to put that type of control on someone. It's like, what do you think's gonna happen?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah, yeah, I agree. I agree. Unless they want it. Unless it's a consensual thing. We got new merch. We got new merch. Here we go. A shirt that says consensual yanking. Yanking. The Yankees have new merch ideas. The Yankee and the Yankeed. Yeah, the headphone polling is absolutely a red flag. Comments, or sorry, verdict is not the asshole, which I agree with. Comments, not the asshole.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
You should reevaluate your relationship with him. He is acting insecure, jealous, and controlling. Don't stop doing what you are doing. Someone else said, he is completely out of line. Being jealous of audiobooks is next level insecurity. Not the asshole.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
God, we're back in 2007. This guy. Hey. Someone said, this is a big red flag to me. Is he so insecure that he can't stand the idea of you listening to, gasp, another man? You weren't even listening to anything provocative when he did this, and he had that kind of reaction. Where is all his anger coming from?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
The fact that he dropped an ultimatum, books for fuck's sake, or breaking up is insane to me. This seems like such an odd thing for him to want to have control over. You are wearing headphones, not listening to it on speakerphone, and you're minding your own business, and he has the audacity to be upset you're doing that. Personally, I would cut ties.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I told him I didn't see the issue and that it's literally just a lunchbox. But last week, he took it further, telling me in front of our coworkers that it was weird for a grown man to be carrying around kid stuff. I told him he should worry less about my lunchbox and more about his own life.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
But if you feel like he's a good partner to you in other aspects and he isn't controlling about other things you do, what you wear, who you hang out with, then maybe try talking it out when he's calm. I just always have a hard time believing that this isn't reflected in other things.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
OP said, he did try to explain that he felt as if I was reacting to the romantic parts in ways I don't react to him, which almost made sense, but then all I can think is, yeah, of course I do. This kind of romantic thing doesn't exist in real life, and I don't expect it to, but to hear about it is enough to make me blush or laugh because it's cute.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I've never expected him to be an over-the-top romantic. I don't think I would enjoy it in real life. It would more than likely overwhelm me, but I do like to hear about it, I guess. This part does make me feel a little bad because at the time I was so angry about the headphone pulling. I don't know why it set me off so bad.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
No one has ever done it to me before, but for some reason it had me pissed. I couldn't even react to it like I should have. I honestly maybe should have asked to wait the more I think about it. Well, you're upset because it's fucking insane.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Just point is, talk. Talk. I think also this goes into the realm of, I think a lot of people don't really understand fantasy, fantasizing, right? Because the way it works is that your brain, when you're reading a book, you can go to much wilder places because your brain knows you're safe. Narnia. Right. Oh, thank you.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Your brain knows, I'm sitting here reading a book, so wilder things can be exciting that in real life would never be exciting. Absolutely. I think we seem to understand this with other genres, right? Like, I enjoy watching Fast and the Furious. That doesn't mean I wanna drive a car at 200 miles per hour. Like, I would hate that in real life.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Now he's been acting cold toward me, and a couple of coworkers said I was being too harsh, that he was just messing around. But I don't see why I should change something harmless just because one guy thinks it's weird. Am I the asshole?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And watching it and thinking about it is different, because it's just thinking about it. And I think people get really uncomfortable when it has to do anything with romance or sexuality, but I mean, I see so much of it on book talk discourse of like, romanticy, like all these wild things and boyfriends being uncomfortable with it, but it's like, they don't actually want that in real life.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
This is a fantasy to be read safely in your home, not lived out.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
He could be reacting with curiosity. Yeah. But he's reacting with pushing it away and everything.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It's an opportunity to learn more about what excites her. Right. But he's completely. Yanked. Yanked.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Update. I forgot about that. This update came two months later. Do we have any predictions? They broke up. He's an author. You think they broke up? He's an author. He's insecure because he's like, it's not as good as my book.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Uh-huh, very reasonable. All right, those are good odds. Yeah. Here we go. So it's been a while. I didn't think I would update because the original update would have been mostly us talking and working things out, agreeing that whenever he felt insecure, he could tell me and I could focus my attention on him for a while. It worked really great.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Well, until I found out he had been fucking his coworker, that is.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Every time. It's a very common trait. I don't have the details. I don't want the details, but he admitted to it in the end, so he did it. That's enough. He wanted to work it out and apologize, begged for a second chance, but honestly, the idea that he said a word to me about an audiobook about Edward frickin' Cullen while he was getting strange on the side...
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It killed any opportunity for forgiveness I had inside of me. It was so ridiculous. I laugh thinking about it now, and it's been a month since we broke up. Like, it makes me feel insane. It is so funny. He was yelling at me for listening to a book about Mormon vampires while he was cheating on me. I cannot make this shit up. 100 points to whoever said projection the first time I posted.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I can't remember if it was a comment or a message, but you were right. I wish I had a cookie. Cookie!
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Thanks for the help anyway. Even if the relationship is a bust now, I really do appreciate you all. Oh, man.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It is funny. Unfortunately, it's hilarious.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Oh, Powerline, yeah. Damn.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
There you go. Wow. So good. Had six hours of sleep. The Reddit stories chapters on this video is gonna show like these stories and then like goofy movie. Goofy movie.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
They're being millennials right now. Give them a break. Like most replayed. People love this. Okay, I can't be too shocked.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Can't be too shocked.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Something was up either way. Either way he had work to do. That level of suspicion coming out of nowhere. It's unfounded. And it's crazy how common it is that when people are unfaithful that this suspicion for their partner arises. But it's kind of what you said, it's like I'm capable of it so my partner's capable of it too.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It's so funny to hear about different types of workplaces, because we work here, right? Which is just such a different environment from any job.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And it's tough when, because this is what people do, they keep you on the ropes. So when you're on the ropes, you can't be suspicious or clock back or whatever, because you're defending yourself so much.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
She's defending reading Twilight over here. I mean, God, you know.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I tried to read Twilight back before it like blew up. You're that cool? I'm a hipster for Twilight. I tried to read it, and I just couldn't get into it. But I have no problem with it. But look, I'll read anything. I mean, I've said on Smosh Mouth, I read Morning Glory Milking Farm. You did read it? I read it. Wait, you actually did? I read it. And it's wild, man. That's crazy.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And there's a bunch more in the series, and I gotta know what happens. There's other monsters. How much more milk is there? Well, no, it goes to other monsters. There's a mothman, there's a mermaid, there's a ghost. I'm like, how does that work? None of those are mammals, so there's no milk. That's crazy. Well, is it more moth or is it more man?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I talk about eating ghosts all the time. I don't think milk is involved in some of the other ones, I think.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
They move past that.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I'm pretty sure people probably do have those types of lunchboxes here.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
All right. Our next story comes from Am I the Asshole? Am I the asshole for expecting my brother to turn down a job offer from a place I was rejected from? Probably.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
So I, a 20-year-old woman, have done a bit of modeling. Nothing major, just product modeling for smaller clothing brands. Yesterday, I had an audition for a gig, and my brother, who's 19, came with me because he knows I get nervous before auditions. This particular clothing brand is pretty niche, and honestly, the style is much more in line with what my brother wears.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Lots of pinks, pastels, lace, and frills. I dress normally and went into my audition, but unfortunately, I didn't get it. When I came out, I saw my brother talking to one of the employees, and to my surprise, the guy asked if my brother was auditioning. My brother said no and the guy encouraged him to try out because he thought he'd be a good fit.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I was caught off guard but played along because the worker was still there. After the guy left, I told my brother I didn't get the gig and he seemed sad for me and tried to console me. I figured that was the end of it. But as I was about to leave, he asked where I was going. I told him I was heading home and then he asked, what about my audition? I was completely shocked.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I didn't expect him to want to audition after I was just rejected. I asked if he was seriously doing this to me, and he just shrugged and said he didn't see why he shouldn't try. I called him selfish and left. A few hours later, my brother came home and announced that he had been offered one of the modeling spots.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I had already told our parents that I got rejected and what my brother did, and my mom was on my side, asking him how he could do that to me. But my dad immediately took his side, saying that me and my mom were being unreasonable. He also scolded me for leaving without my brother, since I was his ride, and even insinuated that I was just jealous. I'm not jealous.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I just think it's incredibly rude and selfish to go after something your sibling wanted but couldn't have. He knew I wanted it, and instead of supporting me, he took the opportunity for himself. My brother thinks I'm an ass, but I really don't see how I'm the bad guy here. Am I the asshole? You suck. You don't suck. You suck a lot. You did abandon him. He didn't have a ride. Exactly.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It actually hurts. I just can't imagine being bothered by this.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah. I mean, this is... This is a realm that we understand well, right? Like, so many jobs we read about, it's like, oh, well, we're in kooky entertainment town. But auditioning is such a real thing, and it's such a real thing, because I started auditioning when I was like a teenager, right?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And it's crazy when it's like you and your friends are auditioning, and it's such a thing for us when it's like, you're not booking work, but your friend books something huge, or books something that you auditioned for, too. And it hurts. Of course it hurts. Your self-worth is tied to it. But you have to recognize too that it's like, all right, they're right for it and I'm not.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And that's, gotta keep moving.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
So, I don't know. She and her brother are not long-term competition. No. Like in this. It's like, why are you... But I also... Here's the thing. What I'm saying, too, is that I understand the feelings. But how she's going about this is... Thank you.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah, yeah. Verdict, not the asshole. Great. Comments, super weird that he feels the need to control a coworker's lunchbox choices. Sounds like he needs a different hobby, not the asshole. 12,000 upvotes.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
The compliment bully. Yeah. Pretty good. I like how you just wear whatever. Cool slaps, dude.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
That's the way to live. Someone said, I have a sparkly unicorn water bottle. No one steals it. It always finds its way back to me. Matt is trying to put you down and be mean. Ignore him. I think a lot of people nowadays, I think millennials especially are like one of the first generations where we're just like, oh, I don't have to stop.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
doing this, like I don't have to stop being interested in this just because I'm 30. Right.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
do it just becoming one with him, is when someone asks a question like that, just looking them in the face at that dinner table and being like, what an absolutely wild question to ask. I think questions are the best way to tackle these types of people, is when someone asks something so uncomfortable, be like, why are you interested in that? Why are you thinking about that?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I think that's the better way to handle it. Because if someone's then mad at you for pointing that out, they're absolutely the asshole. Right. But once again, I'm not sitting here going like, how dare you do that? Like, this person started it.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Same. Yeah. Well, man. Okay. Well, man.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Okay, our next story. Am I the asshole? Am I the asshole for unplugging my fiance's phone, fully charged, to use my own charger when my phone was at 4%?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I hope they keep writing them. I don't want him to stop. We live on a cloud above a mountain and the cord is very long. Look, it's imperative for us that people keep writing in. Oh, it's true, it's true. I, a 28-year-old man, live with my fiance, who's 25, and we recently had a disagreement that I'd like some outside opinions on. We have a USB-C charger that stays in the living room.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Technically, it's mine, but since we live together, we both use it when needed. A few days ago, her phone was plugged into the charger, but it was already at 100%. Meanwhile, my phone was at 4%, and I urgently needed to send an important email or something similar. I don't remember exactly, but it was something time-sensitive.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
In my rush, I asked her, can I use the charger while already unplugging her phone to connect mine? She immediately said no. This surprised me, as her phone was already fully charged and mine was about to die. I had already plugged in my phone by then, so I said, but your battery is full. She got really upset and we had a brief argument about it.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
We dropped it at the time, but the issue came up again a few days later. She told me that what I did was rude and compared it to her watching TV and me changing the channel without asking. I disagreed because if she were actively watching something, I wouldn't just change the channel. This was different.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
She insisted that it was negotiable etiquette, meaning that it's still rude even if I think it makes sense. According to her, I should have asked. And if she said no, I should have respected that, even though it was my charger and her phone was already at 100%. So am I the asshole for unplugging her fully charged phone to charge mine in an urgent situation? I... I think this is another one.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
We're back here, it's not about the charger. It's another, that subreddit, oh my God, just break up already. Yep. Just like, come on, like what?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Because you did not want him touching that phone. No, don't look at the phone!
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
He gave her everything. 100 for the electricity. We got another cookie on our hands. I mean, it's just like, if your arguments are at this level over this. Over that? What's going on here? Figure it out, baby. You got to take it out of the bread bag and figure it out. Verdict, not the asshole. All right. And we got a logical answer. Talking about in a workplace, setting is a little different.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Like with someone, like, but a partner. But I still think you throw it out first. Just like, hey, can I plug mine in?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah, I wouldn't question that.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah, and it's being brought up a few days later. It's like, whoa. Comments, not the asshole, but does your fiance like to have the last word in anything and everything, no matter what? Are you sure that's something you want to be dealing with for the rest of your life? 1.7 thousand upvotes. Opie said, usually yes. Lately I fear bringing up my complaints because of that.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Sadly it wasn't like that for years, five years together. And I could count on one hand, but lately has become the rule. Someone said, read what you wrote. I fear bringing my complaints. Why are you marrying someone you are afraid to talk to? I really think Damien, I agree with what you kind of pointed out. This is sounding like cheating behavior. A little down.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
That'd be a whole cookie. Daughter. This just sounds like there's tons of resentment everywhere. Absolutely. So it's like, you gotta ask yourself, is this working? Well. No update? No update. Oh, man.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
So we don't know. We don't know. All right. our final story. Let's go. We have an Am I the Asshole and a Best Redditor updates.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And I'm excited because this is a Will I Be the Asshole. Oh. So they're asking beforehand and I'm assuming we're gonna get the result.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Or is it like past perfect tense? Like, will I have been the asshole? Would I be the asshole for telling my son to wear not his favorite jacket anymore because it looks gay? All right. Okay. Probably.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I'm a single dad to my son, Oliver, who's 10. He's with me most of the time and sees his mom every other weekend. He's an awesome kid, creative, full of energy, and he's got his own sense of style that's pretty unique. He loves bright colors, nail polish, and clothes that some people might think are more girly. If I'm honest, I think Oliver might be gay, and I'm totally cool with that.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I've always made it clear that whoever he turns out to be, I'll support him 100%. Because of how he dresses and acts, Oliver's had a really tough time with other kids. He got bullied so badly at his old school that I ended up pulling him out and homeschooling him. The school wasn't helpful at all and it was heartbreaking to see him go through that.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It does. Pokemon rocks. Favorite Pokemon? I know yours. It switches around a lot.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
He struggled to make friends and it kills me to see him feel so alone. Now, he's starting back at school in September and he's really excited about it. But recently, we were at a cousin's birthday party and Oliver wore his favorite jacket, which is a bright pink, a sparkly one that he loves. Some of the other kids started picking on him, saying he looked gay.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I stepped in, got the kids to apologize, but it ruined the day for Oliver. I'm worried about how things will go when he's back at school. I've been thinking about whether I should talk to Oliver about maybe toning it down a bit, especially when he's around new people. Not because I want him to change who he is, but because I hate seeing him get hurt and feeling like an outcast.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I don't want him to feel like he has to hide who he is, but I also don't want him to be picked on or excluded because of it. But then I feel like a complete arsehole for even thinking about this. I don't want him to think that I'm ashamed of him or that he has to conform to be accepted. I want him to feel free to be himself, but I'm also scared of him being hurt by others who don't get it.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
So would I be the asshole if I talked to Oliver about maybe being a bit more low key with his style?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Oof. You know a later one? Because I'm partial to all the original 151. Same. Right? But what is it? Hawlucha? Yeah. The like Luchador bird. The wrestling guy? Yeah. The wrestling bird is just awesome.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
You know, so. Yeah. Yeah. How much, I mean, it's interesting, because by the title we were assuming, I was assuming one thing about this guy. And then you start reading and you see another thing, but it makes me wonder how much of parents' homophobia comes from this place of like, they're scared for their kid, right?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Because the world sucks, and you're scared about the world, but in the process, if he does that, if he actually goes through with this, Now he's also.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Like his son also, and my dad also doesn't like it. Right. And so it's like, you kind of actually, is it more important to just be the support for him?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
and there's like, no matter how right it feels in his head, there's sometimes where like, you'll be thinking of a motive or a decision or advice, and then I almost think, I'm like, does this sound like the opposite of like Disney logic in a movie, where it's like, hey, hide who you are. And I'm like, oh wait, that's probably not the right answer then.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Oh, yeah. It's also tough when it comes to bullying. It's like, you can change the clothes and stuff. Kids are ruthless. People are ruthless, right? And truly, my only hope with this situation is just like, if he is who he is and he's showing off who he is, he will hopefully eventually find others who see who he is and love that. And he'll find his group. That's the hope.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Comments, don't do it. Kids will still bully him and all he will remember is that you deterred him from expressing himself. Trust me, the same thing occurred in our house. I was trying to keep him from being bullied but my child felt as though I didn't accept him and that he needed to pretend he was something he wasn't. Lots of later life therapy.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
If he's gay, if he's straight, let him be himself and tell him as long as he likes his clothes, that's all that matters. Sincerely, the mom of an amazing queer kid. Someone else said, no one's the asshole. You want to protect your son. You think the best way to do that is through conformity. I don't think you're an asshole, but there may be other ways of handling this.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And before we move on, a reminder that tomorrow is the last day to buy tickets for our live show. To get the VOD, go to live.smosh.com and you can watch Smosh Reads Reddit Stories Live. It was a great time. What was your favorite part of the show? It's probably that one part when everything and it all happened and it was really good. Oh, it's so good. Yeah, it's definitely happened.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Teach your son unbridled self-confidence and clever comebacks. Teach him how to stand up to bullies, disarm them and humor them, and reverse heckling. Don't teach him that the key to acceptance is not to be himself. He'll internalize that toxicity into his worldview. Kids are notoriously mean. He'll look to you for validation, and he's better off getting it from you than none at all. Update.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Hey all, it's been about 26 days since my original post and I thought I'd give an update now that Oliver has had his first week back at school. I can happily say that so far things are going much better than I'd hoped. Over the summer, Oliver and I had a really important heart to heart. I sat him down and told him just how incredibly proud I am of the person he is becoming.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I do love the aesthetic of Magikarp.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I made sure he knew that there is absolutely nothing he could ever do that would change the way I see him or make me love him any less. Honestly, it was a bit emotional, and I even got a bit choked up. I told him that if wearing his favorite jacket, the one that's caused some hurt before, made him happy, I'd stand behind him 100%. But I also wanted to make sure he was prepared.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I explained that while I'll always be there for him, I can't always be around to protect him, and he might have to stand up for himself if kids make fun of him. I made it clear that this doesn't mean he should change anything about who he is, but that he needs to be ready to handle it if anyone says anything cruel.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
There's a cool vibe. I agree with you.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Oliver understood, and we spent the summer coming up with some playful comebacks together. He really wanted to take the jacket with him to school, so he made it a bit of a project, imagining the kinds of things kids might say and crafting witty replies that he could fire back with. It was actually pretty fun, and I think it helped him feel more confident about it. Now, back to school.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
His new teacher knows all about his past struggles with bullying, and she's been amazing. She's keeping a close eye on things and making sure he feels safe and comfortable. It's made such a difference already and Oliver's first week couldn't have gone better. He's even made a friend, a boy named Sam, and they've really hit it off.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah, like as a Pokemon, garbage. The no brain. Gyarados was one of my favorites as a kid, though.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
They're planning to meet up tomorrow at the Wacky Warehouse and Oliver can't stop talking about it. It's been a long time since I've seen him this excited about spending time with someone his age. Yay! That makes me so happy. That's awesome. Update number two. I just wanted to hop on and give a small update about Oliver's play date over the weekend.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Firstly, when Oliver was getting ready, he wanted to wear all his flamboyant clothes. He asked me if I thought it was a good idea. His friend had seen him in his jacket, but he was a little worried how he would react to the full Oliver. I told him to wear whatever he wanted, and if this friend was worth being friends with, they would accept him for exactly how he is. This made Oliver smile.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
He wore his full Oliver outfit, When we were walking in, I could feel Oliver getting a bit nervous. He was bullied so much in his last school for how he was, so I understood why. I held his hand tight and gave it two squeezes. This means I love you, something I learned to teach him from Reddit, actually.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Absolutely badass.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
The friend's dad was with him and he looked at Oliver and gave a little curious look, but apart from that, it was fine. The boy said he loved Oliver's clothes. They spent about four hours playing and we ended up eating together. On the way home, I told Oliver how proud I am of the little man he is.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I am so proud of how he is willing to be himself and so brave to continue despite any backlash he gets. I love him so much. This is my final update on this account. I don't know if I'll ever show you these posts, Oliver. Maybe in a few years when you're older so we can, okay, that's. The message? Damn, I wasn't expecting that. Can't hit me with that. I'm already crying, let's just do it.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
All right, we're gonna do this. Okay. I don't know if I'll ever show you these posts, Oliver. Maybe in a few years when you're older so we can laugh at how worried I was about you. Your dad is so proud of you. I think you are the most amazing person in the whole world, even when you drive me absolutely nuts. I am so lucky to get to be your father. I am so lucky you're in my life. I love you.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Lastly, here's someone said, not the asshole, Matt has a little dick. So this person knows more about him.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
That's awesome. Stuck the landing. Damn. What an ending. Whenever these types of posts, because we've read through so many stories, I'm like, okay, I'm prepared for some information. But then if you get a perception or a perspective shift, that's gonna kill me. I can't deliver a message.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
That's so good. That's also like the quote that gets me, is the like, I'm so proud of you.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I'll also say, I think we all understand this, you meet people who have an unbridled confidence, and it's like, oh, what's the secret? And they're just like, well, my parents are awesome, and we're all, we're so weird. They have my back, and it's like, man, anything can go in your life. And it's like, but I'm fine, because I've got that. It's such a huge thing.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
The lights come back on, it's like, now I've never been proud of you.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Oh, man. Okay. Our next story. Am I the asshole for not listening to my wife and eating the wrong cookie?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Hey, Oliver, good kid. Damn. Well, thank you both for being here. What a journey. We started with a cookie, we ended with tears. How did it end up like this? I was like, the joke is right there. Thank you for watching. And once again, it's your last chance to get tickets to watch the VOD of Smosh Reads Red Stories Live. So get your tickets at live.smosh.com. Check it out. It was a great show.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I am certain. Especially that one part.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah. And we'll see you next week for more Reddit stories. See you later. Goodbye. Arrivederci.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
All right. I worked a 10-hour shift yesterday and had little to eat but bubble gum and some cheap hot chocolate. That's not food. That's not food.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I'm glad we all got there. I ate some bubble gum. Don't worry, I swallowed it.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I came home to a voice message, whereas my wife had picked up a cookie for me from the local bakery and another specific cookie for our young daughter, which she could have when she came home from school. Overjoyed, partially because I was hungry and partially because my wife and I had been at odds for a bit, and I thought perhaps this was an olive branch of sorts, I looked into the cookie box.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
One of the two cookies inside was definitely the one for my daughter, due to its description, so I ate the other one. It wasn't quite what she had said it would be, but I didn't want to be picky. A few hours later, my wife pours herself a glass of milk after dinner and goes into the cookie box. She mutters something under her breath, pours her milk back into the jug, and flops down on the couch.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I asked what was the matter, and she informed me that I never listen, and I ate her cookie. I told her that I had only eaten the other cookie in the box that wasn't our daughter's and my wife let me know that my cookie was separate in a bag under the cookie box and that I should have listened better and that she wasn't surprised.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I asked her what kind of cookie I had eaten and told her I'd go buy her another one. She refused to tell me and merely repeated that I should have known that that wasn't my cookie based on her description. The cookie I ate was white and had some kind of brown icing on it. Apparently she had bought me some sort of toffee chocolate chip cookie.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Am I the asshole for not paying attention and eating the wrong cookie or is she blowing this out of proportion? Since it's come up a few times, I thought I'd add a bit of information. Yes, I do have a hard time paying attention. I have ADHD and I'm working on it. Yes, not eating all day is my fault. It was two days before payday.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
We had nothing in the house viable for me to take, and I had a dollar worth of change in my cup holder, plus a pack of gum. I did what I could. No, she didn't mention that my cookie was separate. She told me my cookie was in our bread bag, which is a bag where we keep bread and other things we want to keep bugs and mice out of. She described the cookie as a toffee chocolate chip cookie.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I looked in the bag, found the box from the bakery, and it had two cookies in it. One of them was decorated like the night sky and is what she said she had purchased for our daughter. There was only one other visible cookie. No, I can't prove this unless someone can instruct me on how to download voice messages from Messenger and post them here. I'm in. Okay, the verdict is asshole. Okay.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
And my take is a little bit on I don't care about the context.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
No, the cookie is the final straw here.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
There's another subreddit called, oh my God, just break up already. And it's truly like, what is going on? What are you doing here? No, they have a daughter. I'm not telling them to break up. It's just like, do you care yourself? It's not about the cookie. Like reread your message. You hate your wife. What's going on?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
As of reading this, we've definitely done it. So it was definitely cool.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
But for them, it's like, oh, and this is bad. Yeah. The day is now worse. But I don't love that it was like, oh, we've been at odds, and I was hoping this was an olive branch. It's like, what kind of... Where's your olive branch? What kind of communication are you guys having? You're not two different nations that are going through a negotiation right now. Jesus, just talk.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Anyways. Tommy, Damien, thank you for being here. Thank you. What? I realize I never said your name, so people listening didn't know who you were. Oh. I feel like they could sense it, though.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It's also not great that he's like, no, she didn't make it clear, I didn't know, I looked in the cookie jar, but then he does admit that she said that they were in the bag. That's true. So by his own recollection that he's writing, he did seem aware. Yeah. But I think you brought up the question of like, where's your olive branch? Like, what's he doing?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Um... Comments, you're the asshole, you didn't listen. She did something nice and thoughtful for you and you didn't care enough to actually listen to what she said. You ruined a special thing and took the cookie she was looking forward to eating. Given her reaction, I'm guessing this is not the first time this has come up and listening slash communicating has been an issue previously.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I know I'm just guessing based on context, but it seems the direction this went. You need to do some self-reflection and determine if this is a pattern of not listening to your wife and ending up with a bad outcome, especially on her end. I hope you actually apologized, it doesn't mention in your post, and told her you were wrong and took responsibility.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Making the excuse of not eating earlier in the day is just that, an excuse. Your wife wants you to listen to her, not make excuses.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Someone else said, like, I think that it's super weird to have put his cookie separately in any other context, but it honestly sounds like she put his in a separate bag specifically so he wouldn't eat her or their daughter's cookie and he did it anyway because this seems like a recurring problem where he doesn't listen and ruins other people's day. I have ADHD too, and it's really hard sometimes.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
But it's not her problem he didn't eat all day, and it's not her problem that he didn't listen. Replay the message if you think you missed something, especially after the first bite of an unexpected cookie flavor. Find out what the bakery is and go and get her and your daughter cookies. Buy her more than one, apologize properly, say you'll do better, and then do better.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
It's not hard to pay attention to people you love when you care about what they have to say. You're the asshole. Yeah.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah. But that just comes down to both of them communicating better still. Right. And I do agree with the comment of like, she did describe the cookie as a toffee chocolate chip cookie and then he ate a cookie that wasn't that and just finished it. Yeah. I'm just like, there's a lot of contradictory stuff going on here. Definitely for me, the asshole verdict on my end is a lot of like inferred.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I'm like, I'm assuming a lot going on here based on how you wrote this. Yeah. I'm assuming a lot of things.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
I think it's actually so fascinating how these little tiny things, if they are a big problem, it's such a huge sign, right? Because if accidentally eating a cookie isn't a thing you laugh at, then it's like, oh, there's a bunch going on right now that we have to acknowledge. If tiny things are causing huge problems, you've got huge, huge problems everywhere. Making a mountain out of a muffin.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah. It's a cookie, Damien. It's a cookie.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
All right, our next story. You got that?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
So no one else could bully me. I'll talk about it in therapy. Our first story is an Am I the Asshole? Yes. Am I the asshole for refusing to stop using my embarrassing lunchbox at work? I, a 28-year-old man, bring my lunch to work every day in a bright blue Pokemon lunchbox. I've had it for years, and I don't think much about it.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
We're literally seeing it. But they didn't. No. Okay, our next story comes from Man by the Asshole and best of Redditor updates.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Am I the asshole for my response to my boyfriend's ultimatum over audiobooks?
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Yeah, nice boyfriend, idiot.
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
My boyfriend and I have been together for around three years, and we've had a pretty easygoing relationship, no big fights or anything, until now, which is why I'm questioning myself so much. So I listen to audiobooks, not erotic ones, though I do partake in audio-only porn sometimes, because,
Smosh Reads Reddit Stories
Remember, Sticks And Stones... | Reading Reddit Stories
Why even justify it then?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Hello and welcome to Smosh Reads Reddit Stories. I'm Shane, and today we've got a classic Am I the Asshole episode. And I'm joined by two people who are not the asshole.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Best of Editor Updates.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Buckle up. Am I the asshole for leaving my Bumble date stranded at a restaurant after she admitted she was going to her guy best friend's place after the date? Okay. A couple months ago, I matched with Anna on Bumble. I thought we vibed really well, she had a really nice and funny demeanor, and we had lots of engaging conversations on FaceTime. We set up our first dinner date last week.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I proposed a really nice restaurant which was sort of far from where we lived, but I really wanted to treat Anna because I thought she was special. Anna asked if I could pick her up and then after the date, drop her off at her best friend's place. I didn't mind it at all. Anna said she had movie night with her best friend. I picked Anna up and we went to the restaurant.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
The date went better than expected. We vibed really well. Anna also had drinks since I was the designated driver. However, right at the end of the date, Anna asked if I would drop her off at Josh's. I was initially confused and then realized Josh was her guy best friend. Anna instantly realized what she said and it sort of became awkward.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Anna apologized and I told Anna there was no reason to apologize. I was just curious about who Josh was so I asked Anna and Anna said he was her guy best friend and they occasionally have movie nights. Anna said she wanted to be honest with me because she really liked me and saw a future with me and she admitted they sometimes make out during these movie nights but it doesn't go further than that.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Mm-hmm. I felt sort of guilty about it later and called my sister to ask her if what I had done was right. My sister said I shouldn't have left Anna stranded at the restaurant, especially after Anna was really sweet and honest with me.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I told my sister how I could be expected to take Anna for a really fancy dinner and then drop her off at her guy best friend's house where she would then make out with him. I had enough self-respect left not to do that. Was I the asshole?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
So we're not talking about, we are acknowledging most of us, I think all of us here would probably not continue, or I think I wouldn't continue seeing this person because I'd be like, I don't know if I'm comfortable with that.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'm honestly beyond sick of Disney, and I never really liked going in the first place. Jess knows this, but she has no concept of travel beyond Disney. We're currently planning a trip for April, and Jess, as usual, said that we can just go to Disney. I explained that it sounds fun, but hey, why don't we go somewhere like Hawaii this time? Jess was confused. She asked why we would go to Hawaii.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's the conversation of, okay, he's not interested in seeing her more. That's clear. He did tell her he was gonna drive her home. Should he still drive her home?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
That's kind of the conversation, because she hasn't necessarily been a bad person to him, but she's being honest with him, and he's going, oh, I'm not interested in this relationship.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Ian and Amanda.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I think that's what I would probably do in this situation. I fear... as is the case with every Reddit stories, I fear we might have a little bit of an unreliable narrator on this one too.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Because I'm just like, yeah, how did you react? How did this go down? How did she tell you about this?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I don't think so either. And it's like, it was his choice because he's like, I want to treat her to this fancy dinner. So he goes there and now he's making her pay for her portion. Yeah. And that's after her being like, hey, I'll be honest with you, this has happened. It has me wondering, I'm very curious about the wording of this because slight wording changes change this entirely.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
If it's like, yeah, in the past we have done this, and he's going, oh, so you do this all the time. And you do this, and you're about to go do this right now.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Pretty rough. I also am like, if I was her friend, I'd be like, you shouldn't expect to be succeeding in seeing people if you're telling them you're actively kind of seeing someone.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
That's what I'm curious about, too. That's what I'm like, what was her wording?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I think he probably did. Taken at her word, taken at the word of this story, which I never fully trust a Reddit story, I'm like, okay, if she really did say that, that's wild. That's wild to admit that. That's wild to ask a date to drop you off at the place that you're saying this is happening. Yeah. I don't know what you're expecting to happen.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
My only assumption with this story is I'm like, I think there's little tweaks to this. Yeah.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Anyways. I don't know. Crazy. So the verdict was not the asshole. The comments, what did Anna think was going to happen? Which I agree as the story as it's written, I feel the same way. Someone else said, why on earth would you go on a date with someone and then ask them to drop you off at your friends with benefits and then expect them to want to continue a relationship with you?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
What planet are you living on? Have my cake and eat it to land? Someone else said, kudos for the maturity on both their parts, but girl, what? Thanks for dinner. It was great. You're great. Now I'm going over for a movie night with a guy I might make out with. Can you drop me off? Huh? I completely agree if that is what she's saying.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Given his story, sure, I agree, but I don't think that's... I just have a hard... I mean, look, there are people out there that would do that, right? The world's filled with every kind of person that... they exist. I just have a, I'm having a hard time believing it. But update. Hey everyone, just a quick update. I appreciate all the comments and the different opinions on my previous post.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I responded that we could enjoy the spas and go to the beach. Jess mumbled a half-hearted answer and walked away. A few days later, she approached me saying that she made hotel reservations for Hawaii. Which is? That's right. Oh boy. Frustrated, I told her that I'm honestly tired of Disney and that I just wanna have a different experience this time.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
However, at the end of the day, the reason I posted it was because I felt guilty about what I did and I agreed more with the comments stating what I did was wrong. Also, my sister has never once given me bad advice in life and I think her assessment was right this time too. Since I left Anna at the restaurant last week, she texted me a couple of times but I just ignored those messages.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I opened the messages a couple hours ago and I was sort of surprised. Instead of lashing out at me, she just apologized again and said she was willing to stop seeing Josh if it meant we could continue our relationship. She said after the dinner, she just took an Uber back home and didn't go to Josh's.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I texted Anna that there was no reason to apologize and I shouldn't have left her stranded at the restaurant and I should have also paid for her meal, since I was the one who invited her to the expensive restaurant. I asked Anna for her Venmo, but Anna said she didn't care about the money, and asked if we could continue our relationship.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
However, I didn't have the same feelings for Anna anymore, so I texted Anna upfront that I don't think we're compatible, and I don't want to continue this. We chatted a bit more, and Anna was very respectful of my decision, but admitted she was sad. I too admitted it was tough, but it's best for everyone that this doesn't continue further.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
That was the final text, and I definitely think there are valuable lessons learned for this entire thing. Thank you all for your input. That has me now believing that this was all legit.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Look, because he's given this update going, yeah, I was wrong, I should have done this, whatever. I'm like, oh, she really probably did say that.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
And that is the situation, which is... Wild, but hey.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I think that's become the common saying. I think that's become the common saying of being like, it's all right. I don't like it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I mean, it's a good update in that they both are okay, and they feel good, and it's all all right. I mean, he was saying he just doesn't have feelings for her now, like...
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, but don't apologize.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Our next story. I also own you both. Oh, okay.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, and that's why I don't need to apologize.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Our next story comes from Am I the Asshole? Am I the asshole for having second thoughts about marrying my fiance after a drunk comment?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Real, this is.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
This is a 30 year old woman and she's writing about her 27 year old husband. Not sure why I'm even here. Guess I'm still trying to process what my, 27 year old man, what my fiance drunkenly admitted to me. For context, my fiance, who I'll refer to as Alex, and I have been together for just under two years and got engaged in December.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Everything has been a blast since the day we met and we keep surprising each other with just how awesome of a couple we can be. Last night, we had a special date night for New Year's planned where we were dressed up like bowlers from the 1970s and bowled our asses off for a few frames until we finally decided on a winner.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's pretty funny.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
They go to Disneyland, they go to Disney World all the time. Give me some boring times with the relationship. Totally. During the five games, we ended up drinking two of those beer towers, about seven beers each altogether. He's not a big drinker, so he was a little more than tipsy when we decided to call it a night and head home.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
We live really close by, so we walked to and from the bowling alley since we figured we were going to be drinking. On that 15-minute walk home, he was doing the usual mushy I love you and other cute little things he tells me while giggling. Things took a bit of a turn when he started talking about how much he enjoys our sex. Okay.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He's always told me that we have amazing sex and that he can't get enough. But in his drunken state, he told me something different. You're the third best that I've ever had.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
She told me that she was compromising with me and that I should be appreciative for the time she spent. I asked her if she was willing to consider anything other than Disney for our trip and she said no. Whoa! At this point, I said that I wasn't going. Now she's furious. She canceled the reservation she made and now she's looking for a friend to go to Disney World with again without me.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I stopped walking for a second and just stared at him in disbelief. Alex just looks at me, giggles again, and kisses me, thinking he was just saying that on purpose to agitate me a bit like he does, but not really mean it. I laugh it off and we keep walking. Once we get home and sit on our front porch, he brings it back up. I really do mean it though, babe.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
You're amazing, but I've had better before you.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I was as confused as I was mad, embarrassed and offended all at the same time. I asked him what the hell he was saying to me and if he was being serious. He started crying and told me that he had a one night stand before he met me with some woman that was like a sex goddess. He also mentioned a past fling with a guy when they were both teenagers and experimenting with drugs.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Both of these confessions took me completely off guard because he never in our time together mentioned anything about being bi-curious or anything like that, let alone promiscuous sex. My commitment to Alex is starting to change now, though, and I haven't been able to look at him all day.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'm having second thoughts about following through with a marriage if he'll always think of me as a third place prize. Even if I did think there was something about Alex that wasn't as good as a past relationship, I wouldn't openly tell him that I thought he wasn't as hot, handsome, has a small dick, et cetera. That just seems like kind of mean and feels a little malicious or petty.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Am I the asshole for reconsidering the engagement?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's actually the third smallest dick I've ever seen. At first I'm like, there's no way this guy actually said all this. But then I'm like, you get eight beers deep, the truths are coming out. And he's wanted to say it for a long time. There's nothing that Samuel Adams won't get out of you.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's Sam Summer. And there's no secrets at Sam Summer. No. Sam Summer. Okay.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
No, you can't recover from that. You simply cannot.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Which it's like, how do you move on from that? Because mind you, not only being told third best, she also was like, I had no idea that he was also vicarious. Like that's also a huge bombshell. And it's not that there's a problem with it. It's that it's like, I don't, do I know you?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Was I the asshole here for not trying to accommodate her request? No.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I also think he's not, I think this is a very clouded statement because he's referring to one, an experience he had on drugs when he was a teenager. That's absolutely, it's a distant memory. it gets clouded by like, oh, the past, you kind of think of it differently. And it's the same with this one night stand.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
You talk about single instances, and single instances in life can have this different feeling of excitement to it, whereas he's not referring, like, This is a partner he's had for years and that's a very different thing. I just think there's a lot. But it tells me there's a lot going on internally with him.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
And that's why if I was her, I would be reconsidering it because I'd be going, I actually don't think I know you. And I think you're working through a lot. And I don't love that you think of it this way.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'd probably be the same way out of just, I would need to know.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I would need to know, even if I was still certain that I'd be calling it off, I would need to know first.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'd want to talk it all out. Verdict was not the asshole. Comments, not the asshole. Saying it once was a slip, twice was deliberate. True. Someone said, not the asshole. There is absolutely zero situation, joking or not, where I would ever say this to my wife, ever. Lastly, someone said, you're not the asshole for having second thoughts.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
What he said was hurtful and unnecessary, even if he was drunk. It's okay to take time to process this and decide if you can move past it together.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He was in a bowler outfit when he said this.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Just start with that. Not everybody drinks and not everybody, you know, is into it. But for those who do, I do feel like those nights where you do get drunk with your partner are kind of like a test. Because it's like, all right, we got the truth serum in. Yep. What are we saying to each other? How are we treating each other?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Nice. And it is kind of a test because once you get past it, it's like, all right, I... Anything we would have aired, we probably would have aired it out.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yep. Update. Split. They might split.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Ooh. All right, update. It's done. This is gonna be done.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
You don't know? You think there's a chance?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
The advice is always to cut it off, but not always the case. I mean, look, Disney World guy, they're going to Disney World.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I think it's over.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Okay. So Alex tried to apologize. The morning after we went out, he pretended everything was okay and was as sweet with me as usual. But I was short with him and ignored his texts all day leaving for work. When we both got home in the evening, I still couldn't even look at him. And so he asked me what was wrong and I told him. Apparently, he hardly remembers a thing after we finished bowling.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He recalls walking home and saying some things he felt embarrassed about and then sitting outside and cuddling with me on the porch. I told him exactly what I remember him saying and he looked mortified.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He apologized profusely and told me I'm the only person he's slept with and ever cared this much about, but I told him he'd humiliated me and made me feel like I was the problem and needed some time apart, so he volunteered to go stay with his brother to give me some space.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He's since spent the rest of the evening and today trying to make it right, leaving voicemails and texting that he really didn't mean to hurt me, and that he was drunk and stupid. He kept reiterating that I'm the best thing that's happened to him and the sex he had before was meaningless and that you're my number one as far as anyone I've slept with that matters.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's just, it just made me more mad. Like he's now lying to save face and trying to manipulate me into feeling like I'm overreacting after making me feel like a lesser partner in bed.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I finally told him to stop and told him I didn't believe a word he said anymore and that even if he's being sincere, nothing he says will undo the fact that deep down he'll always think of me as a consolation prize to some sex goddess and his male buddy. I'm honestly also second guessing if he even likes women and am not ready to deal with someone who's questioning their sexuality.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He started crying again and said he just wanted to open up to me since we've never had the conversation about previous partners, and in his drunk state, he thought we were at that point where we could have honest conversations, but regrets the timing and letting it slip while drunk.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He said he'd move out and leave me alone, but hopes I won't share what he told me with my family and mutual friends, which I agreed to. I don't feel bad about ending things.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He clearly didn't think before speaking and now he's just trying to patch it up and minimize it as mistake and attempt at honest conversation when I know he's just trying to lower my self-esteem and make me feel like I need to turn into a sex goddess in bed or be more like a man. I've realized my self-worth and I'm no one's bronze medal.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I appreciate all the comments and kind words on the last post helping me realize this. Okay. Girl, my God. But I think she's, She's going through a lot as she's writing this post. But I do think she's missing the mark on a lot of it. All of it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Let's just, let's just get past that point. I agree with her in the sense of like, that's only going to make you more mad.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I, I, I, predict that months from now, she'll look at some of those things she's written and been like, okay, that was not true. Like her being like, oh, he wants me to be more like a man. I'm like, okay, slow down. Like stop. Stop.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I guess the argument is that this is anonymous, but it does run the risk always of people knowing.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
But I also do agree with, you kind of said it earlier, is like this did break them up, which means are they compatible? You know, this did break them up. There are people out there, there's a version of this where this happens and it's like they do talk it out and it makes them stronger because they were compatible. They saw eye to eye on things. Yeah.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
And I also agreed, I think it's important to go back to what you said earlier, is like, people's sexual relationships will change and evolve. It's not like, oh yeah, you're the third best ever. It's like, viewing sex as like, that's you. That's you always, and that's what it is. It's like, no.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Sex is communication that yes that is something that will change and if you're with the right person that you're compatible with it will Only get better and it's exactly about communication and talking with each other and understanding each other totally He doesn't seem it seems like they both have growing in that realm.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's still just like, okay, our vacations are always gonna be Disney themed and he's tired of it and he's telling her, hey, I'm tired of this.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah and he also frankly does sound like there's a lot that he needs to acknowledge and figure out she the same way and That's kinda why I was not confident this was gonna last. Because I was just like, I don't think they sound compatible. And this just sounds like too big of a thing for them to handle.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Maybe in a couple years, if they really work on themselves, it's something that they will come back around and be fine with.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, she was so hurt.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Oh, totally. And this is one of those heartbreaking ones that is really devastating and really like, man, I don't know what I would say to either of these people, you know, if I was talking to them.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I agree, but I also think if in her head she's immediately saying, there's no way I'm ever gonna get over this, I'm also like, all right. That's true. But a marriage is truly being with someone where you're like, I will do everything I can to make this work. Yes. But once you hit that place of I can't make this work, it's dishonest to stay in it. Right. Totally. So it's this tough.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
But she immediately, I mean, if you are calling it quits that fast, you weren't right for each other. Right. Yeah. That's how I view it. Right. At least.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
No. I mean, look, that's a fucking devastating thing to hear.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, yeah, yeah.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
The biphobia is real. Totally. For sure. Agreed. That's what I mean, as she's writing this, I can tell, I'm like, tears are streaming as you're typing this. So I'm curious, because this was written very recently, I'm curious if there'll be an update eventually, kind of like a cooled down version of it, but we'll see.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, which is still, it's still a little sad to me that in all these years she's never been like, what would you like to do?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Our next story. Am I the asshole for flirting with 19-year-old girls and defending myself when being called a predator?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Say how old you are, bro.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'm 31. Yep. And recently ended a long-term relationship. I was broken. I recently went to this cool restaurant slash bar downtown with one of my buddies to have a good time. Anyone of any age can come in. While we were there, there was a girl who was celebrating her 19th birthday. They sang happy birthday, and they were allowed an outside cake with 19 on it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
The birthday girl was pretty, so I wanted to go chat her up. Her friends were super cute, too. My buddy told me to leave them alone and that they looked like babies. He didn't want to go over at first, but since the breakup, every other woman but my ex has been invisible, so he went to wingman with me. We walked over and wished her a happy birthday.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I thought things were going well and the women were laughing. Then all of a sudden, one of the girls snaps at me to take a fucking hint, R. Kelly." I was taken aback and just said, excuse me? She said to read the room and that they were uncomfortable. Another asked us to go away. I was going to go, but I was really bothered by the R Kelly comment.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I said it's fucked up to call me a predator when we were all adults here. My buddy wanted to leave, but I stood my ground. The birthday woman said that it didn't matter. It's weird for someone my age to hit on them, especially when they make it obvious that they are uncomfortable. I apologize for making them uncomfortable, but that didn't give them the right to call me a predator.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
One of the women said it was a personal problem. I said that adults are allowed to hit on other adults. It's not a crime. One woman just asked why I was still standing there and yelled at me to go away. I was pissed off, and when I left, their entire table was singing Ignition and laughing their asses off. I was furious and humiliated. When we sat back down I was seething.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
My buddy said that it was my fault for not seeing the signs that they were uncomfortable. To him it was obvious, so he wanted to go. He called me delusional. I pointed out that they were laughing and he said it was just uncomfortable laughter. I told him that I had every right to be mad about being called a predator when they were all 18 to 19. It's a horrible accusation to make.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
My ex was six years older than me. He said that they weren't calling me a predator, just weird for going for teens. He said it was wrong of them to sing after me and that was bullying, but I should have left long before that. I felt like he should have stuck up for me. Was I wrong for sticking up for me or for hitting on them in the first place? I was respectful and not creepy at all too.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Edit, for the record, I do date women my age and older. This was the first time I approached much younger women.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's wild. Even his friend. It's also like they're celebrating a birthday. Even if the cake said 30, I'd be like, oh, well, I'm not going to go up and bother them. They're celebrating a birthday right now. Don't bother them.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
But look, man, he also entered the gladiator arena of people who are gonna make you, like insult you better than anyone. 18 and 19 year olds, devastating. Born and raised on TikTok. They're singing Ignition at you.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I fucking killed Eric with that one.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
There's no context where I'm gonna willingly talk to teenagers because I'm scared of them. Because they're gonna make fun of me.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
They're gonna make fun of me and it's gonna hurt. It's that John Mulaney joke of there's nobody in the world who can find your weakness like a teenager.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, your friend is like, you're delusional.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He's actually truly being your wingman right now by telling you you're being delusional and being creepy. Exactly. He's being your wingman in that way. Yeah. Sometimes a wingman has to do that.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Emily makes a great point. He referred to her as the birthday woman in this post, which he definitely, I know for a, you know that he was typing out and he wrote birthday girl. Back, back, back, back, back, back. Birthday woman.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's giving Matt Gaetz. Yep. This guy really puts the Reddit in Predator. Oh. Nice.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
That's insane. Yeah, unless it's like, oh, you book the reservations, you pick. It's like, don't just go off and just book it. Like, let's do that together. See, where I thought this story was going was she was going to be like, yeah, let's go to Europe. Let's go to Japan. Let's go to Beijing. And then it's going to be like Disney Tokyo, Disney Paris.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Edit, okay. Verdict, asshole, not surprising. There's an edit that he wrote. He's like, wait, hold on, hold on. All right, guys, I get it. I let my pride get in the way of things here. Can't fix it. We'll do better next time.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Let's see what these comments are, because you know it's about to be ripped apart. You're the asshole for being creepy, not taking a hint, and arguing about it to women who asked you to leave. You're upset about being called a predator, but don't seem to care that your inappropriate behavior made a group of women in public feel uncomfortable.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Someone else said he is extra you're the asshole for standing his ground when they asked him to leave. What did he think would happen? They would admire his persistence and realize they were wrong all along and he was actually a nice guy who they should all sleep with. Someone else said, you're the asshole.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
The fact that both the girls and your friend easily recognized that it was creepy to hit on her should tell you that it wasn't okay. He wrote this all out thinking he was right.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's hers. Yes! What? Let's go! What?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'm the Lionel Messi of Reddit, basically. I don't know if he does that. I've never watched football. Football. Our football fans watching are pissed off. Or they're like, hey, Ian knows ball. Does Messi do the wings when he scores?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Update from the 19 year old girl.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I have never had a Reddit account before, but my journalism TA showed us it, and sometimes I'll just check the front page for news. Earlier, I saw a post up there that basically described my birthday dinner like three weeks ago. At first, I didn't give a fuck, but now I just felt the need to clarify a few things, even though I know most people called him an asshole.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Some people got angry about the R. Kelly comment and singing Ignition. Was it mean? Yes, but I'm done being nice to creeps. This was not a bar. It was a bar and grill, but it was mainly a restaurant that just happened to serve drinks. We were sitting near a family, so we weren't in a setting where people go to get hit on. We were minding our business and keeping in the corner booth.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He came and wished me a happy birthday. I said thanks and we all went back to our conversation. I did appreciate being told happy birthday, but he stuck around. We laughed uncomfortably and went back to our conversation. He stuck around and kept interrupting us. Each time he said something, we nodded and then turned our backs to him.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Like she was going to be like, let's go to one of those. Which frankly, that's, if you want to argue a compromise- That's one. It's like, let's go to Paris and one of the days we'll go to Disney Paris and then some of the other days we'll go do other things.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
We said, thank you, bye, a few times, but he was still standing there talking to us. His friend kept finding excuses to leave. I was annoyed, uncomfortable, and disgusted, but I gave him a respectful, okay, have a good night. Here's some cake for you to take home. But he grabbed the cake and sat down in our booth. No. He said, the night's not over yet. Predator!
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Then my friend just snapped. And if she didn't, I was going to. When she called him R. Kelly, she wasn't accusing him of being a pedo, but a creep. 30-year-old guys who hit on us are creepy and disgust us. Point blank. period. We were nice the entire time and I even gave them a million hints and cake for the road. His friend was even finding reasons for them to leave.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Then he had the audacity to stand there and fight us on it. I told him that he was way too old for us and it was creepy from the start. When he left, we started singing Ignition among ourselves, not singing it after him. It's a throwback that our parents put us on. Instead of crying over our night being ruined by a creep, we turned it into a fun moment with karaoke." P.S.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
When he asked us our age and gave us his, we became a million times more uncomfortable. Guy was 30 trying to get with 18-year-olds at a birthday dinner. We are used to old men bothering us, and it's always gross. To the if-he-wasn't-ugly crowd, he was a decent-looking, fit guy. If I never met him, I'd set him up with my aunt. But he was in his 30s, and that is way too old.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
This isn't porn, and I haven't met a single girl desperate for a 30-year-old divorced dick. Being called legal is demeaning. Everything about it was sickening. When he came over, announced his age, then asked us ours, I almost yacked. It was like he was IDing us at a family restaurant. Fuck out of here. I'm tired of having to be polite to guys who are creepy and disrespectful. Period.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
That was crazy. What if he commented underneath it being like, all right, so what's your aunt up to?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
You're telegraphing it. This is so good. That's insane. He sat down and said, the night's not over yet. Which is very scary. Extremely scary. I mean, he's lucky they didn't call the staff on him.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
They were being so nice to him.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Brutal. That's awesome. You know he saw this, too.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Oh, yeah, you said I was fit. Yeah.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yes. Sure. No, and I mean... I feel like my point was proven. That final paragraph, devastating. She annihilated him. Oh, 100%. If he read this, he's dust.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Get your ass home. And she's new to college.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, brutal. All right, our next one. I don't know if anything can beat that.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
That was savage. And we're going to Disney World after this.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Okay, our next story. This comes from Relationship Advice. Am I the asshole for breaking up with my girlfriend because of a caught cheating prank?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah. Yeah. I, a 26-year-old man, broke up with my girlfriend, 25-year-old woman, of two years because of something that happened recently, and now my friends are saying I massively overreacted.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
So a few days ago, my girlfriend and a close mutual friend decided to play a prank on me. The prank was that they filmed a scenario where I caught them in bed together pretending they were hooking up. They set up a hidden camera in the bedroom and when I walked in, I saw him in just boxers and my girlfriend in a bra and panties, straddling him, acting like they were mid hookup.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
To make it more realistic, they even made some noises and tried to act like it was happening for real. I was shocked. furious and immediately confronted them as I thought it was real at first, like an actual betrayal. And then I walked out of the room and started leaving the house when they followed me screaming it was just a prank and then showed me the video they'd been recording.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
To be honest, I felt completely betrayed, not just by the idea of the prank, but also because of how they had gotten undressed to film it. I know it's meant to be funny to some people but for me it felt disrespectful and I was hurt. The whole thing felt like a violation of trust even though I know they weren't actually cheating.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I told her I couldn't be in a relationship with someone who would do something like that and I ended things right there. She's devastated and our friends have been telling me I overreacted. They think it was just a harmless prank and I should have taken it better.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
But I can't shake the feeling that it crossed a line for me, especially with how intimate and uncomfortable it felt to see them in that situation, even if it wasn't real. Now I'm left wondering if I made the right decision. I'm starting to doubt myself because everyone else seems to think I blew it out of proportion.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
The views, bro. There's a lot of people who do a lot of stuff on social media where I ask that question.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It reminds me of a question that gets asked around this office a lot, which is, what is a prank? And it's kind of like trippy when you think about it. Some people don't know. What is a prank? What is a prank? And to me, a prank is supposed to be...
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Kind of like a joke that you pull on someone that does give them a rush of some emotion, but it's ultimately supposed to end in them laughing and it's supposed to be fun for the person you're pranking. If the person you prank doesn't like the prank, then it wasn't a prank. It wasn't a prank. You actually just fucked with them in a way that.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
And I think you should know the person you're pranking well enough to know what's going to work and what's not. Because there are videos of people pulling off pranks on people where the person laughs their ass off. Yeah. And those are awesome, right?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Punked, crossed the line. But I think all of them knew. I think so, too.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
There's ones where they would get into a port-a-potty and it would like flip backward and they're at the top of a ski slope.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Japanese prank shows are ruthless.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
You know what, fam?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Fuck it. Wait, I'm sorry. It has me thinking of my all-time favorite. This is old school, where they would wait till people were walking down an alley by themselves and they would have a crowd of people run the, like, sprint the opposite way screaming and the people would always be like, and they would start running too. It was awesome. Yeah. That's funny. But also devastating.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Again, this is different.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I also think people need to know, and we say this as people who make content on YouTube, you're going to try to make a prank and you're going to film it. Know that most of the people who do prank content on YouTube, that it's all fake. It's so fake. The person they're pranking knows that it's all fake.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Like scare tactics? Yeah.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
That shit was fucked up. Unfortunately, I was entertained by that.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
But it's wrong.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Verdict, not the asshole. Comments, not the asshole. How does your girlfriend of two years not know you well enough to know what you'd find funny? Like even if you prank all the time with each other, she should know you and what you would find actually funny. If you're not laughing, it's not actually a prank. It's just them hurting you and then blaming you for being hurt.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
OP responded saying, yep, I told her that. She says she wanted to try something new and unexpected and didn't think I would feel so strongly about it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
No. Someone else said, so two adults who were comfortable enough being in their underwear together and assuming a sex position think you are overreacting? OP responded, I can't make it make sense either. You made the right decision. Other people don't get to decide what sort of prank goes past your line for pranks.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
If your ex-girlfriend really was devastated, maybe she'll learn that trying to pull elaborate pranks can backfire on her and she won't do it to other people in the future, not the asshole. Yes. Ooh. My ex-girlfriend was really upset with all the hate she received online and blamed me for painting her in a bad light.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I told her I did no such thing, she just didn't like that she got called out and on her behavior. The mutual friend who was part of the prank is now also pissed off at me and saying I went way overboard. I told them both to fuck off and have blocked their numbers.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Our friends have since started taking this more seriously after reading some of the comments on here, with a few taking my side and saying what my girlfriend and the friend did was horrible. Others still think this was all unnecessary and I should have just laughed it off and moved on. No.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
You know what? I also, I don't think this is what's happening, but I know that I do this and I have to like force myself away from it, which is they didn't go on vacations for the longest time because they couldn't afford it. They finally could. And they probably one of their first trips was Disney World. And it was like that rocked. Yeah. Let's do it again. Because we know it rocked. Yeah.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, the whole point of the video that you were also filming without my permission was supposed to make me look, I was the focus of this video I didn't know I was gonna be in. That alone.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He did the right thing. Our final story. This story was covered on two hot takes on an episode that Courtney was in. So Courtney's take is out there, and now it's time for our takes.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's time for three hot takes.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
No, our takes are hot.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'm actually not.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Let's do it. All right. Okay. Our final story. Am I the asshole for telling my fiance I don't want my Timu engagement ring?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Timu is a, like, it's a... It's like a Shein, it's like an app or website where you get really cheap stuff.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Uh-uh. But it's just a site where you get really cheap.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Imagine Amazon, but like 100 times shittier.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, it's Shein. Okay. Okay, so it's a 27-year-old woman. My fiance, a 29-year-old man, proposed to me a few weeks ago. It caught me completely by surprise, but we've been together for three years and things have been going great, so I was really excited and said yes. I really liked the ring when I first saw it and my friends and family all think it is stunning.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's an oval cut with diamonds across the band. I asked where he got it and he wouldn't tell me where, but that he got a great deal on it. I didn't think anything of it until yesterday when we were in bed and I asked him if it was diamond or moissanite, mainly out of curiosity. I don't have a preference, by the way. He said he didn't know and would have to look it up.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
When I glanced over at his phone, he was in the Timu app. I asked him if he got it from there and he didn't respond. So I asked again and he responded with something like, does it matter? He left the room and ended up sleeping on the couch. I spent all night so confused. Today I decided to download the app and look up my ring and I found one that looks identical.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I found the exact ring and it's listed at $38. I am mad. He makes good money, around $200,000 a year, and I feel like he could have shelled out some money for a ring better than the one on Timu. Am I the asshole for telling him I don't want it?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It's so easy to fall into the like. Trap. Well, we've done that. And it's awesome. So let's just keep going there. It's safe. I think the like more common one is like restaurants. It's like, oh, that restaurant. This is our spot. We love it. We're going to just keep going there. It's like we have to try something new eventually. Right. Yeah.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
So I, to me, it's once again of like, this is, he does not know his fiance, or he doesn't know his girlfriend, right? Because this, it clearly did matter to her to some degree about like what the ring is. And there are tons of people who don't have like fancy rings. But there's, it's like, there's still, it's such an important thing to have some thought put into it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, it doesn't have to be expensive, but like to have some meaning to it is important. But he just got it off a,
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I know people who have silicone rings or wooden rings or all sorts of things. But just something that has some meaning to it, maybe. Clearly it's important to her is what I mean. Because there are people who are like, oh, I don't give a shit what the ring is. But she's not one of those people.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Because this is going to be temporary. This ring is going to break. It's going to turn her finger green. Her finger's going green in like two weeks. Yeah. Yeah. Definitely. The verdict is not the asshole. Comments, not the asshole because that thing might turn your finger green. He's lucky you don't have a sensitivity to fake metals like some do. He makes good money but bought a $38 ring.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Is he cheap with other things where discount shopping isn't a new thing for him and he's just an all around penny pincher? My first thought was did he not spend the money because he doesn't want slash expect this to last? OP said, yeah, let me provide some more context. Really, he's never been overly frugal. I'm probably more frugal than he is.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
And then you try something new and you're like, that's our new favorite spot. Right. That's. It's comfort. It's the tough thing. And there's nothing wrong with.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Neither of us are huge spenders, but we each make enough to not have to strictly budget or anything. We have our own accounts and split rent equally. I know he has at least $100,000 across his savings slash investment accounts. We go out for drinks a few times a week and we'll go to concerts together and whatnot frequently. We travel a few times a year and stay in basic accommodations. Ugh.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Like our door dash the other night was $40. My ring costs less than door dashing dinner. Yep.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
But I'm now confused, because she's like, he's not frugal. We're not in a financial bind. Yeah. This is confusing.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Nine years in a row. I think it's like. Unless they're both Stoked about it right that's fine right, but he's not right yeah Okay comments well verdict not the asshole sure yeah comments How the fuck did this go on for nine trips without you saying something I'd have gone mad after going a second time correct so
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Update, after reading responses from my first post on the Am I the Asshole subreddit, it got taken down, I was freaking out a bit. He came home while I was FaceTiming a friend about this. I hung up with her and then talked to him for an hour or so. He apologized for sleeping on the couch and that he needed time to think.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He doesn't see eye to eye with me on my concerns about the ring and says he did research and that it was highly rated. He says if the ring breaks, he will replace it, but didn't say it'd be higher quality. I have people messaging me that the ring could be harmful to my health and that Timu has horrible standards for their jewelry and labor issues, so now I really don't wanna wear it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He left and went to his brother's house. Usually I'd go with him, but things are just tense. Am I the asshole for telling him I still don't want it? No, you're not. Update number two.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Ugh. Now I'm just in my head about all of it and regretting my initial reaction. It's just a dumb ring and maybe I've read into it too much. The only other time we've had an argument like this, it was resolved within a couple hours, so I'm not used to this behavior from him. Update number three.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Update machine over here. He came home this morning while I was in a work from home meeting. These comments made my head spin all night. I got like three hours of sleep, so I admit I may be in the wrong for bringing up his finances, but I did. Ari, the gold digger rumors. When we met, I was making more than him. and often paying for his things, his high paying job is a recent development.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I have my own money and don't need his. I asked him what was going on, if there was anything he needed to tell me, if he was testing me by doing this. Well, that really set him off. What kind of person do you think I am? You think I'm a cheapskate, a liar? You obviously think really poorly of me. But still, he never gave me a reason.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
So I asked why he was deflecting every question to victimize himself and to avoid my questions. He tried to leave again. So I tried deescalating and told him I see where he's coming from, but I need to know if he still loves me. He was immediately apologetic and still wants to get married. He said I can just pick my ring out and buy it with my own money.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He said he's sick of talking about this and it's water under the bridge now. He's acting like his normal self again since this convo. I hear him out there skipping around and humming to himself all happily and it's actually pissing me off. Maybe I'm being dramatic, but I don't think I can handle a marriage with someone like this.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Two beer towers. And then when that goes wrong, you go to Disney World.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Someone else said, your wife needs to learn to consider her husband's feelings instead of only her own, not the asshole. Lastly, someone said, what the fuck? You have a wife problem. She's not into fully compromising at all. She doesn't look beyond herself much. Book yourself a nice vacation and go.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah. Okay. Thank you both for being here.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
No more updates. Thank God. There's nothing else to update on that. Yeah, they're done. They're done. I think they're done.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, these were really good. Yep, pretty solid. Very good. And they'll also be solid at Smosh Reads Red Stories Live on March 8th. We're doing it live.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
And we're going to have a live audience. Those tickets are likely sold out by now, but you can go get tickets at live.Smosh.com, and it'll be like you're there with us in person. Get your pancakes out. Watch the live stream. It's going to be a blast. So we'll see you there. And we'll also see you next Saturday, as always.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah, you got a woman problem, bro. You got a wife problem. You gotta get that wife in line.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
About a week ago, I made a post about an argument my wife Jess and I had. The TLDR version of it is Jess loves going to Disney World, and we have gone there for literally every trip during our marriage, which is now at an impressive nine times. When I asked Jess if we could go somewhere like Hawaii, she suggested Aulani, the Disney resort, and I dismissed the idea completely. This upset Jess.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Here's the update. I screwed up. I know most people were giving me the not the asshole judgment, but Jess actually showed a great deal of openness to my idea. She took initiative by reserving the hotel because she wanted me to be happy. When I said nope, no Disney, she felt that I hadn't put any effort into taking her feelings into consideration, and she was completely right. I hadn't.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Oh, yeah. It's still the bread and butter of pretty much every episode. All right, well, let's just hop into these. Let's do it. Okay. Our first one, Am I the Asshole for just deciding not to travel because my wife made reservations for Disney again? Oh boy.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
It was, in a twisted way, my form of revenge for dragging me to Disney World all those times. In the last post, some people commented about how Aulani barely even looks like a Disney resort at all. This is something I should have researched myself before I threw the gauntlet down with Jess. When I looked into it, it looked like a run-of-the-mill Hawaiian resort.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
In my defense, going to Disney World nine times has kind of made me sensitive, and I'm fairly sure that on a Rorschach test, I'd see nothing but mouse ears at this point, but I really should not have jumped to conclusions. A day after I made the post, I approached Jess and apologized. I was wrong.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yes, she might be a Disney adult, but aside from always wanting to go to their theme parks, she's never obnoxious about it. I said I was sorry and asked for permission to reserve the hotel again. And Jess responded that she'd love to go to Aulani with me. When I told her that it's not really all that Disney, Jess said, of course I knew that. I wanted to go because my sister said it was beautiful.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I'm a moron. Jess and I have replanned our vacation and we're super excited to be going now. I came to this realization because a lot of people pointed out some things I should have figured out myself. Thank you.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Sure, I still don't love that he's jumping to, I'm not considering her feelings. It's like, well, she didn't consider your feelings for nine years, so I don't know. We obviously don't know these people on a real level, we just have this story, but from what I'm gathering from here, it just doesn't sound like she's considering him.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Now write that down.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yeah. Hi again, everybody. This situation all started because my wife, Jess, and I had an argument about going to Disney World on vacation again. I didn't want to go because we've been there nine times. When I suggested Hawaii, Jess made reservations for Aulani, which previously on Dragon Ball Z, Disney World Resort.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Okay, and we realized that I was wrong and that Aulani was a perfectly fine compromise. Unfortunately... We will not be going to Aulani for our upcoming vacation. A couple of days after Christmas, Jess had a minor car accident. She mistook the drive for reverse and backed into our garage door. When I heard the loud bang, I ran outside and found Jess holding her neck in the car.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I immediately drove her to the hospital where she got x-rays done. She seemed fine, but the doctor said that based on her symptoms, headache, neck pain, numbness in her fingers, she could have whiplash. Jess and I figured that she would be fine in a couple days, but almost two weeks later she is still complaining about back pain.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
We've got a Disney adult story. Let's go.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Yesterday she approached me saying that she wasn't confident she could go to Hawaii in a few months. I asked what she wanted to do and while apologizing profusely, she asked me if we could postpone that trip. I responded that she had absolutely nothing to apologize for. After that, she said that she felt bad about not being able to go to Hawaii, but she might be able to make it to Disney World.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Stop it. Stop it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
But you know what'll help? Maybe Space Mountain will get it back right.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Let's go. My wife Jess and I have been married for the past 13 years. We're both 39. After experiencing financial hardship throughout our 20s and early 30s, Jess and I are now fortunate enough to have the means to travel once or twice a year. The only problem is that Jess literally only wants to go to Disney World.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
She's flooring it out of her garage. Yeah, that's crazy. All right, all right, let's continue. Yeah, sorry. While I didn't understand at first, she told me that it was very high accessibility and in a worst case scenario, ECV rentals. She doubts that will be necessary, but assured me that we could take it easy there.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I know that this isn't the conclusion people here wanted, and it's certainly not what I wanted to do with my next vacation, but Jess's health has to come first here. We've made our reservations. It's not where I want to go, but Jess is super happy right now, and that's what matters most to me. Thank you all for your input. Is this a no sleep post?
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Her neck is just back to itself.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
People were taking advantage of it.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
I don't think that'll get you in front of the line.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He's in severance and every year he just comes into consciousness at Disney World over and over again.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
Literally, she's like, okay, Disney World is fine, but the resort where we're gonna lay by a pool all day is dangerous. Bullshit.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
My old boss is gonna come get me. No, this is, once again, I only have this story. I have no other information. This just feels like total manipulation to me.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
No, I'm so upset that he agreed what he should have said. And the actual answer is no, we're not going on any vacation. We're not getting on planes. We're not going anywhere. If you have this injury that you're saying that happened a couple weeks ago that you don't feel confident a few months from now.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
He's going to Disney World for the rest of his life. He's not going anywhere.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
We have been to Disney nine times now, and every vacation we have ever taken together was to go there, including our honeymoon. So we go, we eat the Mickey Mouse ice cream, we wear the mouse ears, we stay in the official hotels, we see the characters, we ride the rides, we take the pictures in front of Cinderella's castle, and we come home every trip.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
They live in the Haunted Mansion.
Smosh Reads Reddit Stories
Putting Relationships To The Test | Reading Reddit Stories
This is a very good one. What? No, it's extremely funny. It's also a nightmare. Yeah.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Hello, welcome to Reddit Stories. I'm Shane, and today's theme, silly. Some silly stories. And I'm joined by two silly gooses. Sharks, Spencer. Wait, wait, sing a song for us.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
No. I just remember it. I can fairly say. I remember all the details, all the tags, everything. I can find it.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Oh, yes. Yes, RedTube. The old magics. The Lost Arts. Red Tube. This was from a month ago.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
And I'm just sweating. I'm just like.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Not the asshole. Not the asshole. Oh, there's the asshole. I was waiting. Comments, it's got to be because you totally only watch the most wholesome porn. Someone else said, as someone who works in IT, we don't care. We're not snitches. Lastly, someone said, a few years ago, I was working with someone who was always on Reddit at work.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Never saw what specifically, but he was a chill dude, so we never looked too closely. One day, we were testing out a new screen monitoring program with all of our CEO executives team. It randomly switches to this guy's screen and everyone was treated to a hentai image of some woman being demolished by some kind of monster. The guy's supervisor just went white in the face.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He was fired the next day. Fired? They walked up and they were like, nerd.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This next story comes from Best of Redditor Updates. My boyfriend's, this is a 21-year-old woman, my boyfriend's relationship with his teddy bear is making me uncomfortable.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This isn't anything crazy, just something funny that I want to tell people about, but can't risk getting caught. My husband, who's 30, and I, 30, have been together for eight years. For the past couple of years, I have been making him a peanut butter and jelly sandwich every day to take to work. I use Welch's Grape Concord Jelly. This is important for later.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Okay, now please, no joke, this is actually serious. Well, sorry, this is the silly episode. Kiana, this was supposed to be silly. Okay, now please, no joke, this is actually serious. I've been with my boyfriend for three months now, so it's pretty new. So far, everything is going well, except this tiny little detail. He has this teddy bear, let's name him Teddy.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Teddy has always been a part of my boyfriend's life. Teddy was given to him when he was born, and at around the age of five or six, his parents tried taking Teddy away from him. He screamed and cried so loud without stopping, and they ended up giving up. so he kept Teddy with him his whole life. He mentioned Teddy to me pretty early, about a week after us being together.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He showed me pictures of him and I found it cute at first. He had plenty of pictures of him in different situations. Him with the mug, him laying in bed, him studying. I truly found it adorable since I thought it was just a joke, really, and didn't think that Teddy was such a big part of his life. The more we got to know each other, the more he started mentioning him.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He'd often make jokes about him. When he had to come back to his flat, he'd say, I have to come back, Teddy is waiting for me. And then later, he'd text me, OK, I put Teddy to bed, so now I might go to sleep as well. I don't want to wake him up. Again, a little weird, but cute still. But he started talking about him constantly, always linking what we were doing to him.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Oh, I wish Teddy was with us to see that. Teddy doesn't really like people, so I won't take him with me for this party, et cetera. He'd send me selfies with him at least twice a week. He also sometimes said weird stuff like whenever we watched a sex scene in a movie, he'd say, that's what me and Teddy do when we're alone.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I'd be like, oh, Cleo's at home. She's lonely. Everything was kind of silly until... Cleo's alive.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
All of it could be passed as silly until it was like, and I fuck him. Yeah.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Or when I asked when he lost his virginity, he answered, oh, I lost it with Teddy a few years ago. Whoa, whoa, whoa. They were jokes that made me uncomfortable. He always seemed to consider him as a baby slash his son slash his brother, so him being sexualized was extremely weird for me. I told him then that it was weird and he just laughed, but I don't think he took me seriously.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
About a month ago, I told him I was okay with him bringing Teddy when he was staying around my flat. I could see it was making him sad to leave him and also was very curious to finally see him in person. I can't go to my boyfriend's flat. There are rules that are strict. He can't invite anyone. So that day, I drove to his flat and he went with all his stuff and Teddy.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
When he got in the car, he pulled him out from his bag and had him give me a kiss on the cheek. When we drove, he opened the window and put Teddy out of the car, a bit like a dog would. He said it was rare for Teddy to travel like that and he could feel that he was happy. Teddy smells a lot. My boyfriend hasn't washed him in 12 years.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Every day, he tells me that I make the best sandwiches, and I just say, I make it with love. However... When we're fighting, he always says he can taste the difference in his PB and J, and I say, because I made it with hate. But the truth is, he can taste the hate in his sandwich, because when we fight, I use organic sugar-free grape jam.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
For the rest of the car drive, he hugged him and gave him kisses. He has a weird twitch where he just compulsively pats the back of Teddy. It makes a weird sound because Teddy used to be able to play music when you pressed his belly. He always rubs Teddy's clothes in between his fingers. You can guess that Teddy is in a pretty bad state. He used to be red and now he's just gray.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
When we're together in bed, he always puts Teddy's mouth on my mouth and I always avoid it as I find it disgusting. And I told him that I hate it, but he doesn't listen. This sentence is insane. Okay. He often mentions us having a threesome with Teddy, him, Teddy, being great at licking and them always doing kinky stuff together. Now I'm not an idiot, I know communication is important.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I tried talking to him so many times, sometimes in a joking way too so he doesn't feel attacked. Like once I asked who would he choose if he had to choose between me and Teddy, he said Teddy. But also, so many times in a serious way, I told him I didn't like when he was rubbing Teddy on my face and body.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I told him I found his relationship with him way too intense and weird, but every time he didn't take it seriously, made jokes, and never truly told me what he thought. I should mention that he is like that for any serious conversation. All he does is make awkward jokes and he never tells me how he feels. He said I love you first because he was drunk. This is becoming hard to handle.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I have been away from him for two weeks and was kind of relieved I wouldn't see Teddy anymore. But all he did was send pictures. And whenever I asked him, what are you doing? Or what did you do today? His answer was playing with Teddy. Today he told me I was perfect, which was a surprise at first. He doesn't give a lot of compliments. When he said that, I said, really?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
And his reply was actually no. Teddy is perfect. You come way after him.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Fuck you. What's happening? I just gave up and didn't reply. I have three questions. One, am I overreacting? Am I the one not being tolerant enough? Am I some boring girlfriend who can't welcome some childishness in her couple? Two, what should I do? Should I let him live his life with Teddy? Should I ask him to make a real choice? Should I ask him to just stop the sexual jokes?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Like, who am I to ask such things I don't know? Is it my place to tell him to stop being so weird with his teddy bear? And three, how do I get him to finally talk to me and take me seriously?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Teddy was red and now he's gray. Okay, okay. Oh, wow. This is a whole brand new thing. This is silly.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It's in the back of the fridge, and he's never seen it, so it's what I use to convince him that he can't make me mad, or my anger makes food taste different.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Okay, that one was kind of funny.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
That was funny. Okay, there are plenty of adults who have a childhood teddy bear. Yeah, sure. This took such a pivot when it got very sexual.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
But this is very different. I've never heard this type of story before. I think him involving it in the bedroom without asking her... Oh, and it's like kind of fucked up and it's very fucked up.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It's like extremely fucked up. And the fact that he's not like listening to her, that's enough for me. I'm like, there's a lot of reasons for you're allowed to break up with people for any reason. But that's like, hey, you should definitely.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Anyways, back to... And I would fuck him.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I don't know. That's a great question. You know what I mean? I think it's decent size.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
But this is supposed to be his. That's his teddy bear, and he's trying to make it be. Has he checked it for holes?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Top comment. How on earth am I still single? That's that's great. That's hilarious Someone said seriously what the fuck I've been married for a couple years and as an average-looking woman I ran to my fair share of weird dudes while dating But what if I had told my girlfriends even a light version of this dude's behavior?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
To not, I am so locked in on all of my fridge that you can't hide anything from me.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
They would be holding an intervention for me to get away from him ASAP Someone else said so I'm pretty sure I used to be friends with this dude on Facebook and ended up blocking him he had several profiles one for Teddy and would harass the hell out of women then blame it on Teddy and
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He has a comic slash novel or something he's working on about him and Teddy, and he makes the girls who block him or get upset with him the villains they defeat. If it's the same dude, he's out of his fucking mind, and you need to run.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He's silly. This is the silliest. This guy is very silly. He got too silly. He's getting silly with it.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
There's an update. Yeah, just give it to us. Oh, my God. I don't know how to process any of this. About the guy who said he knew him, fortunately, it wasn't him. Oh, good. That was some other guy. Oh, good. It's another one.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Thank you so much for your help, though. I was meant to see him today, so I picked him up and we drove to my flat. Of course, Teddy was there, and when he came in the car, my boyfriend had him give me kisses and stuff. I said, stop, please, in a cold way, and he stopped. I said we needed to talk, and he listened because I started crying.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I thought it would be hard for me to start talking, but since I was so stressed with all your comments, I just broke down and cried. I told him how I needed him to stop with Teddy, that he needed to stop being so close and dependent on him, that Teddy shouldn't come to my flat anymore.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
At first he was silent, but then he said he didn't understand why I was so uncomfortable with it, that he was purely joking, that he knew Teddy wasn't real, and that it was hurting him to see that I thought he had a problem. I was extremely disappointed by his reaction and just told him I needed a break. I drove him back to his flat, and that's where I am now.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It's just fully Freddy Fazbear. I don't know what to think. If it's Freddy Fazbear, it all makes sense. He's kinda cute. What? Okay, I'd fuck him.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
A Rupert? That's a brand new story. New guy unlocked. Fully new guy unlocked.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
No more updates. Wow. It sounds like she's backing away. She leaves him. She leaves him. It's done. In every other story I've ever heard, people who are adults who still have a teddy bear, it's always kind of wholesome. It's like, oh, yeah, you still have your teddy bear. Well, I mean... But they usually have it just in bed or as kind of like a decoration in their house.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Some people collect dolls. I would not think anything of someone being like, oh, yeah, I have my teddy bear that I sleep with or whatever. I'd be like, yeah. Okay, well, that was... I'm going to be thinking about that for a minute. Our next story, am I the asshole? Am I the asshole for asking my sister to replace my jelly beans after her son ate them? Did your son eat my jelly beans? My God.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
So I, a 25-year-old man, recently invited my family over for dinner at my new condo. I'm really proud of this place. It took years of saving, hard work, and sacrifice to get here. It's small, but it's mine, and I wanted to celebrate with a nice family dinner. I decided to make homemade spaghetti carbonara. I spent hours on it.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He's at work, and he's like my wife made hate This is weird I never looked in the back of the fridge
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Crisp pancetta, freshly grated Parmesan, whisked with eggs and pasta water for a perfect silky sauce. Carbonara is all about timing and texture, so I was in the kitchen paying close attention to every step. I added garlic bread, salad, and even made a cheesecake for dessert. It was a big effort, and I wanted the evening to feel special.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Now I keep a big jar of jelly beans on my coffee table as a treat. I love picking out a few here and there, and I always save the cream soda ones for last. They're my favorite. The jar has lasted a long time, and it's something I enjoy after a long day. Until little Joey's rolled in. My sister Laura, who's 35, brought her seven year old son who's honestly a bit of a handful.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He's not used to hearing no and thinks every space is his to do what he wants. My sister has never set limits with him and growing up our parents spoiled her too. While I was busy in the kitchen, my nephew found the jelly bean jar. I didn't notice at first because I was trying to get the carbonara just right.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
After dinner, I went to grab a handful of jelly beans and realized that almost all the cream soda ones were gone. My nephew had picked them out, leaving a mess of crumbs and broken bits. I pulled Laura aside and mentioned it, asking if she'd noticed. She just shrugged and said, oh, he only likes the cream soda ones, so he picked those out. No big deal.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I tried to be polite, but I told her that those were my favorites and asked if she could replace them.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
The cream soda ones. Those were my favorites too.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I tried to be polite, but I told her that those were my favorites and asked if she could replace them or at least get me some more of the cream soda flavor. She got annoyed and snapped, he's just a kid, you're seriously this worked up over some jelly beans? I told her it wasn't about the jelly beans, but that it would have been nice if she'd kept an eye on him or taught him to ask.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Laurel rolled her eyes and said, then don't leave temptations out if you don't want kids touching them. I asked her one more time to either replace the jar or just the cream soda ones, but she refused, calling me petty and saying I was blowing things out of proportion. My parents jumped in to back her up, telling me to drop it and that I should know better than to have temptations out around kids.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
But it's not just about the money, it's about respect and boundaries. I put a lot into that dinner, and her response was to let her son treat my place like his personal candy store. Now my family thinks I'm overreacting, but to me, this is about respecting boundaries. It's about respect. the asshole for asking my sister to replace the cream soda jelly beans her son ate.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Now, Margaret. Now, Margaret, you'll see there's an absence of cream soda flavor, jelly beans in there.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I guess, okay. There's a jar of jelly beans out there.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I have nieces and a nephew, and I'm like, if I leave a jar of jelly beans on a coffee table. I'm surprised if you don't eat them. I'd be kind of like, hey, man, I left those jelly beans out.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I can't help but judge this guy a little bit by how he's writing. He goes into the carbonara. which is completely unnecessary.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I know, but, oh, I'm hungry. He's talking himself up in this. And it's like, he's talking about, he's just like, I worked really hard on this condo and I have it. I'm like, none of this matters. You literally could just be like, hey, my family visited and my nephew ate a bunch of my jelly beans and I asked to replace it. There's something...
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
The way he's delivered it. The relationship is also an element, you know, a roommate taking your jelly beans is one thing. We know about roommates and beans, okay? And that's a different thing. But this is specifically a, if a seven-year-old is coming over to my place... Now, there's a lot of elements, because I think he's not talking about the kid being the problem.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He's saying he's mad at his sister for just being like, whatever.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I don't care. Yeah, and that's... There's obviously history there.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I agree with you, Spencer, where I'm like, how did you... No, no, no, specifically, I love you. I hate him. I love you, dude. I literally hate this guy. But I agree, like, how did he ask this with a straight face? Like, can you replace the cream soda jelly beans?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It sounds like he did, yeah. And I'm just like, I don't know. There's a... There's a lot of things that a seven-year-old could get into where it's like, hey, that was a problem, but you left candy on a coffee table and you're mad that the kid ate the candy.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It's super annoying. I understand that. I've seen that. Yeah, me too. It pisses me off, but I'm like... That kid hasn't been given boundaries, but that's how that kid operates.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
There's also the element that's really funny that they both operate the same way. And he's like, oh man, you took my favorite.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Oh, the Harry Potter one.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
See, my... The way... But I don't have... My nieces and nephew aren't like off the rails, right? I mean, they're going to grab candy if there's candy.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I would do the same thing. I'm the same exact way. When I visit my parents, they have a jar of M&M's. I'm going for it. And I can literally not help but just go over and grab it all the time. Like, that's...
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
My dad doesn't eat those M&Ms.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Everyone else. Okay, then. You think my father would eat those peanut M&Ms? You think my father eats the M&Ms? God, Jesus.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I can fuck up some cream soda teddy bears. I kind of agree with this first comment. Given the limits of this subreddit, you're the asshole. But really, really, you're just being petty. They're jelly beans. They aren't expensive, and they make more every day. And that's the great thing. The good news is, did you know that they make more? I keep eating them. They keep making more. American brother.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Buy some cream soda jelly beans and hide the jar whenever nephew comes over, which probably won't be often considering you're making a big deal about jelly beans. Congratulations on the condo, though.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Congratulations on your condo and your great carbonara, dude. Someone else said, you wrote, I keep a big jar of jelly beans on my coffee table as a treat. Well, that is exactly what happened. Your nephew discovered them and helped himself to a treat of the flavor he liked. I get your point, but you're being very precious about jelly beans.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I tend to agree with you regarding your nephew's behavior, but again, he didn't break or damage anything. He merely ate something which you left out as a treat. Your response is OTT to the point of you're the asshole. Over the top. Over the top. Lastly, someone said, unless you made the pasta yourself, I can't see how you spent hours on carbonara.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
People are just roasting him. This guy just seems like... There are people out there, and I... I almost feel like a lot of people have an aunt or an uncle like this, where it's like they're just super controlling of their space. And when you visit, it's like... It's like a museum, yeah. It's truly like, don't touch anything. Were we talking about this yesterday? No, never mind.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
And I just... And I get that, I get that, but it's also like, seven-year-olds haven't learned that there are people like that, where they need to really, especially a family member. But yeah, I agree with that take of like, this is ultimately just petty, and this is extremely silly.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Given the limits of this here subreddit.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
You are the asshole, but ultimately it's just petty. We do need to do like a southern theme now.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He's dead. Update! Update! He choked on a jelly bean.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Okay. I'll accept my verdict since apparently it is normal these days to allow a child to root through a jar of jelly beans like a hog. Like a truffle pin.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This guy is silly as hell. You're killing me. I'm sorry man, you're trying to say that this is crazy, like apparently it's normal these days to allow a child to root through a jar of jelly beans. I'm sorry, yeah, that is kind of normal to me.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Like a hog looking for truffles. Okay, I want to be clear, this update is long. This guy is updating his post about how his nephew ate his jelly beans. And he's actually angry, and he's actually serious here. I don't even care about the writer. I live for this shit. This is so silly. This is so good. Okay. Just this first sentence. I love you, man.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I'll accept my verdict since apparently it is normal these days to allow a child to root through a jar of jelly beans like a hog looking for trouble. Now, did or did the child not? What I won't accept, what I won't tolerate is the insults about my competency as a home chef. Give me a fucking break.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This guy is so silly Let me let me walk you through it so you understand while real carbonara takes time and while cutting corners would be a disgrace Okay, I got to read this normally because this is too insane First I went to this authentic Italian. He's really his update is about the carbonara. It's just about the pasta
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He shouldn't have made it because he clearly is building resentment as we speak first I went to this authentic Italian market with shelves stacked high with imported goods where the scent of cured meats fills the air They carry real pancetta flown in weekly and I spent ages with the owner Domenico
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
That was full on cat behavior there.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
who hand-picked the perfect wedge of Parmigiano-Reggiano for me, a rich, nutty block that was almost too beautiful to grate. Next, I stopped at this tiny family-owned shop that specializes in fresh farm eggs and produce. Carla, the owner, gets these eggs from a nearby farm, and each one is an intense, deep golden color, perfect for a creamy, rich sauce.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This is literally Patrick Bateman talking about anything. Finally, I swung by a salamaria for semolina flour. It sounds dramatic, but that's the lengths I go for traditional pasta. Where does he get his jelly beans from? Literally. I have a guy. The place feels like a rustic old world bakery with walls lined with wooden shelves and burlap sacks stacked high.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Their semolina flour has a texture and richness that just doesn't compare. Ideal for handmade pasta that holds up with the perfect al dente bite. So we did make the pasta. He did make the pasta from scratch. Back home, I crafted the pasta from scratch.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Flour piled on the counter, eggs nestled into a well, kneading it with care until the dough was soft and elastic, a process that took a solid 15 minutes of arm work. Then I let the dough rest before rolling it into long ribbons, each one dusted lightly with flour like fresh snow. Finally, I crisped the pancetta, grated the cheese by hand, and whisked the eggs to perfect consistency.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
The sauce had to be watched like a hawk, just enough heat to turn it creamy without scrambling, with careful additions of pasta water to reach that glossy silken texture. So yes, it took hours, and I'm not ashamed to say that. Okay, he honestly, he convinced me.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This dude convinced me, not the asshole.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I'm gonna go over to his house, I will have his carbonara, I'm gonna eat his jelly beans. I'm gonna fuck his couch. You're like, thanks so much. I'm sorry dude, I'm gonna fuck your couch. Jesus. Sorry dude, I'm gonna fuck your teddy bear. That's the thing I do.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Me too. I got to be honest, look, as annoying as I think this guy is, I kind of want to go over for carbonara.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It would be really funny if you guys were just shittier people, it would make for great content.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Handmade pasta is not easy to make, and to get it, it's rare. You ever see the Jackie Chan movie where he makes the homemade pasta?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
You've seen every Jackie Chan movie?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Who Am I is great. It's a little weird tidbit about me. He sings the theme song at the end. It's great. Legend of Drunken Master. Yeah.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
You've seen all his old ones too?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This next story's insane.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
That's it! He's telling us the process of his carbonara, and I gotta be honest, it sounds incredible. I'm not questioning his shelf skills. After this, I do wanna compare our favorite pasta places.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Not you. I gotta be honest.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Just us. Fine. He does sound like a great chef. Yeah.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
You have to be a bit like a dick. It sounds like the bear. It sounds like truly eating the beans. He's just like, what did you, did you eat that? You ate the beans? You ate the beans? We got 15 orders coming in and you're eating the fucking beans? And the nephew's just like, cousin, what's the fucking problem? Cousin! Cousin, come on! I like the cream soda ones.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
A gun goes off somehow and they're like, what the Our next story. My partner, a 28-year-old man, whispered, I hate you, when he thought I, a 37-year-old man, was asleep. Do you think he means it?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Okay. This is awesome. Me, 37 year old man, and my partner, 28 year old man, have been together for seven years. We've had arguments in the past and almost broke up more than once. The arguments have calmed down and gotten less frequent over the years. We had an argument today while making dinner.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I put the dry pasta in the pot before putting it in the boiling water from the kettle and this really got him angry. I was supposed to heat up the water in the pot and then put the pasta in. He stopped talking to me the rest of the evening. He went into a different room and I went to bed. At about 2 a.m.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
he came into the room and he thought I was sleeping and whispered, I hate you and walked back out. I tried to go talk to him at around 2.30 a.m. but he is not responding to me, just sitting on his iPad. He may be calmed down by tomorrow. What are your thoughts on this?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
You guys are in chairs for reasons we cannot tell you. I got too silly with it. Spencer got too silly with it. The couch will be back next week. Mom and dad needed to be separated a little bit. I was humping the couch.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
And that's fair. That feels way healthier.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
That's really good. Comments on this. Naughty husbands get the sad jam.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It is really funny. Just him standing in the doorway just... and then leaving. The fact that he came into the room, whispered it, and then left.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I would not care. This does not sound healthy. No.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Dude, the comments. I'm pretty sure he means he hates you. Someone said he definitely means it. Time to exit stage left. Lastly, someone said, yes, he absolutely means it. That's fucking creepy and scary. Time to take your incorrectly cooked pasta and leave. That's fucking creepy and silly. That's extremely silly, dude.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It's also like, yeah, they were 20 when they started dating him, and they've been dating for seven years. So the younger person, the 28-year-old, has probably not had opportunities to date other people.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
The 28-year-old whispered that to him. But did they say, I love you? I don't know. It just doesn't sound healthy. It sounds like it's time to go to sleep.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I bet they didn't eat it.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I love how pasta has come up twice now. Are these silly stories or pasta stories?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Spaghetti is the silliest food.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Someone else said, this reminds me of something I occasionally do when my kids are being stinkers. I make their sandwiches with end pieces that are all crust.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
No, they both died. They're dead. That was recent.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yeah. Okay. Last story, am I the asshole for not believing my boyfriend that suddenly became gay due to the altitude difference when he was on a work trip in Utah?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I think I, did I find this story and send it to you guys? I think. I think you might have. So I discovered this story, and by the title alone, I was like... This is the funniest shit I've ever read in my life. We gotta read this. This is fucking awesome.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yes. That the altitude made him... He suddenly became gay because of the altitude. In Utah? In Utah. It's high altitude.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This is like me when it's a full moon. Yeah. I become gay. I am become gay. I can hardly believe that I am writing this or that it happened, but I am and it did, so here we go. I, a 28 year old woman, have been with my boyfriend, a 29 year old man, for three years. Every now and then he has to go to Utah for a few days because his team has a customer service branch that operates out there.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I got a text from one of his coworkers who has become a friend of ours, and it said that on the trip, my boyfriend cheated on me with some guy on the customer care team. I did not believe it at first, because first of all, my boyfriend has always identified as straight. And second of all, I just couldn't believe it.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
When he got home, I asked him about it, basically expecting him to confirm it was nonsense. Instead, he got real quiet and had us sit down and said he had to tell me something. He said it was true. He did have a one-night stand with a guy. I couldn't believe it. I asked him if he was telling me he was gay or bisexual, and regardless, cheating is cheating.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He insisted he was not gay at all, but the strangest thing happened. He said that when he was at dinner with his Utah coworkers, he suddenly became gay. I was like, what, what the fuck? He said he thinks it was due to the altitude. I was like, you're fucking with me, right? But he said after he had done it with this guy, he got really confused as to how all of a sudden he was gay.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He said that higher altitudes can have an impact on how people think and on their emotions, and he thinks that the high altitude made him gay temporarily. He said that as soon as he landed back home, he was back to being straight. I was like, did he get drugged or something? But he said that was not possible.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
They were always in a group at dinner, which is when he became gay and was only alone with the guy afterwards. He said he had done a lot of thinking on the drive back from the airport and he confirmed within himself that he is straight.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yep, I'm straight. and that his only conclusion could be that he was temporarily turned gay due to the altitude. I was like, whatever, I guess we are breaking up. He looked at me confused. I was like, gay or not, you did cheat on me.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He said it wasn't his fault and that human actions are just a byproduct of accidental brain chemistry and that his chemistry had been altered through no fault of his own due to the higher altitudes of Utah. He said he couldn't believe I would blame him for something medical and scientific that was out of his control. He really looked bewildered that I was angry about this.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I don't know, maybe he's convincing and I'm a rube, which is a country term. A country bumpkin is what... A rube. But I am starting to wonder if I am overreacting. Like, I know it sounds insane, but is it possible to accidentally change your sexual orientation due to emotional changes brought on by altitude? Is that possible? And if it is, am I overreacting?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Should I throw away a three year relationship for this? He's acting like I'm being rude and weird. I'm confused.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
We're changing the narrative. Lastly, someone says, my barista friend said when a customer is rude, she makes their latte with decaf espresso. It's her way to get a little dig in. That's DV.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Well, everyone's gay on an airplane.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yeah. Guys, maybe it was the fries that they were eating.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Everyone at a certain altitude is gay. We don't know. We're at sea level. I'm straight here.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Whenever I'm dunking, I'm gay.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
But I believe... We're being silly, but come on. I think everyone's really wrapped up on the aspect of the altitude turning him gay. She's right. He cheated. It doesn't matter. Oh. And he's trying to play it all also as if... he should be able to get away with that.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He's trying to say the altitude made him cheat, too. Because he's like, oh, the brain chemistry, it's all a byproduct or whatever.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He was on a work trip and cheated on her. A thing so many people seem to do.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
And he's trying to play it off. He's coming up with an insane excuse.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
The verdict is not the asshole.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Comments, been to Utah a ton. Haven't felt the slightest change in sexuality. You realize that he's feeding you a crock of shit, right? Okay, just wanted to be sure everyone was on the same page. Now to deal with the aliens and their brainwaves beamed into my eyeballs.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Someone else said, even if it were possible, and it's not, he's telling you that he can't help but cheat on you because human actions are just a byproduct of accidental brain chemistry. Even if he's not into dudes anymore, there's plenty of girls he can cheat with because, by his own admission, he can't control himself when he's attracted to someone, not the asshole.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Lastly, someone said, by that logic, anyone flying in a plane becomes gay for the duration of the flight.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Okay, we have a sort of update. It's in the comments. OP posted a big update in the comments. Someone commented, temporary altitude gayness happens all the time. OP responded, I don't know, I have read a lot of comments, almost all of them, and it turns out there is in general a consensus that it is not true. I knew it the entire time in my head, I just let my heart give me doubts.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I think my favorite moment where I feel like I kind of got to punish the audience. I don't know if punish is the right word, but just get to slap in the face kind of was Smosh Mouth where it appears and it's Angela in the Lime shirt. That was.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I know I sound absurd in my post questioning if it was really possible, yet I couldn't bring myself to accept it, now I do. I met my boyfriend just this afternoon. He acted like nothing was abnormal. I told him it was over. He acted like I thought he was joking. I said, come on, he cheated on me. He said he couldn't believe I was blaming him for it. It was the altitude, he kept saying it.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Like seriously, he said it like 15 times in a row. He was insistent. I told him it didn't matter if the altitude made him gay. He still had a choice to not cheat on me. He accused me of being a bigot. I said, it's over. That's a good pivot. Smart move there. He has texted me many times claiming that he was only temporarily and unwillingly gay due to the altitude.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
He is sticking to this story and to the end. Well, I'm going to block him and that's that.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Is anyone else getting frustrated with the fact that he keeps bringing up the gay part and that's not what she's talking about?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
She's like, no, you cheated on me. you cheated on me. He's like, I can't help that the altitude made me gay. It's like, I don't care about that. He's trying to absolve himself of guilt and keep the focus on the whole gay aspect of it as opposed to the cheating aspect.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
It's bound the scope of the subreddit.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I don't think he's focused on the cheating part because I think he's trying to convince himself. Yeah. Yeah. I think he's clearly saying it out loud to convince himself of a thing. That's what he cares about. She doesn't give a shit. She's like, I'm mad you cheated on me. But, and then he keeps bringing it back to, well, I'm not gay. She's like, okay. I didn't say you. I'm not gay. Wow. Silly.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yeah, man. All of Smosh will go to Utah, and we're all going to become straight.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
That's fucking crazy. Oh, my God.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This has been extremely silly. This has been so silly. I don't know what was silliest, from whispering I hate you in the middle of the night.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
To jelly beans, to teddy bears that people fuck. To...
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Let me be clear. All of these stories were silly, but they were all also very serious.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Imagine him in the middle of the night hearing Teddy go, I hate you.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
this was silly? Thank you guys for both being here and joining me for this journey. And thank you for watching. There was a lot to process here. I'll gather my thoughts on them over the next two years. Comment down below what other themes and subreddits you want to see because Silly was a crazy one. Silly! So I can only imagine what other kinds we're going to have. And we will see you next week.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
We laughed so hard. It was really great. Okay, our next story. Our next silly story. Silly.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
That was really silly.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
So we've already got hate sandwiches. Am I the asshole for not knowing a candle wasn't supposed to be lit? Parenthesis, it had wicks.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
John Wick. Yeah, pretty cool. I wouldn't actually own those though.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I went to the bathroom last night and it was stinky. So... What happened?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Dude, my little stinkers. So I dropped some stinkers. So being the considerate boyfriend I am, I lit the candle my girlfriend left on top of the toilet, and then we went to walk the dogs. The candle looked like most scented candles I've seen. Round glass, tan colored wax inside. Just cry me a candle. Well, it had the... Yeah. Round glass, tan-colored wax inside, smelled good, had fucking wicks.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
We get back. Smoke alarm is going off. House is cloudy, but no worse than burning food in the oven. Smoke's worse in the bathroom, so I blow out the candle, and she tells me, you're not supposed to light that candle. What the fuck? Why would it have wicks? Why would she put it on top of the toilet? To me, it's like having a doormat you're not supposed to step on in front of your door.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Do most guys know about this? She seems mad at me, but I told her it's crazy to do that. Am I the asshole? This is new to me. I don't know what this candle is, but I do. I am someone. I never leave a candle lit when I'm not in the house.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
You blow out all the candles before you leave.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
That's a recipe for disaster.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Discussion of leaving an open flame in the house is one thing. She's mad at him for lighting this specific candle, which he was like, this candle looks like it was supposed to be lit. She's mad at him for lighting that when it's like, oh, this isn't meant to be lit because it just gave off a bunch of smoke.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I think his reaction is bad. It's strong. He needs to be like, oh, I fucked up.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I kind of agree. A little silly that there's these. So the verdict was you're the asshole. Comments, dude, never leave a candle lit in a room you're not staying in, but especially not when you're leaving the house. Your girlfriend might have wanted the candle because it was pretty, and you can pick it up to smell it.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yes, I can see why you thought it could be lit, but that takes a backseat to lighting it and then leaving the house. You're the asshole. It was stinky. Someone else said, you're the asshole. All candles have wicks, even the decorative ones. But more importantly, all candles that are meant to be burned need to have the wick trimmed first.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
If you don't trim the wick, then the candle is a fire danger. Did you trim the wicks? I bet not. You also never leave a burning candle unattended. Don't ever light a candle in the bathroom and leave the bathroom. I didn't realize this was our candle, bro. Yeah, my goodness. Jesus Christ, bro. God.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yeah, I don't understand that. I love candles, but I get candles that are meant to be lit.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Because it's clearly a candle that's, it's a decorative, it's kind of a decorative candle. And also, if it's a candle that the wick needs to be trimmed, but most candles I get already have that done.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Lastly, someone said, you're the asshole. One, you don't leave a lit flame when you aren't in the house. You screwed up just by doing that. Two, not all candles are meant to be lit. Some are just for decoration. Three, all you needed to do was ask if it was okay to light the candle. Why? But then she would know it was stinky.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I am super unfamiliar with the idea of a candle that looks and has wax but isn't meant to be lit. Especially placed in a place like the bathroom. And there must have been matches or maybe he had a lighter. Maybe he smokes and he had a lighter on. But I... Yeah, or maybe the wick wasn't trimmed, I guess. This is so silly. I wanna hear Keanu's take on this story.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yeah, the only thing that I will flame him for, silly, is I don't light candles then leave the house. I don't. I don't. I wonder how long they've been dating. How long has he seen this candle there? He's always been thinking about it. He's like, I gotta light that thing.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Sorry. So Kiana picked all these stories.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yeah, it must've been bad. Must've been stinky. All right, update. Oh, how, why, why is there an update? Crazy story, I have an update. I'll never read more, please. Okay. It is a fucking candle. Like, candle, candle. I've been at work all night, but I got home and just looked at the bottom. Instructions say trim wick to a quarter inch before lighting. I did not do this.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Being the apparent caveman, I see candle, I light candle. She's asleep so I can't rub it in her face after she said that candle isn't supposed to be lit. They're not meant for that. But this is all I need. Am I the asshole for leaving it lit for a quick piss walk before bed with her and the dogs? Yes. Am I an asshole for thinking this stupid thing was in fact a candle? No.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
The cutting the wick thing was ignorant for not thinking the protective lid that usually comes with a plastic peel around it would have prevented someone from lighting it. Otherwise, they probably should make the damn things ready to go. Here's a lesson to anyone out there about to light a candle. Apparently, they have instructions.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
They're going to be fun. These are going to be some extra silly stories. I don't really know what... what Kiana's definition of silly is, but we're gonna find out.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I now know she was wrong, and we never got into a major fight, so I will humbly and in the least petty way just leave the candle upside down next to the sink so when she wakes up first to brush her teeth, she can know that this candle was in fact meant to be lit, and that I was right. Yeah, that'll work. That'll work, bro. It's going to go great.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I can't add links or pics here, but it's called Mermaid Shimmer from At Home. I may be dumb, but I can hang my hat up knowing I had every right to light it. Good night to all, and have a pleasant tomorrow. I gotta be honest, you're the asshole for just how you wrote that, man.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Well, you're not supposed to light it. Don't. Yes, you are. We were trying to be empathetic to this guy, but the way he wrote that update just solidified that he is such... He's like, good night to all. Good night and have a pleasant tomorrow. I'm like, go fuck yourself.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I hope you catch on fire.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I thought it was kind of funny.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I will say, I don't know how common of knowledge the trimming of the wicks is. I did buy a wick trimmer after, you know what?
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I've never trimmed a wick on a...
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Oh, I have one at home.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Okay, here we go. Moving on from that silly one.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
This next one comes from True Off My Chest. Opened RedTube, parenthesis pornography, on work laptop. Received invite to meeting with management the next day.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
Yeah, with the right packaging. With the right packaging. We're about to read the most messed up story we've ever heard, and Kiana's gonna be like, wasn't that silly? Yeah.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I was so stressed. I just have to let this out somewhere. At some point I logged into my Gmail on my work laptop and all of my Chrome bookmarks were imported. I enjoy wholesome amateur pornography created by real couples where you can tell they actually love each other and are enjoying themselves.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
At some point, I bookmarked... I just don't know why that's so funny. I only like porn where I can tell they love each other. At some point, I bookmarked a red tube link with a title like Super Real and Authentic. On Monday, I was attempting to find a public records link for work with a similar name, like supervisor, but clicked on that link and suddenly saw a red tube on my work laptop.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I screamed out loud. I deleted the bookmark and my browsing history. The next day, I got a Teams invite for a meeting with management for Thursday, today. We had the meeting today. It was an annual performance review, and I did fine. There were no issues. If the IT guys saw that, they did not rat me out. I haven't been this relieved since the moment I gave birth.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I like her saying that she screamed out loud, just like she's on her laptop, and just gets pulled up, and she just goes... I feel like this is a lesson in keeping your personal stuff and work stuff separate. That can't accidentally happen.
Smosh Reads Reddit Stories
A Bad Case Of The Sillies | Reading Reddit Stories
I don't know, man. I think my brain is too broken. Well, let's hop into these. Okay. Okay, this first story comes from True Off My Chest. I gaslight my husband when we fight.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Hello, and welcome to Reddit Stories. I'm Shane, and today's theme is all about some wild dating stories. And I am joined by two people who I think have had wild dating lives, Tommy and Chance. Woo!
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It was so fast, I hadn't seen exactly what he did. People were saying things like holy shit and oh my god. One guy said he took my ice cream. And that's when I realized what happened. He fucking stole this guy's ice cream on a busy street. I was absolutely shocked and mortified. Everyone around us had seen it or else quickly got told about it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
They were staring and pointing down the street where he was still running. I couldn't believe what I was seeing. I apologized repeatedly to the man whose ice cream he grabbed, then said I was going to go find him and got myself out of there, utterly humiliating. Well, he nearly made it back to the house in that time. Wait, what, what, what?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He scrambled when he heard me coming, dripping ice cream everywhere. What? Looked like a deer in headlights. He literally left the cup on the stairs and ran away from me up to our apartment. But I had the key, but I had the key, so he was just standing there when I got there. I, of course, demanded an explanation. He had the balls to deny he'd done anything. No. What the fuck?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I used to love going with him, but the thrill of it wore off and I found myself sick of traveling so much. Because of this, we grew apart, but still keep in contact occasionally because despite the fact our marriage didn't work, he is a really cool, nice person. Two weeks ago, I met a guy through a friend that I immediately hit it off with. We have been on three dates so far.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
After I let us inside, I kept asking what makes him think that's okay to do. He then changed the story again. This time he said he doesn't know why he did it. It was just an urge. I didn't even know what to say, so I told him I needed some time to myself. I'm seriously disturbed. He's got no good reason. This is completely out of character for him.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He's always very mild, reserved, and treats people, especially me, very kindly. He's the last person I thought would do something like this. What do I do next to figure out what the fuck that was about? How can I even know he's being honest?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
This is something I think about a lot about how quickly you can just ruin your own life. About how just anyone walking on the street, I'm just like, I can just grab that guy's ice cream and run. And just eat it somewhere. You can do something just unpredictable.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's something you could do. Art galleries are a crazy place to be, where you're just face-to-face with a Picasso, and you're just like, I could fuck that up right now. I just lick it. Like, what? And what now? And what are you going to do? And what are you going to do? We're going to arrest you. You're under arrest. Okay. What are you going to do about it? Get your hand down.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It sounds like this is... You know how people joke a lot about, I let the intrusive thoughts win, and I got a donut. It's like, that's not an intrusive thought. We all want a donut all the time. But this sounds like an intrusive thought one.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah, you're right. He left her behind. He denies it once she finds him.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
The first two dates were drinks after work. He showed up in nice khakis and a button down both times. On our latest date, I went to his house to watch a movie. Literally watch a movie. We are taking the physical stuff slow, lol. He has a nice house, so I asked for a tour. After he showed me the upstairs, he said he had to show me his game room.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I don't think it was the YouTube prank, my only possible thought, There's two possibilities. One, this is a fake story. Two. What do you mean? That what's being written is fake. Like on Reddit.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah. I mean, look. Period. We, for fun, always take everything as just like, okay, what if this is real? But in this case, I'm like, this is really out there. Yeah. But. People do stuff like this. I'm not saying it doesn't happen. This could happen. This very easily could happen. And if it did happen, and a friend was telling me this, I'd be like, I don't think it's the YouTube prank.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
That was his second explanation. His first was deny. His second was that. The deny was weird. His final one was like, was his final one was he doesn't even know why he did it? Yeah. Yeah, it was just an urge. That's probably what I believe. I believe that 100%. I just think he just was like, he did it, and once he did it, he had to commit 100%.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Lastly, a note was written down by Bailey. It's also unsanitary, he doesn't know. Like he grabbed someone at random person's ice cream. This was bad in every possible category. Comments, I would honestly ask him if he's okay, both financially and mentally. Try not to attack him or make it sound like an accusation. Someone else said, how long have you been together?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Either this behavior is new and something has gone wrong with him or you need to put more effort into getting to know your partners. Also, check your CO level sensors. Someone else said, are you sure your boyfriend isn't a raccoon? Right. Right. That's what I said. update, which we desperately need. So I finally got the explanation from him yesterday.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Turns out he was in a Discord server chat where the members all dare each other to humiliate themselves by doing outlandish things in public they'd never normally do. He told me he's left the group because the experience was really stressful to him, not exciting like he thought when he joined. It was the first time he'd taken one of the dares.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He said that afterwards he just didn't know what to say and couldn't believe he'd actually done it. He was extremely apologetic for acting like a lunatic, causing me to worry about him. We had a long talk about it last night. I genuinely believe he regrets it. He knows what a stupid fuck up it was. Not much else to say really. Just wanted to come back now that I got the answers.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Thank you to everyone who tried to make sense of the original post and who gave me advice for talking with him. I guess I believe that. But it's like it wasn't filmed. You could just say you did it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay, so he gets dared by a Discord server, which they literally don't see if he does this or not. He could have lied. Yeah. He could have just fully played it out in his head. But he wanted to experience it. He wanted to experience it. But then he also didn't have to actually eat the ice cream, but he did. I think once it started, he just like blacked out and just did it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We went down into a fully furnished basement with a pool table, a mini bar, and darts. Okay. But there was something very weird down there also. Apparently my new man is really into metal music. Would never have guessed based on how he dresses. And his favorite artist of all time is, you guessed it, my ex-husband.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
The rush had to have been, frankly, awesome. Yeah. Yeah. No, it probably was sick as hell. This is, this is, this is. It's just. I can't believe this. But peer pressure. I feel so bad for her. The guy is 29. Boys will be boys. I'm like, okay, I understand peer, I understood peer pressure at a certain point in my life. I'm like. Yeah, 29. I'm not feeling peer pressure like that anymore.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'm not doing that. He wanted to do it. He wanted to do it. It seems like he thought it would feel different. This is a childhood dream. Yeah. Yes. And he finally made it come true. Proud of him. I'm not, I'm not either.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And what did he expect was gonna happen? It was a really shitty thing to do to her. He stole an ice cream and ran away and left her with a crowd of people. That is insane. That could have gone horribly for her.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I think this should be a deal breaker for her. Oh, absolutely! Without question! Like, even though he's sorry, I'm just like, no, that was so disrespectful of him to do to you. And it's like, what other dares or crazy things are gonna happen? But he says he's done, says he's done, but he still was able to do that to her.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
There's a whole lot of levels to, there's a lot of red flags. There's probably red flags I'm not even catching in the story. I don't love this. I don't love how easily she forgave him for such extreme behavior.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
No, shame. I just want to come back to that. No. She's like, I genuinely believe he regrets it. He knows what a stupid fuck up it was. I'm like. Okay, like, all right. When you love somebody. Anyways, moving on. This is a 35-year-old man. My mother, 58, my mother's new fiance wants me to call him dad. He's 24. How do I navigate this? Wait, the mother's fiance is 24?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
This is a 35-year-old man who wrote this. OP is 35. My mother, who's 58, her new fiance wants me to call him dad, but he's 24. How do I navigate this?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She's engaged to a 24-year-old, and that 24-year-old wants him to call him dad. Yeah, right. Yeah, fucking right. You know, age gaps are such an interesting thing to me, but especially when people have kids who are younger than their partner. I'm like, how do you, how? Like, come, no, you have to see this. You gotta know what's going on, yeah. Please buckle in because this is all so weird.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'm a 35-year-old man, and for some backstory, my dad died when I was 19, leaving my mom with me and my two siblings. I'm the oldest. It took some time, but eventually my mom started dating again.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We don't live together per se, but our house is back onto each other and have a gate, so it's pretty common for her to offer to do my laundry or me to just go over for dinner or go look after our dog, that kind of stuff. Plus, me and my siblings go over there for dinner every other Friday night or so. Again, me and my siblings are fine with this because it's her life and we trust him.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He had framed posters of all my ex's bands, autographed signature guitars, and every record he has ever released were framed on the walls. He even had magazine articles about him and some of his bands framed. Every wall in his game room was covered with my ex's face and his signature guitars. So I may have messed up here, but I kept my mouth shut and didn't say anything.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He's a nice guy and they clearly love each other, but anyway. So long and short is, this weekend, her fiance, let's call him Phil, calls me and asks me if I could come over. I say, yeah, sure. I'll be over after work, and I assumed he just needed help with some DIY stuff they're doing. When I get over there, he calls me sport and says we need to talk.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I should mention this is something he does to me and my little brother, calling us things like kid, sport, scout, little buddy, or my personal favorite, calling us red and blue seemingly out of nowhere. My brother is 30, by the way. He tried it with my little sister, 28, too, once, and called her princess once, but he stopped when she just stared at him. Okay, I'll wait.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
The thing with Phil is that he reminds me a lot of Charlie Day's character in Horrible Bosses, in that his sole ambition has always been to meet a girl, get married, and have a family. When he told me and my brother this, my brother made some joke about how maybe our mom's going to come up short on the last part, and he got very upset, but they made up after.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Anyway, so I go around and ask if my mom's around, and he says no, it's just him, and that we really need to talk man to man.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I say sure, and he starts talking about how he's always wanted to be a father, et cetera, and raise a son to call his own, and then he drops this bombshell by saying, now I know I can never replace your father, the man who made you, but it would mean the world to me if you would call me dad.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'll admit it, I snickered a little and then I knew he was serious because he looked like he was about to cry and he didn't drop it either. I asked if he really meant it and he got really emotional and started talking about what it means to be a man and how his purpose is to have and provide for a family and he wants me and my siblings to be a part of that family.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Like he reiterated he'll never replace my father and this did rub me the wrong way a bit but he's ready to step up and be my dad and provide and protect for me and my siblings. I just sat there thinking, dude, I'm a decade older than you and live in a separate house.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I don't need providing for, and even if I did, I don't think a guy a third of my age who works part-time at the hardware store and is into collecting manga is the man to do it. No offense if you are into that, LOL. Just, I don't know, I was a bit taken aback. I was in shock, so I just said, okay.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And he gets emotional again, but in a happy way, talking about how he wants to go camping or go to a baseball game. I don't even like baseball, LMAO. And how he joined the Lions this year and how he wants to bring me into it too as his boy, which just feels so surreal. Even more so as I'm a Shriner, so all this talk of service and charity isn't the brag he thinks it is.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Because again, I'm 10 years older than this guy. Well I ended it by just saying, this has gotten a bit too weird and I was going home. He got very upset and I left, called my brother and he agrees it sounds weird as fuck. Later my mom called me and she wasn't disappointed but admitted it's made him very upset and depressed. I told her that if he's embarrassed, he doesn't need to be.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I get he's excited about the marriage and we can just laugh this off as a funny story. She then said that wasn't what he was upset about. He, and she too a bit, is upset about the fact that he poured his heart out and I rejected him. She said, yeah, it is a bit kooky, but this is how he proves himself he's a man.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He knows I'm divorced, but he definitely doesn't know it's from his idol. Girl. We are seeing each other tonight for our fourth date and I know I need to tell him, but how? I really like this guy, but I'm afraid if I tell him he will freak out and run. What should I say? Where should I tell him? I just don't wanna damage our relationship because I can really see it becoming long term.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And I guess I was a bit angry and said something like, first off, it's not my job to certify what's between his legs, and second, this doesn't prove he's a man. It just proves he's a nut job. I apologized immediately, but she said she didn't want to hear it and hung up.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She called back 10 minutes later and we apologized and she begged me to just go along with it until he has some kids to call his own. I won't go too much into the details here, but she sort of let slip they plan to try IVF treatment because she's not ready to give up on being a mom just yet. And while I have my own thoughts about whether or not that's a good idea, I'm not here to litigate on that.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We finished up fine, and I reiterated I'd support her, and she agreed that it was definitely a stressful situation for me, but begged me to at least think about it, which leads me here. I did think it over, and obviously I'm going to say no. I had a dad, and he died. Rest in peace, dad. And that's the only dad I've ever needed, I've ever wanted, and I'll ever bestow that title on.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'm not asking if someone's unreasonable or what I should do, more so what I should say. This clearly means a lot to him for some reason and I deeply love my mom, so I want to try and minimize the damage, especially as we're still so involved in each other's lives and they live behind me.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
How can I make it clear to them, as painlessly as possible, that I think this is weird and borderline offensive? I really don't want to rip the bandaid off because I fear what it might do to the family. Whoa. This is wild. Okay, I like how the mom almost kind of admits that she's dating a boy. A boy? Like truly. Because she's like, he's trying to prove that he's a man. I'm like, you're 58.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
You should be dating someone who's been a man for a long time. It's like describing him and describing how he's thinking is like you're admitting he's way too immature. You're admitting it, you recognize it. So you recognize the power imbalance here. Like this is not okay. I can be his mom and his... Why? Yeah, exactly.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And especially, she's putting her children in such a weird position here. And defending him to them. Yeah, like, defending him while also admitting that it's like, hey, I understand that this is a lot.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And everyone applauded. And everyone applauded. I'll say this too, they're engaged, right? This man is engaged to their mom. I think this would be an inappropriate conversation even if he was 60 years old. Absolutely. It's like, no, you're an adult. You're a 35-year-old man. Your father died when you were already an adult. What he said is true. It's like, he does not need another father.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He had a father. You don't get to do that. That's not the case.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah, exactly. This is a very unique situation. Yeah. This is extremely unique. 24 is so young. It's so young. Well, and it's adding his behavior to it, too. Yeah. He can't rent a car. That's exactly correct. He cannot. I'm sorry, man. You're not ready to be a father to a 35-year-old. No. A 24 year old might be ready to be a father for a two year old.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I know I should have told him at his house, but honestly I was in shock. Does anybody know how to approach this?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Being a father to a 35 year old is a whole new ballpark. You don't even know what it's like to be 35. You won't for 11 years. You don't get to tell him how to live his life when you aren't ready for that either. This is unfortunately extremely funny. Extremely funny. Comments, I wonder if he grew up without a dad.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He's giving a weird 1950s energy to this whole thing that feels like he only knows what dad's from seeing them on the television. OP said, oh no, his dad's still alive. Both his parents are, I've met them. They definitely feel odd about the whole situation, but go along with it for his sake.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Someone else said, such a crazy situation, I think you should talk with your mom and maybe hang out with her fiance, but as bros, not some weird dad situation. OP said, I have offered this, but every time me and my brother do, he definitely tries to act like the man of the group, or sets us up for more explicit father-son activities, or just talks about how desperate he is to be a father.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
A personal favorite was a time when he got his phone out and started reading some pearls of wisdom he'd obviously found online.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I finally collected everything.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'm just picturing like, I've always wanted to be a father. It should be said, this guy, in a way, this 24-year-old guy is doing nothing wrong, because he's clearly insecure. He's in a weird situation. where if I was in his situation, I would have no idea how to act or think. This is a really weird place to be and he's trying to solve it in a way that is not the way to solve it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
If he's a big fan.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's gotta be uncomfortable for him. I don't know what to think. I've never encountered a situation like this. I've never heard of anything like this before. So let's see what happens next because we have an update. So I told both my siblings and we agreed we'd collectively put our foot down with Phil at our next family dinner next. They're gonna kill him.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Especially after an incident where Phil referred to my brother as sport and asked if he wanted to go see a baseball game with him. I do love how it's like 1950s with this guy. Yeah, it's also like, are you paying for the tickets?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I like to think that the 35-year-old there is standing there, but still the 24-year-old insists on getting down on one knee, being like, hey champ, and he's just talking right at his crotch. He's like, come on. Okay. Admittedly, I was a bit spurred on by what you all said and got involved, pinging him back with, no tickets for me, Daddy.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And my brother responded with, Daddy wants me all to himself, hmm, hot. And Phil took a few minutes to respond before saying he was shocked, speechless, and disgusted. Hell yeah, I love this approach. He then messaged me in private to say he was utterly appalled and that he'd never disrespect his own father the way you boys did. I kind of lost it at this point and said right.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
That's because you're not my father, Phil. You're a 24 year old man child dating my mother. You have no right to my respect, especially not to the respect a father gets. I immediately said sorry, but then blocked his number and left the group chat. Apparently he sent a similar thing to my brother who responded with more daddy stuff and Phil blocked him.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Well, that aside, I don't think that family dinner is going ahead. After the original post blew up, it seems someone from his Lions Club found it and reported it to their chair or whatever, and Phil has either been expelled or resigned or in the process of one of the two.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He has removed nearly all mentions of the Lions from his social media and no longer mentions being a member with his last post on it being some cryptic goodbye post where he kind of drones on about what it means to be a man in the modern day and the duty of fatherhood bestowed on all men at birth. Really weird shit.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
My mom called me half in a panic, half in rage after about the stuff I'd been telling about him before breaking down and saying we need to meet, which we did and got my brother to go over to. I know Phil has temporarily moved back in with his parents in the next town over, but from my understanding, they still want to go ahead with the wedding.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
But I think that's more so because they've already spent money on it. I have no idea what's happened with Phil or what's going to happen with him, but I did make it clear to my mom that he is not my dad, he's not even my stepdad, I'm not a kid, and he's never going to be either one outside of legal fuckery.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She relented pretty quickly, I think she's finally broken out of her shell at least, and we've agreed that if things go ahead, that it's going to be a huge red line, though I don't know if he'll want to be friends with me after all this LMAO. Anyway, thanks for the help on the original post, y'all. I just, I just can't believe, I don't know, it's, it's...
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
this is wild to me, that his parents aren't like, hey, stop. Stop this. This is silly. I feel bad, because the amount of delusion this guy is in. He is living in some sort of. I feel bad for the mom, too, kind of. I feel bad for kind of everyone. Everybody. The situation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay, update number two.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Bit of an update as I can't respond to everybody but I think the marriage is off. Phil has gone AWOL again and has had a huge argument with his family as they've demanded he call off the wedding and date people his own age. This apparently made him snap.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Me and my mom have met his mom and older brother who said Phil is very insecure around girls his own age and has never been able to talk to them, hence his preference. Oh, okay. I think we have enough. to say this should stop. I think we have enough. I don't even know if this guy is acting like a 24 year old. He's acting younger than that. Wow. Down with Phil. Down with Phil.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'll give it a nine. I'll give it a nine as well. Nine's fair. We need to always leave room for it to get crazier.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Him, like, being, like, someone talks to him at the game, just like, I'm here with my dad, and it's just like a 24-year-old, just like, hey, I'm here with my son right here. All right, moving on. Okay, this next story comes from Our Relationships. This is a 31-year-old man writing, my wife, who's 28, wants... My wife. I'm sorry. I'm sorry. I'm sorry.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It was worth it. It was really worth it. You get one. Sorry.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
My wife, who's 28... My wife...
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I won't do it again, I swear, I swear. My wife, who's 28, wants a divorce because I live an entirely different reality with my first love, who's 29, in my dreams. Okay, so my wife wants a divorce because I live an entirely different reality with my first love, a 29 year old woman, in my dreams. No, what, no. What do you mean in your dreams? Like when you're asleep?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He's there just like, yeah, I'm such a huge fan of him. He must be so awesome to have sex with. Yeah. I wonder if he's a really good husband. Okay, comments. I find it really hard to believe that he has a shrine of your ex-husband to the level you're describing, but doesn't know who you are. Maybe I'm jaded, but it seems too coincidental and potentially unsafe for you.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I guess when he's asleep he lives a different life with his first love.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Night wife. Night wife. This sounds like a romance novel. It would be called Night Wife. Wow. Dream wife. Dream wife. Okay, I, a 31-year-old man, have been with my wife for three years. We had a short engagement, married quickly, and have a perfectly ordinary existence. I love her, she loves me. We do taxes, housework, watch movies, all the normal things.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
No physical cheating on either side as far as I know. But here's the thing. I am a lucid dreamer, which means I can, to an extent, control my dreams, which is something I find cool as it allows me to go on adventures while asleep. It also makes scary dreams not so bad because I can just wake myself out of them.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Over the last year or so, I've been having a recurring dream about my ex, my first love, a 29-year-old woman. Truth be told, I never got over her. Okay, what? I just feel like you're admitting a thing there. Is she still alive? We'll find out. Truth be told, I never got over her. We were together for five years from 2015 to 2020.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We broke up after I graduated from college because she didn't want to move from New York to South Carolina with me, which is where the biggest industry for my field is. I was crushed, but moved on and we've spoken sporadically over the years, although we never crossed any lines. I will admit that I've kept up with her on social media a bit, but nothing stalkerish.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Well, a year ago, she announced she was getting married, and I experienced a resurgence of feelings for her, although I never acted on them or told her. That same night, I dreamt about her for the first time in years. In the dream, she showed up at my door and asked me if I wanted to get coffee. I said yes, of course. The dream, which was not a lucid dream, ended there. It felt so real.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I couldn't shake the feeling once I woke up. It felt like we were actually reconnecting. Since then, I've dreamt about her several times a week and I've practiced becoming lucid, so I've been able to control the outcome more times than not. We've lived a whole life together over the past year. Everything from dates to a trip to Paris together, which we visited while in college.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We even re-walked the same paths we did in real life. It got to the point I was looking forward to going to sleep to be with her. Fast forward to today, my wife told me she felt distant from me. And I started to feel guilty because I thought what I was doing was harmless, but she's obviously noticed a change in me. So I confessed about all of it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
At first she thought that I was joking, but when she realized I was serious, she accused me of cheating on her and told her mom and sisters who were calling me a cheating weirdo. She even threatened to tell my ex so she'll know what a fucking loser I am. Now I get that it's not anything a woman would want to hear, but it's not like I physically cheated.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's a good roller coaster right there. Thank you. So these stories apparently pretty wild.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I don't want to lose my wife, but I don't think she can forgive me for this. What a woman would want to hear?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah. He admits in the story, I never got over her. Right. Yeah. Oh, in writing. You put that down in writing. You wrote, I am not over her. Right. That's a deal breaker. There we go. That is a deal breaker for most people. And he's making the conscious choice to fantasize about this and make, he's like, I'm going to practice lucid dreaming so that I can spend time with her.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And this all spurned on once he saw that she was getting married and he's like, oh, this resurgence of feelings. I'm like, oh, I can't get her anymore. I'm like, there's a lot. here that I think is a problem.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I think you can absolutely, dating, like if you're talking about early stages of dating, like I almost think that's important when it's like to get over someone. But he's been with this person for three years. For three years. They're married. And he's saying, oh, I'm not over this person. I'm like, she needs to know this. Yeah, that should have been resolved.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
You need to break this off if you can't. Okay, great, yeah. That's where I think it's a problem. No, that's, but I also think it's why, you know, I was up front years ago, when you get out of a serious relationship, when you're dating and you're like, hey, I just got out of a serious relationship. Like, I'm still working. You're up front about those things.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He wasn't up front about this, and it's like, she's noticing, he's distant. Now, I don't know what you call this, right? Because it's like, he's not actually talking to her. Is it emotional cheating? It's emotional cheating, I guess. It is. It is. But it's not, because the person's not actually. To me, I'm like, I don't even care what the classification is. It's a problem. It's a problem.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
OP said, a lot of people are saying this and now I'm a little freaked out. I mean, he can Google him and find out we were married. Now I'm scared he did. I'm gonna ask my friend that introduced us if she told him. He has Googled him so many times.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He just isn't invested. He's not invested in his current relationship because he's more invested. The way he's talking and writing this out, I'm excited to go to sleep. It's like, you're not in this current relationship. Yeah. You need to respect her and either get out of this so that she can live her life and stop wasting her time, or you need to figure out and handle your feelings.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Comments, yeah, no, I think this might be a lost cause. I would certainly consider this cheating, and I think that it does indeed warrant a divorce. You clearly don't really love her, at least not as much as you love your ex. OP responded, I do love my wife, which is why I married her. I just also have feelings for my ex, which I should have been honest about before we got married.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I didn't mean for this to happen, but once it did, I wasn't able to stop it. Living that life with my ex while sleeping felt like getting to experience what I missed out on in young adulthood. With that said, my wife left overnight for a hotel and I don't know if she's coming back. I feel awful for hurting her. I wasn't able to stop it. Oh, you weren't?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
You're making choices. What disabled you, huh? No, you are actively doing that. Or if you're not able to stop it, you're making an active choice to not communicate to her or to go to therapy and work on this and figure it out. Someone else said, I'm asking this genuinely, not trying to be snarky at all. What did you think your wife's reaction was going to be?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Did you expect what happened or did you think she would be more accepting? Opie said, I knew she would be upset, but I felt I owed her an explanation once she communicated that she felt distant. I didn't wanna gaslight her perception. I just hadn't known that she even noticed a difference in me. I just didn't think she would leave. She's turned off her location.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I have no idea where she is or if she's all right, and her family won't speak to me now. I do love her and would like for our marriage not to end, but that seems inevitable now as I process this. The way he's writing is not convincing me he loves his wife.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah. Thank God. Thank God he told her. I mean, she was noticing something already, right? It took her going, something's off. He's just so ready to go to bed.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So many. Okay. Update.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'm a little, I guess maybe, I'm a little surprised, because we're all like public figures in a way, and it's like, we know that information gets out there, even information that you do everything you can to keep secret, that I'm kind of surprised that she was married to him for seven years, and she's not even questioning whether he's, like if his whole basement is filled
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay. Update. Two days ago, I posted about the fallout that occurred after I admitted to my wife that I had been lucid dreaming about my ex and first love over the past year. After a major blowup where my wife called me every name in the book and got her family involved, which I understood completely, so please don't take this wrong, my wife left.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I didn't know where her whereabouts were for over 24 hours. This was written in 2020. We make roughly the same amount of money, me $90,000 a year after taxes and her $85,000.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I tried to apologize to her for all the hurt I caused by making her feel like she wasn't enough to assure her that I do love her even though I still love my ex and explain to her that I've never physically cheated or had any inappropriate conversation with my ex. But she won't budge. She doesn't want me anymore. I can't blame her.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I was selfish and I shouldn't have carried on what I now accept to be a one-sided emotional affair. So I agreed to stay together for financial purposes for two years or until the pandemic is over, whichever comes first. But she kicked me out of our bedroom and basically claimed the second floor for herself. There's so much tension in the house right now.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So I left as soon as the sun came up and went to a coffee shop to do some work. While there, I received a message on IG from my ex that my ex-wife sent her a long message from her own account, telling her about everything that I told her.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I froze because I hadn't spoken to her in a long time, but she saw that I had read the message and followed up an hour later, telling me she needed to know the truth. So again, I confessed, expecting to be berated and called a loser again, because I had nothing else to lose. But she didn't think that my dreams about her were weird or creepy.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She thought it was sweet and that I still loved her, especially with her knowing that I'd never tried to have inappropriate conversations or force my way into her life. I'm aware that her not condemning my actions doesn't make them right or take away from the hurt I caused my wife, but knowing she didn't think negatively of me made me feel better.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We messaged back and forth for a couple of hours talking about our relationship and how it ended and the choices we made. In that, I learned that she and her fiance called off their engagement a few months ago. I also told her my wife was going to divorce me because of the revelation. She expressed her condolences and that was the end of the conversation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'm home now and I can't help but wonder if this is the universe's way of putting my ex and I back on the path to reconciliation. Hate me if you want, but I made a mistake and I hurt my wife and my marriage is over now, or going to be. But knowing that the person I ruined my marriage over doesn't think I'm the scum of the earth is worth its weight in gold.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I don't know what will happen now, but I can't imagine a friendship with my ex won't blossom from this, at the very least. I know this won't make my wife happy since she contacted my ex to further shame me, but I may just not tell her. We are, after all, divorcing.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Like, 100%. Oh, yeah. And he does not feel bad.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
You're so right. He's like, I got her. Because I know a lot of dudes out there will take any sort of polite comment as, she loves me. Yeah, that's right. Oh, God, that's infuriating. I mean, she clocked it and got out. I think, I mean, living together for two years, their plan is to live together for two years. Sounds awful. That sounds horrible. Good luck to them.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And it's like, he's Googled him. He's Googled him a lot.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And I also think that's about to end because he's going to try to date his ex.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
This is a crazy story. This is gonna get worse. There's no more updates because it probably goes worse for him. It was from 2021, but there's been no updates since then because it probably did not work out. No, definitely not. Okay. That was also a nine out of 10 for me. That was a nine out of 10.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah. Oh, three years into marriage? Yeah. And you go, I'm in love with my ex. Ow. That doesn't make sense. No. I don't know. Our next story. This comes from Two Hot Takes. Shout out to Morgan over there. Love their stuff. I, a 23 year old woman, created a one to one scale puppet version of my boyfriend. 22 year old man. Hell yes. And showed it to him during foreplay as a joke. Hell yes.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I don't know anything about his life.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
What do you mean a joke? Now he hasn't texted me in 12 hours and I'm starting to get worried. How do I get him to text me back?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Apparently. I mean, I feel like most of the dating ones are. Yeah.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
This is crazy. Him at the bar with his buddies, and he's sitting there with a beer, and they're just like, what's going on, Greg? And he's like, I got cucked by myself. Yeah.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
All his buddies like the puppet more. Like he's a really good time.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He's a dope puppet. He's cool. The title pretty much says it all, but here are some more details. My boyfriend of six months and I have had a pretty cut and dry relationship up to this point. I've always been what some people would call as quirky, so pranks are sort of my bread and butter.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He, John, has expressed that he really likes this part of me, and I'm just happy to be with someone who can handle all of my zest, LOL. Sometimes, I worry that he doesn't actually think I'm as funny as he says, but he always reassures me that this is not the case. One of the ways we really like to express our humor to each other is in the bedroom.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
For example, I love to do impressions of mostly Disney characters, such as the paperwork lady from Monsters, Inc. He sometimes does them too, but he's not as good at voices. So here's where I think I may have taken it too far. I recently bought a sewing machine to try and make cosplay costumes and stuff, but something dawned on me as I was messing around with it. This was the plan.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We often start sexy time with a habitual back rub massage sort of thing, and we switch off. And then we progress into French kissing and then full blown you know what. One very important fact to tell you is that John does in fact wear glasses, so I will usually make a point to take them off and put them on the table for safety.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
During this particular romp in the hay, I got a really funny idea about how to take his glasses off next time, and I couldn't stop laughing. He asked me what I was laughing at because he has some insecurity about his appearance, but I assured him that it was nothing like that. We had our fun and John went home, but all I could think about was this plan.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So the next day I went to the fabric store and bought a bunch of skin colored felt and wire framing and cotton and got to work creating a Muppet style version of my boyfriend to put his glasses on next time we started getting dirty. Honestly, the thing was looking pretty good and I even found some clothes at Goodwill that were his style. I dressed the puppet in the clothes,
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
hid them under my collection of Squishmallows that's in my room, and invited him over. To spare you all the explicit details, we did start kissing and taking clothes off and stuff, but my hands were shaking as I reached up to grab his glasses.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Instead of putting it on my nightstand, I made a point to say something like, I'm just gonna put these right here, as I stretched over to the Squishmallow that was covering the puppet boyfriend's head and put the glasses right over his felt eyes. He got confused, I think, and looked back to where I put the glasses and sat up, as a felt version of his face, very easily identified, by the way.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Someone said, have you ever been in photos with your ex-husband that this new guy might have seen? I find it hard to believe that in this day and age, he wouldn't know who the former wife of his idol is. She said, this never dawned on me until I posted it, but there are pictures of us all over the internet. Now I'm a little freaked out that he already knew.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
John has red hair and a mustache, so the glasses on top left little question of who he could be. He was silent for a second and then said, is that supposed to be me? As I was laughing, I said something like, do you like it? As I took it out of the Squishmallow pile and revealed the entirely Muppet John.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Oh, did you make that, he asked, and I stood it up off the bed and asked him to stand next to it. See, it's just like you, basically, I said, but he still wasn't laughing that much. I think he saw that the Muppet ended up being just a little bit taller than him. He's 5'7", and probably insecure about that.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
The Muppet ended up accidentally being a little taller than him, around six foot one, based on seeing them side by side.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I noticed his disappointment and did a tried and true Disney impression to make him feel better. In my best goofy impression, I said, well, looks like we should call him Big John. John just took the glasses off of Big John and let him fall to the floor and put the glasses on the nightstand and sat on the bed for a while. We eventually went to Sin City, but it was a lot quieter than usual.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He left after that, even though we were planning on having a sleepover. He said he wasn't feeling good. I texted him goodnight and went to bed. So here's the ish. This morning, I haven't gotten any good morning texts or any texts at all from him, even though he always sends me a good morning text.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I'm worried that Big John was a step too far and that normal John didn't think the joke was as funny as I did. I feel like he's just putting me in an uncomfortable position by not telling me how this made him really feel, even though I thought it was pretty funny. Is this salvageable or am I effed?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Lastly, someone said, if he's such a fan, he knows you. OP said, yeah, I think you guys are all correct, and I don't think I should continue seeing him. I'm beginning to think it's not a coincidence at all. Okay, update.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We thought the puppet was going to be super sexy. I think actually he would have liked it if it was like, oh, this is you. This is how I see you. This is how I see you. And it's like.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She's like, he's mad at this thing? I like how this is a Reddit story we know is real. We have the puppet. Bring the puppet out. The comments, someone said, girl, what the fuck is this? Exactly. Someone else said, I read the title thinking, oh, that's a cute toy, thinking teddy bear size, then reread the scale. I mean, it's not a deal breaker, but it can come off creepy as fuck.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Someone else said, the fact he still decided to have sex with you after this is what I keep getting hung up on. I'm sorry. Yeah, I think six months into dating maybe is too short of a time.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Six months. Six months. This is new. I think that's like, you're married, and you pull that out.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Or maybe just a couple years. Get a couple years under the belt. Yeah, get like five years in. Get like ten years in, maybe. Updates. Puppet came alive. Puppets alive. Whoa! And it killed a man. Oh shit. Not sure why mods deleted my last post, but so many people were asking for updates that I'll leave the original in the comments.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's really funny to read back, but here's what happened in the last week. So it's been a wild couple of days or so, and I've honestly been a little depressed at the negative reaction from everyone. Can I vent really quick about something? I kind of hate how Redditors can't say had sex. They refuse to say, so we had sex. Why?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
They always say, we did the no pants dance or we did the deed or we went to Sin City. It's dog-o-coded. We did the dirty. I'm like, just say you had sex.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I know, I know, but like, it's so common in Reddit posts to just be like, but even then, just be like, so then we went down on each other. Yeah, that's true. I'm just like, I think it's less cringey than being like, so we went to Sin City.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's just a funny trend I've noticed with writers, where they cannot say that. I'm like, you're anonymous. We don't, that's so true. I'm like, just say it. You included a picture of this puppet. Puppet, dude. And you can't say we had sex? Yeah, that's fair. I was so sad that I didn't even want to look at the sewing machine to make my custom Disney ears because it just reminded me of Big John.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Speaking of Big John, I hung him up in the closet so I didn't have to look at him. Wait, it just reminded her of Big John, not her boyfriend? Just Big John. That is crazy. I was so ashamed, I was drawing when my phone buzzed and I saw it was finally John. All it said was, hey, can we talk? I was super nervous and he came over to my place.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It was awkward at first because it had been so long since we saw or talked to each other and I honestly thought things were gonna end, especially after reading all the comments. However, he apologized for his behavior and told me something that cleared things up. So apparently his mom has been cheating on his dad with multiple younger men for years.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And he and his dad just found this out the other day, the day I made Big John. He wasn't upset about Big John at all. I could tell he was still upset and my instincts were saying I should do a Disney voice. But I considered the comments from the last post and decided just to say, I'm sorry that happened to you. I hope your family is okay. Then the most surprising part, he said, I'm sorry too.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And then in his adorably not very good singing voice saying, Big John never bothered me anyway. I have something for him actually. I don't know how he's saying that. And brought out one of his favorite slap bracelets that his mom got him as a kid. He pulled me into a hug and we danced like we were Cinderella and Prince Charming boyfriend. He tried to dip me, but he's not very strong.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So it created a funny moment where we kissed and then he led me to my royal suite.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah. It's true. Okay. Shall we just go get right into it? Let's do it. Okay. I'm down for some wild stories. We know this first one's going to be good because it comes from Best of Redditor Updates. Okay. Love it. It's going to be a couple parts to this. The guy I'm dating, this is a 36-year-old man, has a shrine to my, 37-year-old woman, ex-husband in his house.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I have tears in my eyes. That's really funny that I'm about to cry now. We got on the bed and Normal John had some smears on his glasses after kissing. He asked if there was anywhere or anyone that he could put these on. I brought out Big John and his hand fell off, but it was like a fairytale romance when Normal John placed the glasses on Big John's cute nose.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So for now, it seems like a happy ending. I'm sorry I didn't post any pics with the original post, but after seeing John's reaction, I was so embarrassed, and some of the comments were so mean that I wanted to just destroy Big John and never think of him again.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
But there were some very kind people who sent me private messages that made me feel a lot better and proud of my quirkiness, which could very well be autism, as some commenters have stated, getting the test in a couple weeks. Also, stop thinking I would use Big John for the Devil's Tango. He is stricken! Jesus! He caught me off guard.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yup. Yeah. That's it. I'll put it on her. I'm gonna name her Emma. Fuck you, Emma.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He is strictly an awesome way for normal John to have somewhere to put his glasses. So after all this time, I've gained the courage to share Big John with you, like all of you have asked. I was happy with how it turned out, and even happier that my beloved loved him as well.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
No, they sound like an adorable couple. And honestly, if they got past this, they're perfect for each other.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He started singing a Frozen reference? Come on. They are extremely vulnerable with each other in a way that is simply adorable. Beautiful. That is a hilarious story.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
God, we need to have a running list of all the ways Redditors have referred to sex. Or just anything revolving sex. It's so funny to me. Okay, that was a great one. That was a great one, that was sweet. That turned very sweet, very happy. Okay, here's our last story. This comes from Relationship Advice. This is a recent post. As of reading this, this is not that old, which is always great.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay, update. Well, after getting a huge range of answers, some of which were kind of frightening, I decided to give the new guy the benefit of the doubt and go ahead with our dinner date that night, our fourth date. So I met him at the restaurant and we had some wine first. We were just talking and chatting and I realized that I had to bring up the ex-husband thing.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay, there's a 42-year-old woman writing this. My husband, who's 42, has informed me he intends to go on a gaycation with his brother-in-law, a 35-year-old man, in Ibiza. How do I handle this? Okay, wait.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay, hi there. I really wish I didn't have to make this post, but here goes. So me and my husband have been happily married for about 16 years, give or take. We both have stable careers, good family life, and are fairly fortunate despite the cost of living racking the UK right now. We have two boys, 15 and 10, and up until this Sunday, thought we had it pretty good.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We argue sometimes, of course, but it never gets too bad, and we have a pretty decent sex life with some exploration, but I won't get into that. Long and short is, on Sunday, just after I dropped our boys off at their friend's, my husband asked me if we had the house alone, and more importantly, do I have a minute?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I said yes, and he sat me down, then got out this printed poster for some sort of orgy, and started explaining to me the concept of a gaycation. how it's where straight men go to somewhere with sun, sand, and booze and become gay for the duration of the trip, but that's fine because it doesn't actually count because what happens on the gaycation stays on the gaycation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I was just completely silent and mortified, even more so when he said he was looking into booking a trip to Ibiza next year with his brother-in-law, his sister's husband, to experience it for himself. When he finally let me speak, I just said, I need him to be clear with me. Is he gay? Because if yes, that's okay, but we need to figure out what happens going forward.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I didn't let myself get angry or upset. I was just stunned. He swore up and down he's not gay, and he's 100% attracted to women, and of course still loves me and our boys. So I said, well, do you think you're bi, maybe? And he got very defensive, saying how I need to drop the accusations, and that this is the beauty of the gaycation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It allows straight men to experience gayness without actually being gay, and now it's like going to an aquarium. And again, he was adamant he doesn't find men's bodies or genitalia exciting at all, but he needs to experience this apparently.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I said, well, I'm really not comfortable because even if he was bi, this would be explicitly cheating on me and he got very angry and reiterated he's not because that's the beauty of the gaycation. I just had enough and left the room.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
That's the beauty of it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's kind of like a lucid dream. Yeah. Yes! What? I really can't put into words how surreal it was, because he was speaking so matter of factly, and he again insists this is a thing that straight men do all the time, and how he's actually doing it a bit late. I just said to him, if he has any love for me, then he can't go ahead with this, and if he does, the marriage will be dead.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So while we were both two glasses of wine in, I decided to just ask him flat out if he knew that I was previously married to his favorite musician. He laughed nervously and said, yes, I knew, but my friend didn't tell me, I figured it out. He told me essentially that he found out through the grapevine that he decided to start mingling with my friends so he could meet me.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We didn't speak any more after that. Since then, he's mentioned no more of it, but somehow, and this is what scares me a lot too, that decision genuinely seems to be tearing him up. He didn't go into work on Monday and only went in a half day yesterday because he told me he just felt too ill and he just looks distraught every time I see him. I really don't think he's wholly gay though.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I can absolutely believe he's bi, but I'd rather we talked about that in a healthy way rather than this incredibly weird denialism around going on a sex holiday to Ibiza. Has anyone known straight guys to do this and come back and just go back to being straight? Like surely that can't be a thing that happens. I'm so out of my depth here and I just don't know how to even initiate the conversation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
For the record, I also haven't mentioned it to his sister yet. I don't know how I'd even break it to her. Thanks for any help, I just don't even wanna think so. Being able to get this out there has helped even just a little bit. While this blew up, this has been incredibly sobering and I think I've now confirmed that I already knew to be the case. The marriage is dead, one way or another.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
In a way, I was in denial about that. I have contacted my sister-in-law and she initially screamed at me, calling me a liar and even insinuated I was trying to steal her husband. She rang me back shortly after, apologized and admitted she was in deep, deep shock. I have asked my parents to look after the boys and we're going to meet tomorrow to discuss this deeper.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I have also texted my husband and told him we will need to make alternative accommodation arrangements, but he will not be sleeping here tonight and a bag will be waiting for him. P.S. I see a lot of people asking about the aquarium and at risk of doxing myself. There is a pretty famous aquarium in the UK called The Deep.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
At the very end, you walk through a tunnel that goes underneath the main fish tank, so it's quite immersive, I suppose. My husband explained the aquarium thing in that it's a bit like that. You go there and you observe the fishes, you even get a bit up close, but you never actually enter the water. Get emotionally invested, or become a fish, gay, so it doesn't really count.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It was very bizarre analogy and I pointed out it still makes no sense and he just got more in a huff and how I just don't get it and frankly, I still don't.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He told me that yes, at first it was just because I was married to his idol, but that now he is really developing feelings for me. I thought it was a little odd. A little odd.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Then he can change. I don't think the issue here is his sexuality. No, it's not. The issue is he's married, and he wants to go to a place, he's literally like, I'm gonna go have an orgy. It's like, is he gonna have an orgy? But that's what he showed her, that's what it says.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
But the problem is, he's still describing, what he's describing is inferring that he's going to go... I wish she would have asked. Be in a situation where it's even if it's... You did say mind, body, and soul. Yeah, it's also like, even if it's a situation where it's like, oh, I'm gonna go, I'm not gonna have sex, but I'm gonna go watch some other people that are there have sex.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's like, that's still cheating. Like, you're still, what you're telling me is, what she's upset about is that it's like, hey, what? Like... This is a whole lot of layers. She doesn't even seem to be upset about it. Yeah, I think she's trying to make sense of it. I don't know. You're right, there's some vagueness to what is being described here. He's explaining it like an aquarium.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I think, I understand though her inferring, and it's what I'm inferring. I would think that too, I'd be like, are you gay? That's my, well no, I'm saying my assumption that this is gonna involve sex. Sex, yeah. This is going to involve something, you know, like kissing. Like, anything sort of that's cheating. When he said mind, body, and soul, he added body to that.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I thought it was a little odd, but I felt fine with it until I remembered his man cave basement. I asked him if he knew I was married to his favorite musician, then why the fuck would he bring me down there to show me all of the memorabilia? His response was too weird for me. He said, I was trying to see if you would confess. I was like, confess to what? And he said to my being married to my ex.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Just like on the beach drinking a pina colada, just like, I'm gay right now.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I don't know. You know what? I certainly can. I haven't been to a straightcation. Guys, let's go on a straightcation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Is there an update? We need far more clarification on this.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah, that's what I'm thinking too. In Ibiza. Okay, comments. Your husband isn't proposing a gaycation. He's proposing cheating on you with men while using magical thinking to pretend it doesn't count. The fact that he's planning this with his sister's husband makes it even more disturbing. His bizarre explanation about surrendering mind, body, and soul isn't straight man curiosity.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's someone desperately trying to justify exploring his sexuality while keeping his heterosexual marriage. His depression about not being able to go isn't about missing a vacation. It's about being forced to confront his sexuality without his convenient what happens in Ibiza stays in Ibiza excuse. His meltdown over not going shows how desperately he wants to avoid facing this reality.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah, I've never heard of a gaycation. I've never heard of this before.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay. Okay. So when I last posted, I'd contacted my husband to tell him he wouldn't be staying at home tonight and a bag would be waiting for him. As you can imagine, we argued, quite badly. I won't go into the specific details, but no, I'm 100% on board with the fact, at a minimum, he's bi. Might even be gay altogether.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I told him that I thought it was pretty concerning that he tried to trick me into some weird confession and that I didn't think we would work out. He accepted it and didn't seem upset or anything. Dinner had already been served, so we started eating when he proceeded to bombard me with questions about my ex.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
We've had arguments in the past, but I've genuinely never seen him have such a childish tantrum before, screaming about how I just don't understand the gaycation. Absolutely despise that phrase now. And insinuating I'm actually homophobic because I refuse to allow him to participate in this cultural exchange with the gay community.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
A lot of you said to ask him if it'd be acceptable if the roles were reversed, and I did ask him, would it be acceptable if I went and slept with other guys during that week? Like fucking clockwork, he was very angry and offended, saying it's completely different because a gaycation means nothing, and what happens on the gaycation stays on the gaycation. So he did want to sleep with people. Yeah.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So doesn't actually count. Whereas I'd just be straight up cheating. Well, I turned it around on him. No, but you see what happens in Manchester stays in Manchester. It doesn't mean anything. It doesn't count. It's like bird watching. And I think it got through to him.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He went all quiet and then started crying, admitting the thought of me sleeping with another man is destroying his heart, but relationships need sacrifices. So agreed, while in tears, that when he goes on the gaycation, I'll get one week in Manchester to do whatever I want. He doesn't want me to, but that's fair in a twisted way, he supposed. I told him to get out of my house.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Thankfully, he left without a fight. I know it's incredibly petty, but I also drained the joint bank account, legal in the UK, so he couldn't try to use it against me. About an hour later, I got rang up by his mom, my mother-in-law, who just screamed and screamed at me about being a cheating whore. What about the kids? What? He must have... Yeah, he said some stuff.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
When I finally got my composure back, I just said, ask your son about the gaycation. Obviously, at first, she got angry, but I said, no, just ask him about the gaycation. He'll explain, but she called me a fucking joke and hung up. Later on, getting into the evening, I got another phone call from her in floods of tears.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She was very apologetic, and I told her she doesn't need to be the one to apologize. She was so upset, she put father-in-law on the phone, who, while he sounded calm, I could just sort of tell he was on the warpath.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Again, very apologetic, and said he overheard that phrase, asked my husband, and husband initially said, no, it's nothing, before explaining how it's a modern thing men do, and gave them the same spiel about how what happens on the gaycation, men cannot resist the gaycation, how a man must surrender to the gaycation, et cetera.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Father-in-law just said they told him to leave or they'd call the police. Don't care where he goes, but he wasn't staying there. My husband tried to call me while I was on the phone, but I just ignored it, and father-in-law just said he was so sorry for me, and they have my corner in this, so that's one thing.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Told them to be there for their daughter because it sounds like brother-in-law is involved. Husband didn't tell them that, and father-in-law just said he had to go because he was so, so, so angry. Got a text from my husband after the phone call, which was all weirdly rambly, saying how I'd abused the gaycation to destroy his marriage and destroy his life.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And again, insinuated I and his parents was homophobic for doing such a thing. Told him we'll talk when he grows up and blocked his number. I took a day off work myself to have the locks changed this morning so that 500 pounds gone, whatever. At least I know he won't be coming back. I'm going to look into how to proceed with a divorce and then we'll move from there.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
When is he releasing new material? What is his favorite band? What does he do during the day of a show? Is he vegan? What's his mother's maiden name? Okay, so I made up the last one, LOL. Blah, blah, blah, blah, blah. Finally, he could sense my discomfort and we ended the dinner and parted ways. He said he would text me the next day just as friends, which I said was okay.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
So I haven't yet met with sister-in-law. She was in such a state and has taken this far, far worse than I have for reasons that'll be clear soon. We're going to maybe try tomorrow but we did talk over the phone and I eavesdropped on the conversation with her husband where she put her phone on speaker and I went on mute.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Her husband got home earlier, she made him come home, told him there was an emergency, and just said to him, can you please explain what a gaycation is? She told me afterwards she was praying he'd look confused or just be like what or anything like that.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
But instead he just sat her down and explained that a gaycation is a new thing where straight men go to gay hotspots and participate in gay sex acts, but it doesn't count because there's no investment and because what happens on the gaycation stays on the gaycation. If I hear that phrase one more time. Oh I hate this. He said it's like writing down angry thoughts and putting them in a drawer.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
You never have to see them again. Oh, God. The whole time, sister-in-law is in tears as he just calmly bats off the same points my husband did about how it doesn't count and he even did the whole it's impossible to resist, you must surrender or be destroyed shit.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I seriously think they must be speaking to a dominatrix or something because surely neither of them are that into this, actually make that up on their own. I really don't wanna go into what was discussed for her sake but it did become very apparent to me that the brother-in-law is into sissy hypnoporn and at times conflated that with the concept of a gaycation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
There was this utterly surreal moment where sister-in-law is just trying to wrap her head around this while also in floods of tears and he explains so genuinely, so matter-of-factly that for most men, the gaycation is either a one-time or annual thing, but some men go on the gaycation for years
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
and others simply never return because they use hypnosis and mind control to be totally feminized into a state of permanent pseudo-gayness. She said in disbelief, surely if you're taking it up the arse willingly because you want to, that makes you gay, and he said no, because that's the beauty of the gaycation. You can do all this gay stuff, Don't interact with the white or gay life experience.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She asked him if the sissy stuff is what he wanted and he said not on a long-term basis and was adamant this is something all straight men do, but she wouldn't get it because she's a woman. Then there were more insinuations of homophobia. Well, that marriage is dead too, I suppose.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
The whole ordeal ended when she said to him he has a choice to make and he said no, he doesn't need to make this choice because the beauty of the gaycation is that it allows him to keep his marriage. Oh my. Because it doesn't count. She said that's not the choice. The choice is whether he's leaving the house that night or she is. The only good thing is he did leave.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Me and sister-in-law spoke about it after that, and I'm just still utterly stunned. I understand she's gone to her parents for support. What exactly did we do to have our lives destroyed in such an abrupt, bizarre, embarrassing way? Per some advice, I'm going to look at devices and bank statements to see if I can find any definitive proof of cheating.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Well, his text the next day was trying to get him and his friends VIP passes when my ex comes near us to play. I did not respond and I blocked his number because he kept texting again and again, begging me for the hookup. It was desperate and weird. Anyway, I called my ex to warn him about this dude, even though he seems harmless. He doesn't know where I live, and I didn't get any psycho vibes.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
After that, I suppose I'll figure out how I tell the boys why their father won't be coming home. Edit, spoke to my other sister-in-law, my husband's family is older sister, him younger sister slash original sister-in-law, and gave her a skimmed down version of it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
She asked her husband, and thankfully he was deeply confused, but then mentioned about two years ago at a birthday party, he was approached by my husband and brother-in-law about signing up to some online boot camp around BDSM cross-dressing. He assumed they were taking the piss out of him, so told them to fuck off and never really thought of it again.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
The fact that this has been going on for that long is making me wanna throw up. P.S., for the poster who said about divorce options, I'm actually going to look into adultery because plain and simple, that's what this is.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's sad. Yeah. I think this is sad. I think this is sad because it shows the lengths people go to like, they can't confront things.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And it's the world we live in where it's shamed so much, you're not allowed to like, I think what you said was important earlier, of people's ability to experiment. Because clearly, he never could in his life. He's now been married for 16 years. He's got something inside that he's struggling with.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
When you have a desire, when there's something in you and you are literally pushing it down, I'm talking a realm of anything, that leads to destructive behaviors. Because you're trying to find some other path And he's found his way here to convince himself this is how he can do it. I wanna feel really badly for the guy. And I feel bad for something that is going on inside.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
But where we have ended up now is that's the problem.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah, yeah, because this is like, it's just tough. It's disrespectful. It's disrespectful on so many levels. I'm a little curious. I'm curious what your thoughts are, because this is the thing. She's got put through a whirlwind, right? So any decisions she's making, it's like, I understand. This is all happening so fast.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Her going to his parents and telling them, ask about the gaycation, do you think that's, in a way, like... did she need to do that? Like, because it is, is it in a way kind of outing him to his parents? And like, their reaction, the dad's reaction has me like, okay, like, what do his parents think about the possibility of him being gay? Yeah, that sucks.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Like, because there's a reason he is pushing it down so hard. At the same time, I'm like, like I said, what she's going through, I'm like, Oh, it's awful. And he, you're worried about what the ramifications of separating are gonna be, but it's just like, so I'm not mad at her, I'm not saying she's an asshole, but it's just like.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I think he just wanted me as a trophy, as some user put it in my last post. Ew, thanks Reddit. I'm sorry, you didn't get any psycho vibes?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yeah, it's just really, it's sad on so many levels, because it's also sad that he didn't feel comfortable at any point, and this is his own thing, this is his own battle, to talk to his wife and be like, you know what, I wonder if I have feelings. I wonder if I, like, you should feel comfortable talking about that. Maybe they could have
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Even just, or just like, maybe just talking about it would be enough for him. Well, obviously, yeah. Like, oh my god, that would have been freeing for him to be like, oh, and that's okay. This guy is struggling, it seems like, with not being okay with something. That's all he needs. That's all he needs. He's trying to find a way of being like, and this doesn't count. And he kept reiterating it.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Yep. That's all he needs.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I know. That's the whole thing. And I think it's very clear to me from the subtleties of like, oh, and nobody in his life is okay with it. We are not... I mean, she did say I'd be okay with this, but who knows where up into his life how everybody's talked about it. So it is a tragedy.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Girlie, you need to be a little more aware. So he became friends with Emma in order to get to her.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
It's very sad. But... at the end of the day, too, like, they're gonna divorce, he will be single, and. Here's this opportunity. Now, we will see. Anyways, wildness scale. 10 out of 10. That's, that could be the 10. That's our 10. That could be the 10. And that's the beauty of the gaycation. And that's the beauty of the gaycation. Shut up!
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
What stays in the, what happens in the gaycation stays in the gaycation.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
These have been wild. Those are wild. These were wild. Really wild. I will be thinking about these ones for a while. Yeah. Wow. Thank you both for being here. Hey, thanks. Thanks for listening. This was a lot of fun. What's this? Jerry Spruce. This was really fun. Man, okay. Let us know your thoughts on these. Yeah, we need to hear. I'll be processing these for a while.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
And let us know what other themes and subreddits you want us to cover on the show, because the stories just keep coming.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Oh. What? Nothing. Nothing. All right, we'll see you next Saturday. Goodbye. Goodbye.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I've never understood because I'm such an introvert and I'm so shy that becoming friends with people is already hard enough for me. but whenever I hear about people becoming friends to get to someone else, or just dating someone to get to someone else, or using people as a stepping stone socially, has always fascinated me, because I'm just like, man, that's a whole lot.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
You're never looking at someone as a means to an end. You're fascinated by every person individually as well. And that's fine. That is how networking works. Networking is being like, I'm friends with you, and oh, I've met people through you, and now I'm friends with them, and now I'm meeting people through them. That's fine. He did this with intent.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
The guy I'm dating has a shrine to my ex-husband in his house. The guy I'm dating has a shrine to his? The writer's ex-husband in his house.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He was never interested in Emma as a human. He needed her to get to her. Well, I'm glad OP escaped that.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He was not. It was the idea of her.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Oh, God. She, frankly, needs to be a little more paranoid. That's why, yeah. She is not paranoid enough.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Well, the thing is, yeah, the thing is this, though, like, it's almost the more niche of a community you're in, the more intense the fans are. I don't know what metalhead fans are like, but I know that's not mainstream stuff. That's true. For them, it means so much more to them. So they're way more diehard about it. There's probably, I don't know.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I've usually heard that Metal is like a really chill fan base.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Wild. Wild. That hits a, what, like an eight or nine on the wild scale.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay, it's fair to bring this up. Would any realm of this be a deal breaker if someone knows you or something, like from your career, from Smosh or from YouTube?
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Then you're just like, oh. Boom, I'm in. That's fine. I think there's levels to it. I never experienced it before. And, you know, out here in LA, you might experience a bit, like, they might be also a peer, where they're like, oh, I'm an actor. Oh, I've seen your stuff. Right. Yeah. But a fan, like, where they're like, oh, I'm a fan. I've watched tons of your stuff. Oh, yeah.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I think where I would have had an issue with it is that I'm like, oh, you know an idea of me. Yeah. And this is going to be complicated because this is... Can't wait to disappoint you.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I was married for seven years to a celebrity. And there we go. celebrity in quotes. I put it in quotes because while most of you have never heard of him, he is a A-list in the world of metal music. If you're a metal head, you 100% know who he is. Maybe someone in this room might know, have an idea. As we discuss this, We split amicably because he was always going on tour.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I think there's levels to it, but there's also the thing of, okay, did you seek me out? Oh, that's weird. Because that's a thing. It's like, oh, if it's happenstance. But see, in this situation, he sought him out. He sought her out.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
I've heard the take two, and you know, like I said, this is far removed from me, because I'm not dating anyone, I haven't for years, but I've seen the take of like, a person and a fan can never date because there's an inherent power imbalance there.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Like, the person who's a fan is gonna kind of like, already be enamored in a way, and that kind of creates this imbalance, and I was like, I thought that's really interesting. once again, I think there's just a lot of levels to it. It depends on how much of a fan. You know, because someone might watch and be like, oh, I've seen your stuff, I really like your stuff. That is kind of one thing.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
You know, it's, are they but a, like a fan of this level. Where they have images of you around their house. It's like, that might be, the relationship is fan and entertainer and it needs to stay that way. That's a cherished relationship right there. That's a real thing, but that, When you try to combine two different things or transition one from another, I think it can be tough.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Oh, that's awful. But a lot of different situations that arise. But anyways, it's an interesting thought. Our next story, relationship advice. This is a 28 year old woman. My boyfriend, who's 29, grabbed a stranger's ice cream. Can't believe this actually happened. Was it a baby? My boyfriend stole candy from a baby. And it was really easy. It was frankly really easy.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
Okay, so her boyfriend grabbed a stranger's ice cream. Right off the bat, it doesn't say stole. Grabbed.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
No! He just grabbed it. Oh. No, he just grabbed it and squeezed it. Yeah. He's like, ah! Somehow worse than stealing their ice cream. At least eat it. Yeah. We were out walking around this evening.
Smosh Reads Reddit Stories
The Most Unhinged Dating Stories | Reading Reddit Stories
He'd mentioned wanting to get ice cream but hadn't brought money and neither had I. We usually take a walk after dinner and don't buy stuff during it unless we decide beforehand we want to get something that night. So as we're walking past a group of people, he made a sudden movement to the side and then started running in the opposite direction at full speed.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Did you ever have people write notes on receipts or like mean stuff ever in place of a tip?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
As you guys know, I started acting when I was like 13, so I never worked a normal job. We know, Shane. You're famous. I know nothing of the real world.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Because I've seen a lot of posts similar to this where it's like, oh, they wrote this note or they did something really funny.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
We need queues. That's a really interesting perspective for people who ever complain about their servers or are mean to servers. It's like, hey, what you want out of a server is probably not what someone else wants, and you're trying to adhere to everything. Yeah. That's really interesting.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I didn't want to come back here.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah. Oh my God. Comments on this. Your manager was far too kind. No way that would have come off the bill anywhere I've been and the manager in most places would have told him that we don't put our liquor license at risk for people like them and then thrown them out. OP responded, yeah, but it was like a $15 difference and we took it away after one sip. I don't know, it felt wrong to charge them.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Someone else said, apparently in a few states, parents can buy drinks for teenagers. Had a customer at my bar in Nashville berate me for not serving his teenage son a beer. I was shocked it was allowed anywhere, but it certainly isn't in Tennessee. My very bored security guard happily threw him out the second he raised his voice at me. So we have a note here. One of those states is Texas.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yes. You respect. I'm sure you guys have plenty of nightmare stories. I think you've told them before on the show, but as we go through these stories, if you're reminded of any, please share.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
In Texas, a minor may consume an alcoholic beverage if it is in the visible presence of the minor's adult parent, guardian, or spouse. But it sounds like this isn't the case for this story. In this case, it's the establishment's rules, follow them or don't. Lastly, I had something similar happen. Family came in, young looking kid forgot their wallet, so no ID.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
The dad claimed to be a police officer, and I said, then you should be happy that I won't serve her without an ID. That's awesome.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, that's like walking into a full trap. It's like, don't worry, I'm a cop. It's like, what?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Then I literally won't. Our next story actually comes from relationship advice, but it's about serving. You'll see.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
This is a 31-year-old man. My best friend, a 33-year-old man, is broke. I've been offering him a job in the restaurant I work at for months and today he confessed he doesn't want to be a server because it's low and people would lose respect for him. I'm deeply offended. So this happened in 2018, for just a little bit of context. This happened- Different time. Different time.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
The old times. This happened just before. My friend is broke, he hasn't worked in over a year, he's running out of savings, and has even had to ask his parents to support him. I asked him many times why he doesn't try to get a job that's not in his field. He's got a computer science degree but has never worked in the field a single day in his life since graduating.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
He's turned down lots of jobs because of reasons. They don't pay him enough, they won't give him a higher up position right off the bat, et cetera. I'm well aware he's deluded in that sense, but he has many other good qualities and that's why I love the guy. So since graduating, the only job he's done is share marketing, something like online investing in Forex.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Forex is a foreign exchange trading. He said he made about $20 a day and that it was enough for him. He's single, lives in a shared house, and doesn't spend much. Whatever makes him happy, right? The thing is, he's totally broke. I don't think he really is making even $20 a day on the shares because he's run out of money. He's stressed out and won't stop complaining about money problems.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
All right. All right, our first story comes from Tales From Your Server, which is a subreddit dedicated to these types of stories. Go ahead. A lady called to warn us about her husband.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
This is confusing for me, and I think it comes down to his pride not allowing him to get a job that's not fit for his ego. Now, I work as a server in a very nice restaurant and have offered him a job as a server many, many times.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I have a great relationship with my boss and after telling him my friend's situation, he didn't hesitate to say he wanted to help and would like to offer him a full-time job. My friend has been turning it down for months, not really giving much of an explanation. Today, he called me saying his parents have cut him off and asked to borrow money from me.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I said that as a personal rule, I do not lend money to anyone, but that he was welcome to start working tomorrow with me. He again turned down the offer and I got a bit frustrated because I'm offering him a solution to his money problem, but he won't accept it. So we got into a bit of a banter and he finally confessed he thinks being a server is low and doesn't get you people's respect. Whatever.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Okay. I got a degree too, but I couldn't find a job in my field so I had to take the first job I could. I'm not some prissy prick thinking I'm too good to serve others. I take pride in being a waiter and doing a great job. I'm so hurt by his comments. Why is he my friend if he thinks I'm low?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I didn't want to say something nasty or get into an argument with him, so I only told him he was being very offensive and I felt like he needed time to think about what he said to me. He replied saying there was nothing to think about, then gave me a list of low jobs like street sweeper, cleaner, et cetera, and said it's a fact those are low, not respected jobs.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I asked him to apologize before this snowballed into a full-blown argument and he said he stood by what he said. I don't want to overreact, but I don't know if we can keep being friends after this. I really don't know what to do. I don't want to badmouth him, but he should examine his life and learn empathy. I'm a very easygoing and forgiving person, but what he said hurt me and was idiotic.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
The man who refuses to work is calling me low. I don't know what to do.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
In fact, every single job he listed as low are ones where I'm like, I don't think there's such a thing. I think every job has a lot of potential. Absolutely. Depending.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I also feel like, aren't street sweepers, isn't that like a union job?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, good benefits? Yeah. Look, man, I'm going to be real honest, like being an actor for so long where it's like, I don't know when I'm going to have like another job where you're just like, I need to book auditions. You're like, I could be a mailman. Those types of, oh, when I heard about like, oh yeah, like a mailman, I remember in my early 20s, there was a period of time where I was like,
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You need to close down. Officially had one of the wildest experiences in my four years of serving last night. Got sat with a two and a half top. That's two and a half people, meaning a baby. Yeah. A husband, wife, and their new baby in a stroller. When the hostess came to let me know, I got sat.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I think a mailman sounds kind of sick.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It's always the funny thing when people list off jobs that they think are low, and I'm like, that's actually a damn good job. Like plumber, it's like, dude, no, they're making bank, bro.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Like, I am fully aware, like, I don't view any job as low because I don't think I could do any job.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I've done this for so long, I'm fully incapable of everything. I... God forbid! God forbid!
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Being a server at... is completely different depending on where you're a server.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And it sounds like this guy said this is a very nice restaurant he works at. This is an incredible job offer this guy's getting. And I also, I've heard that, like, this is 2018, but... I mean, the job market's not easy to find a good job. No, no.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I have family members who worked as servers and made a lot of money.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
There's a lot of legitimate reasons why someone would say, I can't take that job or I can't work right now or whatever. He is blatantly telegraphing why, and his reasoning is awful. It's bad. And it's so insulting to his friend.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, I just can't believe the words that come out of people's mouths. What do you think you're getting out of this by saying that? You're telling your friend that the job he's working is low.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She informed me that the wife at the table called ahead of time to let us know that her husband was going to be very picky and difficult. Before I even got there to greet them, they asked to switch tables two times for whatever reason.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I mean, a job is a job, and I don't think your job is who you are, right? Like, I mean, it's a big part of your life, but, like... Right, but it's not all of you.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, there's no I don't think there are unfortunately people who do attribute status to these things those people suck But like not on a real level on like an actual level should it be that way and this guy is basically exposing that this is how he views people.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
So it would be hard to continue to be his friend when it's like, oh, but you think I'm, this is what you think. This is all I am. And yeah, we should address these jobs. They're absolutely not low. And in fact, I mean, I think the pandemic exposed so much of like what society is built off of, where it's like suddenly all these jobs that are so low are the ones that we needed desperately first.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah. And it's a lot of work.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, whenever I hear the term unskilled labor, I'm like, it's all skilled, man.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You just had a lot here.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Once they were finally situated, I go to greet them and the husband let me know immediately that they were ready to order. He proceeds to order around $130 worth of appetizers, entrees, dessert, and gets three different drinks for himself all in one go. His wife, quiet as a mouse, just orders a drink.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
All jobs require skills except for podcast host.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
All right, comments. Honestly, be happy he didn't take the job because with that attitude, he wouldn't have lasted long and tarnished your reputation with it. I don't want to overreact, but I don't know if we can keep being friends after this. Honestly, don't keep him as a friend. Doesn't seem that you get much out of the friendship anyway.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Someone else said, funny, pompous ass is too good to work as a waiter, but isn't above asking to borrow money from a waiter because he's too pathetic to go earn a living to take care of himself. It's easy. Take the job off the table because it's not appreciated or respected by him, and it will only end bad for you and your generous boss.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Don't lend your friend anything and let him figure out his problems on his own. Simple life lesson coming. Update. The next day. I made this post yesterday asking for advice on how to handle the situation with my friend. Basically, he's very broke and his parents have cut him off. I've been offering him a job in the restaurant I work in for months and he has always turned it down.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
His situation got so bad, he came to me yesterday asking to borrow money. I don't lend money to anyone as a rule, but I told him there will always be a plate of food for him in my house and he was welcome to accept the job offer and start working with me the very next day. Well, long story short, we had a bit of an argument, if you can call it that, and he finally confessed he thinks being a server
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
is low and won't earn him people's respect. In an interesting turn of events, he called me today and said he'd thought it through and had decided he's willing to accept the job only with one condition.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Beggars, choosers, losers. What do you think the condition is? What do we think the condition is?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
He'd be willing to do it with only one condition, that he's to be made manager right off the bat. What a pompous piece of shit. And that he should move in with me so that I can drive him to work because the bus from his house to my workplace takes 35 minutes and that's over an hour of commuting a day.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
He then suggested I move my youngest daughter into my elder daughter's room so that's an empty bedroom for him in my house. So he obviously had given this some thought. I was dumbfounded. The sense of entitlement and the level of pride you got to have to make those demands is astonishing. I know he's never had a proper job, but he's not stupid.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
He has to know you can't be made manager if you don't even know the names of their dishes properly. or how to serve a coffee. It's all about his pride. He's got an ego bigger than I thought. He can't be humble enough to accept a waiter job and work things out from there. He needs to be made manager so that it won't hurt his pride as much.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
During his order, he was so aggressive, making demands and asking in-depth questions about every single food item he was ordering and modifying it in some way. And every few seconds while he was ordering, he'd bark and remind me, I want it hot, fresh, delicious. I felt... I filled a notebook page with this guy's order.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
To be honest, I was so out of words, I said I don't wanna talk and hung up. I can't explain how off-putting that conversation was. I feel repealed by him. I feel disgusted, as if something has changed inside me. I can't have a person like him in my life. What makes a person refuse all help just out of sheer pride?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
My wife says I've been patient and kind enough to him throughout the years, and I should let him figure things out on his own. He really is broke. Before his parents cut him off, they were covering his rent slash bills, and he survived on the $20 a day he claimed to be making investing in Forex. I know he barely eats and can't even afford a new pair of shoes and some other stuff.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I know he's got no money, but then why won't he accept the job? He's not shy, has no mental health issues, and has no problem dealing with people. He's refused many other jobs in the past, even jobs related to his degree, computer science. He's got the wrong idea that he should be given higher up positions right from the start because he's him and that's what he deserves.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
That's the reason he hasn't worked a single day since graduating like a decade ago." Anyway, I've got to do some deep thinking and reevaluate this friendship because I don't like the person he's becoming. His dad is a bus driver and his mother is a retired teacher. They are lovely, humble, down-to-earth people. I think they've done the right thing cutting him off.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I know they're both struggling financially, so it's not fair for their son to leech off of them. His mother even had to go back to work doing some tutoring in order to make some extra money to be able to support my friend. I'd be so ashamed if I made my 70-year-old mother go back to work just so I could be sitting at home dreaming of landing the perfect job while actively doing nothing to get one.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Anyway, I'm rambling. Sorry, I'm just so mad. My wife says it's time to cut the cord and distance ourselves from him. I think she might be right.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, I think she's right. Yeah, she's right.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Makes no sense. But, but. You can have a career, and you're like, comedian. They're like, fuck, shit, what the hell, dude?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I see what you're saying. I would say, though, in life, I mean, we all have to start somewhere, right? I don't think anyone gets anywhere without working jobs you don't want to work, right? Is that fair to say? Yeah, absolutely. But it says he turned down computer science jobs.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
So I don't know what's going on. That's where he screwed up.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I mean, I don't, all we know is he told OP these jobs are beneath him. All I know is he's an ass. That's all we know, it's like, all right, we're gonna take you at your word, that's your reasoning. Like, if you gave us a different spiel, we would go off that, but he said these are beneath me, So, you know, fuck you. Like, that's kind of where we're at. I just, wow.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
He also asked his wife if she wanted a tequila shot, and she shook her head no. He turned to me and said, gotta set the mood right, you know? We just had a baby, and smirked and chuckled at me, which I did not acknowledge in any way. They got their drinks, and I was told by my coworker that the wife said she didn't like her drink and wanted to replace it.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Like, he's in such a hard place and he still is holding on to that. Like, the ego is so powerful. I need to be the manager and you need to completely shift your children's dynamic so that I can live in your house. Every aspect got wilder and wilder. This guy needs to think about other people. Oh, man. I feel bad for OP. They sound like a very forgiving person. Yes.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Because the fact that they're like, I guess I should maybe cut this guy out of my life.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I know, and his poor parent, like, I mean, we don't know, but, like, the parents cutting him off, but it sounds like the parents, like, worked really hard to try to support him for a long time. See, I'm wondering, when did Wolf of Wall Street come out? Oh, does he think he's... This gives me, like, guy who's like, I know the art of the deal. 2013, yeah.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I don't know why this guy makes me think he watched Wolf of Wall Street and he's like, here's what I'm going to do. I'm going to demand respect and I'm going to get it. Could be completely wrong, but that's the vibe I'm getting. This next story comes from Am I the Asshole? Am I the asshole for snitching on a co-worker for spitting on a customer's food?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, that's one of those things that I feel like happens in movies that it's like, hopefully that doesn't happen in real life.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
There's the family guy joke where they bring it to the newscaster and he spits in his drink and he's just like, what's in this? He's like, oh, I spit in it. And he's like, bring me the one with urine, like I asked. That's awesome. Thanks. All right, let's get into this story. Okay. Oh, okay. Sure. Tanya came back to the kitchen unreasonably upset.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Their food started coming out while the replacement was being made, and as I was dropping the new drink off, the husband looked at me and said, yeah, we got a big problem. I didn't like it. any of it.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She was complaining about spoiled people, wasting food, extra work, and things like that. The cook made a new plate of food, and as Tanya was walking out of the kitchen, she stuck out her tongue and spit little flecks of spit all over the customer's food.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I was shocked because I'd never actually seen someone do that in real life. Right. I thought that kind of thing only happened in movies and TV shows. Literally. Like I just said. I was even more surprised that she did it during a pandemic. Yeah, this came out, this is 2021. No. For some context. So probably the worst time in history. Right. Maybe the Black Plague. Like Spanish influenza.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You know, every hundred years is the worst possible time to do this. Yeah. At the end of my shift, I told my boss what I saw and he had a talk with Tanya afterwards. Now everyone I work with knows that I did this since my boss told Tanya that I saw her spit on the food. They're all calling me a snitch. Tanya herself calls me the snitch if she ever has a chance to refer to me.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She still works there? She no longer speaks to me at all. I believe even my boss isn't happy that I snitched, though he hasn't said anything directly. I just feel a whole different vibe from him now. It's gotten to the point where I basically lost all of my work friends due to snitching. I'm not sure they will ever get over this because of how legitimately upset everyone is.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I apologized and said I would be right back with my manager. I immediately went to grab my manager and tell him what happened. And as we were walking back to the table, they were gone. They left without paying their bill. We had to just comp the whole thing, but it was absolutely bananas. I've had tables leave without paying their tab, but it's never been intentional. Absolutely wild, man.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I'm considering finding a new job because it has gotten so bad. Am I the asshole for snitching? Should I have just talked to Tanya privately and not told her boss? Okay, so we have some context. OP did not tell the manager until later, so the food got to the table. That is so awful.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I will say I was a little shocked because I'm scrolling down and I see that the verdict is everyone sucks here, and I was a little confused because I'm like, no, you need to call that out. They spit in food, but they didn't. they let the food get to the people.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
They didn't do it in time. You need to stop that immediately.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Whoa! Because I was going to make a joke. Sorry! I was going to make a joke before we started this of like, oh, someone's poisoned their food, whatever. Technically, in 2021, this is effectively a bioweapon right now. It could severely harm anyone at any time and at any point. Right, you don't know what you got in there. But this is particularly, it's even multiplied more.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
These people sound like they don't have... Yeah, nightmare town. I want to know what this place is. I don't want to go. I don't want to go there. This scares the hell out of me. It's a chain restaurant. It's a popular chain restaurant. I hope it's not Chili's.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I know, the buffalo sauce has me thinking it's Chili's.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You think it's Applebee's? Oh, you know, yeah. I understand it's gotta, I mean, I've never been in these types of situations. I've never worked these types of jobs with these kinds of stakes. Literally. We'll be right back. But I know that I am someone who would feel a lot of anxiety having to snitch on someone. And I fear that I would chicken out in a lot of situations.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
This is one where I would hope that I would call it out very quickly, because that's so gross. It's so awful. I don't even know, legally, what level that is. Exactly. Because there's places where spitting on someone is assault, so it's like, what is... Like what could this be? I can't believe she still has her job. This, yeah, because everyone up and down is horrible here.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
So there's some comments. Okay. Everyone sucks here. You for letting her serve food with spit in it to a customer and waiting to report it to your manager. Her, obviously, for spitting in a customer's food over a very reasonable request. Your manager for not keeping your report confidential and not firing Tanya's ass for this.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
All of your coworkers for thinking snitching is a bigger deal than being unsanitary, disgusting, and vengeful towards customers. That is 15,000 upvotes.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Thanks. Look, I sometimes dip my fries in hot sauce, but I am someone that I don't like to have the sauce on the fries. You know? I like to have it to the side.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I would just eat it. I gotta be honest, and this is on me. I'm not saying this is right. I have too much anxiety. It would have to be so bad.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It would have to be so bad for me. I don't think I've ever sent food back in my life.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I shit you not. And this is as someone who has no food allergies, no food intolerances. When I get served the wrong, completely wrong plate of food, in my head I just go, well maybe I'll like this one more.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And sometimes I discover it's really good. I'm also not a picky eater at all. I also have everything going for me where I'm like, I don't mind that much. But if I did care, it would take a lot.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah. Uh, Yeah, like you make a scene and then Dine and Dash. And then leave. Whew, that's bold. Wow. Did you experience Dine and Dashers?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And so you just also bring.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Let them take it home for the dog. The dog. For the dog. Someone replied to that comment saying, I can kind of forgive OP for not jumping in right away. I have social anxiety, and for me to draw attention to myself in the moment for something like that would be terrifying. Yeah, I mean... I'm not viewing OP as an asshole of the caliber of everyone else. No. They're all horrible.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
For me, it's not even like an asshole thing as much as just like, here's what you should have done.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
But I understand because I'm putting myself in there and I'm like, I know the anxiety I would feel too. Because this is the result they got that they were probably scared of. And it's unfortunate that people like this also make people scared to stand up to people.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She did it as she was walking out of the kitchen, but you would have stopped her and been like, you can't serve that.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I would have done like the Disney Channel thing where like as soon as it gets down, gets to there, I'd have run over and been like, oh my God, a cockroach! And I like hit the table all of a sudden. Hit the plate off the table and I go, it splatters all over them. Sorry, I guess I was wrong. And then it's like, I made it even worse. Yeah. Other comment. Someone said, everyone sucks here.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I am a server and have been for years. I have never seen anyone do this and I work in a high volume setting with tough customers challenging us on the regular. Nobody has ever even joked about spitting on food. Your boss is an asshole for not firing her and for telling her who he saw. He should have just said he saw it on the cameras or that someone saw. It could have been a cook.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She wouldn't know. Either way, she should not still have a job and everyone who is siding with her is garbage. Yeah, 100%. Yeah. Wow. Yay. Unless it was that guy from earlier who ordered three drinks in a row. Then spit in his face. Then it's all right. And then you give him the three drinks and you go, I spit in one of these.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It's all right. I was just like, you get food and they're just like, I spit in your food. And then you're like...
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Our next story. Okay. Because I feel like the dates do sometimes matter here a lot. This came from, this is in fall of 2020. Okay. So. Okay, so we're. Sorry, summer of 2020. Okay, so we're in prime. We're in prime 2020. Annie, okay. All right. I feel like as a server that's huge. Does it say what month? Yeah, July 10th. And does it say where? We do not know where yet. Okay.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
But this comes from relationship advice. My mom's rude customer turned out to be my girlfriend.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
So clearly OP's mom works as a server, complained about someone, turns out to be a girlfriend.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
This is a 21-year-old woman who's writing in. I'm 21 and lesbian. My girlfriend is 36 and bisexual. My mom had me young at 16, so she's 37 and works as a waitress at a high-end steakhouse. I just moved in with my girlfriend two weeks ago after dating for two months.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Moving in with her is a culture shock because she made close to seven figures last year and I'm a struggling actress slash college student. So my mom is serving the lunch crowd and goes to meet a woman. This woman did not acknowledge my mom's greeting and interrupted her when she rattled off the specials.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
When her soup comes, she tells my mom her wallet costs more than what she made in a month, so be careful. Okay. She snapped her fingers to get my mom's attention but when she came without her beckoning, she rolled her eyes and said, will you leave me alone? At the end, when my mom asked if she could take her plate, she sarcastically asked if she had any other bright ideas.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
In the end, my mom went to take her Amex and saw the name on it and put two and two together. She got a very poor tip at the end of it. She said she's given me the information and that what I do with it is up to me. I am in denial that my girlfriend would be like this. She's always been sarcastic, but in a very attractive way.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
In fact, the only problems we've had is that she sometimes comes off as flirtatious to others and I get jealous sometimes because I can see she has a lot of options. When we've gone out, she's been nice to the waiters. But my mom and I have a very close relationship and are very honest with each other, and I see the thought of anyone being rude to her.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
When I asked what the woman was wearing, my mom told me exactly what she put on this morning. So when my girlfriend got home, I asked if she did anything interesting today. She said not much, and I asked if she was in a bad mood, and she asked why I would ask her. Now she's getting suspicious because I turned down sex and when I tried to talk to her again, she said she was busy.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
What do I do to confront this issue? What can I do if she was just having a really bad day and this was out of character? I love her a lot and she's been extremely generous to me, so I don't know what to do.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And a whole hour of choices. Exactly. This wasn't just a one-off thing. Yeah, full-on statements. It's like, oh man, I slipped up and I said that really nefarious, villainous thing. I can't believe I did that.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
They moved in at two months.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And there's a power dynamic of the age and experience, but also her partner also is like making...
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
So that's, I don't know, that's just throwing up a bunch of red flags for her, obviously.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, you know, we've brought up, like, age dynamics before, and for me, it's like, once I, like, in my 30s, I think back on myself at 21. Yeah, I was a little child baby. I was like, I'm thinking, like, oh, my God, what I know now to what I knew then. Absolutely, yeah. That's not to say that everyone at 21 is like... Everyone's got a different path. No, there's like... I'm not insulting that.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It's just... I don't know. It always just raises questions. Right. But the seven figures honestly raises more. Absolutely. To me. So... this is her girlfriend, her girlfriend said all of this. I wouldn't be able to move past that. And I wouldn't be able to move past that regardless of who the waiter was. Being rude to a waiter is like, that's one of those universals.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
That's one of those quick red flags. It's like, all right, we're done here. Get out of there, yeah.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I wonder, dining is such an ancient thing and it's one of the most interpersonal and personal things for human beings. It's a universal thing. It does tell kind of everything about a person, about how they act with other people there. But especially treating servers is just another part of it. I think it's the quickest way of finding out how much this person, how much empathy they have.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
How much they objectify and dehumanize people.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, and it's like, okay, this is what she thinks of a waitress there. What does she think of you? Yeah. Exactly. You know, it's like, are you just another non-human to her?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Um... Comments, there is old advice that you should pay attention to how a new love interest treats people like waitresses who are strangers to her in a subordinate role who have no lasting impact or influence over her. There is also a significant age gap to consider. Given her behavior with your mother, I think that you will see other red flags in your relationship if you examine it.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
that has 1.9 thousand upvotes. Someone said, you live together already and she's never met your mom? OP responds, to be honest, we've mostly met her friends and family. Things just happened really quickly and she's never asked that much beyond the fact that I was raised by a single mom.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I was actually thinking of arranging to go out to eat with her and my mom so they could meet each other, but my mom has a pretty unpredictable schedule and has been stressed.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Never asked, doesn't seem like she cares too much about Oprah. No, definitely not. Someone said, lots of people have bad days without being demeaning and disrespectful to others. You really need to think about if this is the kind of person you want to tie yourself to. For me, that would be an absolute deal breaker. I do not like spending time with rude, entitled assholes.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It was good of your mom to give you the information and leave the decision up to you. It really is up to you to determine if this behavior is something you can live with or not. Lastly, someone said, I'm seeing more red flags here than the fucking color guard. Wow, that's great.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, I mean, that's just kind of one of those clear-cut lines of just like... Yeah, that's just... And I mean, to that level, oh my God. I've never, I have, that's another fortunate thing of like, I have never been friends with anyone who has been rude to a waiter, but I think that would be, that'd be a deal breaker for anyone. For sure. I mean, it's just, that's just crazy. Okay. Okay. update.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Two days later. Two days laters. Two days laters? I, ooh, I worry that this could be a plot twist. Oh no. I just worry. I worry. I think they broke up.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Do you think, I'm just kind of shocked after two months of dating they've moved in together, this partner has never even seen a photo or anything of her mom.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
That makes it so much worse. I didn't think it could be worse, and it was. Okay. There was a lot of tension between me and my girlfriend after I turned down sex the day before yesterday. I was clearly upset about what my mom told me, but didn't know how to confront her. She ended up disappearing into her study after the house manager finished cooking dinner and left.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
A house manager is a hired staff that oversees operations of the home. So yeah, this girlfriend is loaded. Yeah, okay. She came out in going out clothes and didn't say anything to me. I asked where she was going and she said nowhere, just meeting up with some friends. I texted her a few hours later to ask if she was coming home to eat or if she needed a driver.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She doesn't text back for a while until she sends me back a picture of a hotel drinks tab that was in the thousands, saying she was paying for everybody. Then she stops replying to my texts. I don't know who booked the room or who she was with. I hear her stumble in at 3.30 a.m. and she reeks of booze and other random smells. She wakes up at 2 p.m. and goes to her study.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I go to her study and she doesn't acknowledge me for a good minute. She finally says, last time I checked, you were 21, not 12. Adults speak when they have something on their minds and tells me to come out with it. So I confronted her about being rude to her waitress, my mom. Oh my God.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She says that I have been sulky all week and she's been walking on eggshells since last Monday, even though I thought we were perfectly happy then. She acknowledged she was at the restaurant but said none of what I accused her of ever happened.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She said that she was served by multiple people and said that at fancy restaurants, waitresses should know to only approach when the customer beckons and she lightly recalls one of them breaking such protocol. What? When I ask who she was with last night, she says she's getting bad vibes from this conversation and tells me to leave if I'm going to be a baby. Okay. You're an adult out with it.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It's like, okay, what were you doing last night? You're a child. You're a child. You wouldn't understand. I'm pretty close to crying and she says she's been thinking and this relationship is giving her bad vibes and maybe I wasn't ready for an adult relationship and that she clearly misjudged my maturity.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I start crying and saying that she was the most successful person I've ever met and I think she's too good to be true and a long thing about how I felt she's too good to me, which scares me now because everything I said was completely from the heart. She then says that when she met me, it was like the stars aligned.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She asks if the life advice she gave me was not helping, if this relationship already was not changing my entire life forever. She reminded me that I was living with four roommates and now I live like the 1% and she's helping put me through school. Oh, great ground.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Like a good mother should. She said she even introduced me to her well-connected friends, and when she told them how I was acting, they were so sorry for her, but she told them that bad moments happen to the best of us. I asked her if she would consider meeting my mom to at least talk things out, and she said she didn't want to meet my mom right now. She wants to help improve my life.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
This morning, she told me to pick out a Dream Tote I could use for next semester and joked I was becoming spoiled. I called my mom, and she said I needed to stick to the things I knew to be true and that she's never lied to me before. But what terrifies me is how unprepared I was for her reaction. or how scared I was when she asked me to leave. I don't know what to do.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Jeez. This, like he hit every single thing. Yeah. He's doing it all. Yeah. In one go. I feel so bad for the wife in this, like the fact that she called ahead and she's like, my husband's a nightmare.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I feel ashamed that I set out to get answers and I screwed up. And now I feel ungrateful and like I'm self-destructing my life. She still works extensively with her ex-husband of 11 years and I feel like I'll never measure up to him. Okay, so much information. So much. And none of it good. No. Not a single one of it good.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
No, not at all. It's giving groomer. This is horrible. Yeah, in fact, her wealth and power is clearly only going to be used to torment you.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Exactly, exactly. I like how they basically out themselves, this girlfriend, when she's like, yeah, you're acting like a child. I misjudged your maturity. I'm like, if maturity matters to you so much, then you could date someone your age. My God. Even the phrase, last time I checked, you were 21, not 12. Adults speak when they have something on their minds. That is the most mom sentence.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah. And it's... As she is rewriting what was said in this conversation, her girlfriend is leveraging power against her. It's just like, hey, I'm having you meet my connected friends. I'm getting you through school. I'm doing all these things. It's like, if your partner is doing those things, they're not being your partner at all. They are actively, in the moment, trying to control you.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
This is... Absolutely so scary.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And, you know... You can't blame her. I mean, this is where so many people end up, right? Yeah, of course. This is what a great manipulator does to people, right? You do blame yourself. I mean, she's absolutely... This is textbook written out how people feel in these types of relationships. And it's hard to clock that of going, oh, wait, I'm talking this way. Am I wrong?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You're so convinced that you're the bad guy.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
When you're in a relationship like that, you are constantly up against the ropes, and you feel like, okay, I just gotta get off the ropes, and then we can assess this, but you're up against the ropes, and they know if they keep you there, you're never gonna be able to fight back. You're never gonna be able to say anything, or even think for yourself.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Exactly. Update number two. Whoa! Oh my god. Am I the asshole for refusing to choose between my mom and my girlfriend?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Can you hear this in the mic? All right. Can you hear this in the mic? The chair is squeaky, but it makes my shoulders look big. It does sometimes.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Depending on the shirt.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Anyways. My mom served my girlfriend at the steakhouse she worked at. She said my girlfriend, who didn't know she was my mom at the time, was outlandishly rude and that she knew it was my girlfriend after she saw the name on her card. So after that, I ended up confronting my girlfriend and we had a days-long fight, our first fight ever, over this before things went back to normal.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
However, yesterday my mom calls and tells me she's been placed on leave from work because my girlfriend contacted the owner and said that she exposed her information to a third party and that she felt her privacy had been violated. The restaurant owner happens to know my girlfriend in passing, a very distant acquaintance.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
My mom says my girlfriend exaggerated her tale to the owner, saying she rattled off numbers of her Amex card to me and also exaggerated the stuff that my mom accused her of. My mom said, since it is a she said, she said situation, she needed me to tell the owner she only described her general behavior and a few true comments that stuck out.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
An absolute horror story there. That baby. There's a lot.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I love my mom, but my life with my girlfriend is so intertwined at this point.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
but my life with my girlfriend is so intertwined at this point. We're vacationing in the Hamptons, but I moved in with her back in Los Angeles, where I'm going to college. She's helped me book acting jobs, and I only secured a future internship through her.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
My girlfriend literally got on her knees, cried, and said she worked so hard for everything she had in life, and what my mom said about her could have destroyed her, and that she didn't want to lose me. so she destroyed your mom instead. When my mom called again, I expressed how angry I was that she was giving me this ultimatum and that I wasn't getting involved.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She gets tearful and accuses me of resenting her for not giving me a privileged life. My grandma called me angrily and said that I was being a bad daughter who they didn't raise to become this. She refuses to listen to the fact that I'd be alone and possibly homeless if I chose sides. Am I the asshole?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
The iceberg, we got this, and there's a whole iceberg there that is very tragic. Comments on this. This didn't perchance happen in Chicago. This sounds exactly like people I used to wait on. OP responded, this did happen in Chicago. Someone responded, I believe I waited on them and they were regulars. Everyone hated waiting on them. The mods were asinine.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I feel like I should have the right to choose not to get involved in situations that are between my mom and my girlfriend. Am I the asshole for refusing to burn bridges when I don't have to?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You should tell the truth so your mom doesn't lose her job.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Because that is the truth. She did not, according to her, she did not give any card numbers or anything. But also, she's talking about, like, this is between the mom and the girlfriend, like, but the girlfriend took a conversation you guys had in private and took it to their... And took it to harm the mom's life.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah. This girlfriend is awful to her. Oh my god, dude. I mean, okay, like, the girlfriend is... absolute super villain level. I feel so bad for OP. I do too. Because I also know the situation, where she's in, where she thinks she's the bad guy. So she's like, oh no, my perfect girlfriend who's doing everything for me. Oh, I just gotta, I wanna stay out of this. She's not in reality.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Also, we completely skipped over going out at night. Oh yeah. and sending a receipt being like, yeah, I'm buying drinks for everyone, getting home at 3.30 a.m., not talking about it. I'm like, what even is that? It's like, yeah, you made me drink. I gotta be honest, two months into a relationship, that's a deal breaker. Absolutely. Why are we even talking about anything else?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Like, this story has so much, and I almost feel like it's part of the play of like, you build up so much That you forget the little small things of like, oh, this one thing was the deal breaker, but you've layered it so hard that I'm losing track.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, that's a good one.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, which, this is a novel of stuff. And I'm sure the comments are gonna point out even more things that we missed, because I'm losing track of everything. Okay, now, what's interesting here is the verdict on this final update is asshole. That the OP is the asshole. Oh, well, yeah.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
For being like, I'm going to stay out of it. It's like, hey.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
They're not going to call the girlfriend and be like, you lied about that. She's not worried about the restaurant. She's worried about her girlfriend. She's worried about making her girlfriend mad.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She's so lost. I hope a bunch of these comments were just like pointing out everything that is so clear to anyone who's reading this. We have one comment. You're the asshole. She completely screwed with your mom's livelihood and treated her horribly, but you're siding with your girlfriend? Sounds like you are choosing money over family.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Your girlfriend needs to call your mom's work and explain she lied, and then you need to seriously reconsider your relationship. If she treats your mom like that when she's mad, what will she do to you? This made me angry just reading it. I can't imagine how your mom feels. Most of the comments echoed this same statement. Yeah.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She's deep, she's deep. Oh man. That sucks. That really sucks. I hope she chose to help them all out. This was many years ago, so I don't know.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It makes me so sad that so many people are in that, you know? And from the outside, it's so obvious. Just leave. It's hard not to just be like, what are you doing? But I'm like, they're not, they have been manipulated out of reality.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Well, here's hoping that that turned out better, because we have no more updates. If anyone finds any sort of updates anywhere, let us know. Yeah, let us know about that. Because I'm going to be thinking about this one. All right, our final story. Okay. This comes from Tales From Your Server. I still remember his Hawaiian shirt.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
He would sometimes drink, but when he did, it was ordering three drinks in one go. Never heard the wife say anything. They did pay us in cash. They didn't have a baby at the time, but I left that restaurant in 2020. Huge bills every time. We were an Italian slash pizza spot, and they'd order pasta and salads in the most bizarre way possible.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It's been a couple years on this one, but it was still one of the most memorable days serving I had. It was maybe two in the afternoon, so the lunch rush had died. I was one of two servers on, maybe three tables come in. Two top comes in, a bigger guy in an orange Hawaiian shirt and a skinny girl in a casual dress. Guy is a bit loud, but obviously in a good mood.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Orders his drinks super enthusiastically. He's a little annoying, but friendly. The girl looks a little embarrassed, but they seem to know each other. He orders a beer, says they are going to be there for a while, and to go ahead and bring him that family's bill too when they are done. To speed this up, he ends up paying for five tables total, besides his own, while he was there.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And he told me after the first table to not point him out, just leave it anonymous. Four were two tops and all were happy, but the five top was absolutely stunned. It was two parents and their kids, and I got the impression they didn't eat out a lot, but the mother seemed on the verge of happy tears. I still remember the dad asking for the bill and telling him, yeah, funny thing, there isn't one.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I don't remember the exact numbers, but I made out really well that day. The other
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
server too he tipped me well over 20 on all other tickets and 100 on his own which his own bill wasn't even that crazy and all but one of the other tables tipped me as well he finally left when the restaurant was empty about 3 30 and he was the last table i wonder if he would have kept going we all have our share of customers we hope to never see again but i'm sad i never saw mr flaming orange hawaiian shirt guy again he was a cool dude oh that's awesome wow
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You know what? I thought they were going to explain something. It's giving like guy who just won like... That's what I was thinking, like the lottery or something. He just won a scratcher of like 100K, so he's just like, let's go out to eat. He's like, I'll buy theirs, I'll buy theirs. That's it. Incredible guy. That's awesome. Love that.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I've never had either of those. That's pretty cool, man.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yikes. Have either of you ever been tipped 100%? Or like just a really, really awesome tip?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Molly Shannon tipped you hardcore?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah. A joy on this earth.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She's amazing. That's incredible. Yeah, yeah, yeah. Love that.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Someone else said, that sounds like an elaborate dine and dash to me. Lastly, someone said, if the lady called ahead, just weird, but that's got to be helpful in tracking them down, I think. So I guess dine and dash laws vary across states. It can be a misdemeanor or a felony offense depending on what state. Maybe depending on the amount of money that you're walking out on.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Well, there are good people out there.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah, we had the choice. We were given the choice of do we want to end on positive or bad?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Well, thank you both for joining me. This was incredible. This was a blast. And thank you for watching. I'm sure we have tons of servers who watch this show. Let us know your horror stories down in the comments below. Yeah, please. I'm so curious. Your horror stories, but also your best customers ever. That would be great as well. Let's balance it out. Get some positive in the comments as well.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
As always, thank you for watching. Let us know what other themes and subreddits you'd like us to cover, and we'll see you next Saturday.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It's something that I'm terrified of, of accidentally getting up and forgetting to pay. It's never happened, but I live in fear of that.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I think back and go, okay, I did. I usually, or I ask someone else, I'm like, we paid. They're like, yeah.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I never thought about that, like the MOs of different types of restaurants. Sports bars. Sports bars.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I can't believe this person is so notorious for this that other people are like, I know this guy. Insane. Because they probably do it A lot. I just can't imagine. That's the thing. You are ruining people's day. You have to know you're a monster. I think he clearly does. Do you think he's doing this? Do you think this is a thing he gets a kick out of? That's almost what I'm reading it as.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
The three drinks in one go. That's so crazy.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Just a strange, like, that's almost like a murderer's calling card, you know? It's like, oh, yeah. And he ordered three drinks in one go.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
I'm surprised. At first, I didn't read it as alcoholic drinks, but it must be. Are you allowed to order three drinks?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Hi, welcome to Reddit Stories. I'm Shane, and today's theme is all tales from your server. These are restaurant and service industry stories. They get wild. And I'm joined by two people who have worked in the service industry, Chance and Tommy. You could say we've served before.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Ooh. Yeah. Wow. Do you guys have a specific customer that you were like, this is the worst one I ever dealt with? Do you have a person who stands out as like, that was the absolute worst table I ever served in my life? Or no, or is it just a lot of bad?
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
After it's all done, she's just like, I still hate you, though.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
to you by Audible. If you're craving your next action-packed adventure, Audible delivers thrills of every kind on your command. From electrifying suspense and daring quests to spine-tingling horror and romance in far-off realms, Audible has something for everyone. Audible not only offers thousands of titles to choose from, but also podcasts and exclusive Audible originals.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
And as an Audible member, you can choose one bestseller or new release audiobook every month to keep from the entire collection. A recent audiobook I listened to on Audible is Entangled Life by Merlin Sheldrake, which is all about fungi, and it had me absolutely hooked. I somehow loved learning about mushrooms for hours. Another favorite of mine is Mythos by Stephen Fry.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Love Greek mythology, and Stephen Fry does an incredible job narrating it. I've been listening to audiobooks on Audible for years now. I love using my credits every month on something new and exciting. It's the best. Start listening and discover what's beyond the edge of your seat. New members can try Audible now free for 30 days and dive into a world of new thrills.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
You got your viral moment out of the way. Yeah, thank God. Now we're done.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Visit audible.com slash SRRS or text SRRS to 500 500. That's audible.com slash SRRS or text SRRS to 500 500. Now, Back to the show. Our next story, also from Tales From Your Server. Woman wrote, don't be such a cunt on tip line after I denied alcohol to her underage daughter.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Okay. Okay. Very busy Saturday at a brunch restaurant. Table of 10 people. They had been on the wait list and then sat. Probably had to wait 30 minutes, but that's typical for this restaurant. A woman ordered an alcoholic drink, but when I brought it out, she gave it to her daughter. I saw her daughter drink it, so I asked to see her ID.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
She left it in the car and then she said she left it at home. This girl looked 14. I told her that unfortunately we had to take it away, but I would get her juice instead if she wanted. She was pissed. And they included a picture of... Of it to show the proof. Not the heart.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It's fine. Our art department decorated this place up a little bit with some restaurant things. Very nice.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Yeah. A star too? The asterisk at the top. Yeah. And then an X on the additional tip line. And that bill was $91. So that was not some small amount of money. But it's additional tips. So hopefully there was some... There was auto gratuity, but this is additional tip. Yeah.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
Well, even regardless of the tip, this is just very mean.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
That's her voice, by the way. Yeah. Because what she's now done, it's like, no, you were in the wrong, so you can't make the waitress feel bad for doing her job. Right.
Smosh Reads Reddit Stories
The REAL Kitchen Nightmares | Reading Reddit Stories
It sounds like she probably has had that situation happen where the waitress or waiter didn't care. It was like, not my problem. I didn't see it. Yeah. But in this case, it did happen, and you just have to deal with that, but that's such a mean thing to say.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Welcome to Smosh Reads Reddit Stories. I'm Shane, and today's theme, red flags. And I am joined by two people who are absolute red flags, Courtney and Trevor. I agree. Well, actually, that honesty, green flag.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The bar is so low, the bar is so low. I really, I'm very curious, like I'd love to sit down with a guy who says that and ask them specifically, like you're embarrassed, what do you think is going through people's minds? What do you think they're thinking?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I really, unfortunately, think it boils down, I wouldn't be shocked if it boils down to being like, people are gonna think I'm gay. That probably is. That's literally like. Okay, man.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
For buying products for women, they love that. It's so dumb. Okay, our next story. Comes from Best Predator Updates. Okay. Holy squeak. Holy freaking quack. Here we go. It's a 30-year-old man. My partner... Old! This is a 30-year-old man. My partner, a 30-year-old man, won't let me sleep, and I don't know what to do.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Okay. First off, I'll say I have sleep issues. I find it very difficult to get to sleep and stay asleep despite taking medication for it. And when I finally do sleep, I snore. I've tried so many times to fix this. Nose strips, adjusting positions, spoken to many GPs about it, nothing worked. I can't control it.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
My partner has taken to, instead of rolling me over, just losing his patience and kicking doors open, yelling, screaming, hitting the bed to scare me awake. This has started a few months ago and was super infrequent, but has now picked up and is happening multiple times a week now. I'm now having an even harder time getting to sleep. Bedtime is giving me so much anxiety.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
My body is on a hair trigger now. I wake up at the slightest noise and never fully drift off anymore because I'm just expecting to be woken up in an extremely aggressive manner. I feel like I'm at the end of my tether. How do I get them to listen and just let me sleep? I mean, it's ridiculous to be scared of going to sleep when your partner is home, isn't it? I don't know what to do anymore.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I can't just up and leave him because he's totally dependent on me financially. and I don't have anywhere I could stay. We live paycheck to paycheck. It's not like I can just sleep somewhere else and still support us. He is so angry all the time now, and I don't know how much longer I can be around him. I just want to be left alone to sleep in peace.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's two 30-year-old men. Okay. So he's saying, I can't, hold on, I don't know what to do. I can't just up and leave him because he's totally dependent on me financially, and I don't have anywhere I could stay. We live paycheck to paycheck. It's not like I can just sleep somewhere else and still support us. So it sounds like they're already in kind of a high-stress situation.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
They're stressed financially and then not being able to sleep is extremely stressful. How their partner is reacting though is super unfair and not good. They need to talk about this.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
You have to deal with a bunch of red flags to get to a place in your life where you're good at seeing them.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The red flag to me is that OP is saying that they've tried everything. The nose strips, adjusting positions, spoken to many GPs about it, nothing's worked. Like, they are trying. It's not like they're... I would understand a little bit more of the frustration if they're like, oh, yeah, whatever, I snore, you gotta deal with it. But they're not doing that.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
They're trying everything they can, and it doesn't sound like the partner... Of the information we have, the partner wasn't trying anything on their end. I don't know what other solutions there are, but you gotta find solutions instead of this.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I've been, because I have family members who are snorers, so when I, growing up and then also when I visit, and I've found for me, I can sleep through a lot of noise if it's consistent. The problem is when people are snorers who are all over the place, That's tough, because you don't know what to expect. I just don't love how quickly this sounds like this got to yelling, slamming doors.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Like, this person sounds scared. So this behavior that this other person is showing is extreme. I do think this is a major red flag to me.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Good. That is a skill that isn't talked about is like the ability to recognize green flags as well.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I don't like it. If I was friends of OP, I mean, I'd need to know more information, but based on this alone, I think this would be like, hey, this is abusive. This is a problem.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Nightmare, nightmare, nightmare! And I mean, yeah, because yelling is just never okay. Comments, someone said, you leave. This is abuse, plain and simple. Sleep deprivation is a torture tactic for fuck's sake.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think it's just one of those things, though, if I were to talk to OP, I'd be like, hey, your partner's supposed to be someone who cares about you and you trust more than anything, and you are on edge and scared of your partner. So are you really even in a relationship right now?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah. Yeah, thanks everyone. I'm a pretty good person. Hey, way to go. Thanks. Let's get to this first story here.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Oh my God. My sleep paralysis therapy.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Someone said, have you been evaluated for sleep apnea? That is often a cause of snoring and can be a serious condition. OP said, I am in the process of trying to get my GP to assess me for this, as I do fit all the criteria. We're doing the let's check off and rule out other options part before they'll do anything.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I've never made an update to a post before, so I'm not sure if I'm doing this right. Please let me know. I posted well over a year ago now, closer to two years at this point, about my sleep snoring issues causing aggression from my partner, and some people seemed really concerned for me in the comments, so I felt the need to update just so people know I'm okay.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
So to update, not long after the post, I sat down with him and explained how upsetting his behavior was, and he changed it. We aired our grievances, did some reflecting, and realized it was unsustainable, so we implemented changes and it worked. Isn't it wild how communicating can fix problems? A lot of people wanted me to dump him and leave, but we have been together for years.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I wanted to give it another try to see if we can find a solution. The first change was sticking strictly to separate sleeping areas and sleeping separately helped so much. Seriously, we are so much better rested in our own spaces and our sleep routines aren't being disrupted by each other. Also fun sleepovers with no sleeping, haha.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Sleep deprivation was making both of us crazy stressed out and we were not handling it well, him in particular. I've reached out to my GP since and am currently still on a waiting list for a sleep study to confirm sleep apnea, which is not ideal. but at least there's movement there. I love the NHS but don't love how long these wait lists take in my area.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Green flag anyone? This comes from Am I the Asshole? My boyfriend refuses to buy me female products, pads, and now I'm upset. Dude, that shit's gross.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He also started therapy soon after my post and we found out that he's autistic, which we suspected before but didn't know what to do about. He got diagnosed and really dove into resources on the topic and we both learned so much about how to deal with it. He's done so much work on recognizing and coping with being overstimulated.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, the loud snoring, extra distressing for him with his sensory issues. He didn't understand how to identify. and redirecting his anger into healthier outlets. He's now trying to get me to get assessed too. I'll say something like, where are the scissors? The way this thread is hanging off my sleeve and touching my arm makes me want to peel off my skin.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
And he'll just hold up a book on autism and point at me like, which is fun.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
And on our financial situation, I mentioned in my post, it flipped. He found a job and then I lost mine. So we're no better off on that front, but sleeping and as a couple, we're doing so much better. I want to thank so many commenters on my first post for helping me realize it was not healthy or okay for either of us. We're still working on it, but we're in a much healthier, happier place.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
All right, green flag.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That's a great ending to that.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That's awesome. Yeah. It's a feel-good one.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, and I'm assuming with all their conversations, they've really talked more about that. It seems like it. And it's an ongoing process. And this post was made two years after. So maybe there was a lot of things that happened, a lot of conversation.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Our next story comes from Relationship Advice. Husband, who's 35, bought me, 31-year-old woman, the same earrings I have worn daily for the last two years.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I'll make it short and sweet. Me, 25-year-old woman, and my boyfriend, 28-year-old man, have been dating for over three years. Yesterday, we had a conversation through text about him going to the supermarket to get pasta because we were having people over and I was going to cook. Mind you, he gets out of work before me and the supermarket is three minutes away from home.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That's such a guy thing to do. Okay.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
My husband and I are in our third year together. Got married legally last year. Our wedding is later in 2025. I have often pointed out to him that I love sweet gestures, such as receiving meaningful gifts when the occasion arises, versus a gift card or generic item. I went out of my comfort zone and asked him directly if he could buy me earrings for Valentine's Day this year.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He said yes, and even asked for some brands he can look at. I gave him some suggestions and let him pick for me. He gave me the earrings today and it's the exact same pair I have been wearing for the last two years every single day. I've worn them the day I first met him, the day he proposed, the day we got married on paper.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I couldn't hold back my honest feelings that I felt so invisible to him, that my doubts of him not caring about the little things were just confirmed by this. He got upset at me for getting upset at him. Fellow ladies, how would you have felt?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Hey, I'm gonna take a back seat on this one. I feel like we need more information. I want to know what he was, because I think, so she's saying that he was unaware that those were her earrings. Did she say that? I think that's what I'm inferring, because she's saying I feel invisible. God damn. That's my interpretation, is that she's like, you didn't even realize that these were the same earrings.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That's what I think she is thinking and saying, as opposed to, oh, you bought me another pair of these earrings because you know I love them, so... Yeah. Want to just, uh...
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
They're married. They're legally married. They just haven't had their wedding yet.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, she went. Because the chances of him finding and buying the same exact pair, she only wears one pair of earrings. The chances are pretty astronomical.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Everything was fine until I got my period right after I was about to leave my job and go home. I texted him to please grab some pads for me. And his answer was, I'm not doing that. Then I said, I'm going home. They're on the personal hygiene aisle. I need them. His answer was, so go get them. And I replied, aren't you going to the store? He said, yeah.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
In this case, too, she's talking about that she wears one pair of earrings. It's not like she has a style. It's not like she has a variety. She wears one pair of earrings every day. And then he bought that exact pair. And then he did get upset at her for getting upset at him. Yeah. There's a lot going on here. Some comments, I don't buy men are like that and they don't notice things.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Men notice plenty when they want to. They can recite the stats for their favorite teams or their favorite players among other things. I would have been disappointed too. Someone else said, don't buy into the whole guys are just like that thing. My partner hinted at having a note on his phone of all the things I excitedly talk about maybe getting and is actually excited about my upcoming birthday.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I would also be upset by such a letdown. Someone else said, that would have hurt my feelings a lot. I think you're justified in feeling upset. It's also concerning that he got upset with you for getting upset with him. You should be able to express your feelings without him turning it on you. I think you expressed yourself well in this post.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Maybe you could write him a letter about how it made you feel. That gives you the opportunity to air out your feelings and hopefully it will feel less confrontational for him.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, to feel seen. And she's saying she feels invisible. Yeah. And I... It's one of those where I wish I had more information is that I'm like, you feel invisible and I don't believe it's just from this singular event. That's what's tough is I'm like, you feel invisible in a relationship is a big deal. And she's like, yeah, this confirms my fears. It's like, what else is going on?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Hi. Hey, Shane. How's it going?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
OP left a comment. They said, Okay. And that's the end of that. We don't have an update or anything. So... I don't know. I think if he's really sorry and he changes things,
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
So I replied, I'm telling you to please get it for me. And his answer was, I said, I'm not doing that, but you keep asking. And I ended the conversation by saying, okay, thanks. Then he said that we shouldn't have people over tonight, which made me more I ended up getting them myself while having pain and a bunch of toilet paper wrapped around my panties to not make a mess.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Like. Yeah, it's true. And it doesn't sound like, it sounded so simple. She wears one pair of earrings. Yeah, she sent him links for other ones. So it's an interesting blip. And I do think it's something that has been so normalized with men, right? Where we go, oh, well, men are just like that. They don't notice whatever. And it's like, no, don't accept that. You don't have to accept that.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It doesn't sound good.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's interesting how even from small Reddit stories, you can get this vibe of like, do you actually really like each other or is it you're tolerating each other? It's like, oh, this is good enough. Like, yeah, it's fine. You wanna be in that?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I just think it's like, this is not an inherent guy thing, right? It shouldn't be, oh, well, guys are like that. It's like, no, this is an individual by individual thing. It's been normalized, so we accept it, but you don't have to make that normal for yourself. All right, our next story comes from Am I the Asshole?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Am I the asshole for refusing to remove a tattoo related to my ex for my current partner? Ooh, I've never read a story like this. This is a 24-year-old man. My girlfriend, who's 29, and I have been together two years. I only have one tattoo. I got it when I was 19 and it was given to me by my ex-girlfriend.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The tattoo, while it's not directly about or for my ex, she was the person to tattoo it on me. It's a small, minimal tattoo. My ex and I never broke up. She died unexpectedly in an accident. I was 21. I haven't been in a serious relationship until this one I'm in now because I've taken time to overcome the loss and all the associated trauma. To me, my tattoo holds a lot of meaning.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It extends beyond the relationship I had with my ex. I've tried to explain that to my girlfriend, but her thinking is black and white. If you're over her, just get it removed. Can't you do this for me? Don't you want to move on? It means you're stuck in the past. These are some of her arguments. Am I the asshole for wanting to keep my tattoo? That's a huge red flag. For one, it's a minimal tattoo.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I always say, it's not what you say, it's how you say it. If he feels uncomfortable, he could have said, I'm sorry, but that makes me uncomfortable so I won't be able to. And I could see it with a different perspective. However, he is 28, and I think it's a very immature thing to be embarrassed about. And before you ask, this was my second time asking him.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I mean, regardless, it's his body.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, same. But ultimately, this is one of those situations where If you're with someone, they have a tattoo or anything that they have with their body and they go, this is my choice, I'm doing this. You kind of have to be like, yeah, all right. Or if you have such a problem with it, then don't be with them.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
There's a lot that I would maybe, there's a lot that I would maybe understand, and I think it being tied to trauma and grief changes it entirely, because it's not just about the ex, this is about a period of time in his life. This is probably about a huge moment for him, and you know, yeah, it was an ex, but it was also like, that's just someone who meant something to him.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Little layers to that relationship.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
And I don't like her. I don't think she should be presenting him with tons of arguments, and I don't like her arguments at all. Can't you do this for me? Don't you want to move on? It means you're stuck in the past. I mean, this is manipulation. It's just really, really insensitive and shitty.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The verdict, not the asshole. Comments, not the asshole. Demanding someone remove a tattoo in general is a pretty crazy demand. If it's not specifically a name or very obvious symbol of her, there should be no reason for someone to even request it be removed or covered. Your current girlfriend seems very insecure. OP responded saying, exactly. It's not directly anything to do with her.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It is. It's a morning. This is our first video up today filming. I don't know if you guys can ever tell the vibes, depending on if we're filming at 8 AM or 6 PM. I feel like you get a different flavor.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The first time, he got it for me no problem, but we were living at his mom's house, which she used to do everything for him, so at this point, I think she was the one who got it.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's just that she gave it to me. Even when I had it done by her, it was a tattoo I was getting for myself. And while it did take on the added meaning of being something that exists in a world where she no longer does and will always be connected in that way, it's not something to be competed with. I wish I'd shared the deeper backstory about my tattoo with my current girlfriend earlier.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think I took too long in establishing this side of my relationship with her, having her earn my trust before letting myself become vulnerable to a point where I could share traumatic memories with her. All for her to say, remove your tattoo. Shaking my head. Maybe I'm an idiot and I don't know how to spot them, but I genuinely saw no red flags.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
This is our only real issue in our relationship, but unfortunately, it's a huge one.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
an issue like in other ways this partner their version of setting boundaries and having things done for them is controlling I also think you know I'm not I'm thankfully not very experienced with grief but grief is a huge deal in how people deal with grief is always very unique and different by the person and you need to be very respectful of how they have dealt with their grief and whatever they've done and whatever they're currently doing and
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
As he admits, he's like, it took me a long time to feel vulnerable to share this, of course. And the second he does, her response is, well, just get rid of that. It's like, damn, that's, I'm frankly shocked he's still staying in this relationship. That's a huge thing.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Someone else said, she didn't even mind that tattoo until you told her your ex did it. Yeah, she's selfish and bad news. Opie said, so you're correct. She did have some concerns even before I told her my story. She worried how my tattoo would be perceived specifically by her parents because tattoos historically have bad association in my culture. But it's not a big tattoo.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's very clean and not visible when wearing most clothes. She knew about me in my past. She knew everything. This tattoo is the least bad thing about me. But to her, it's the most intolerable. Someone else said, I'd reserve judgment on this. OP, do you talk about your former girlfriend a lot? Does your girlfriend feel like there's a ghost in the relationship?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
OP said, I didn't talk about her at all until recently when I decided to open up and share the story about my tattoo. And that's when the remove your tattoo stuff came out. It's not a part of my past I bring up easily or want to visit or talk to people about beyond what's necessary. And sometimes I wonder if I should just keep it to myself and not tell anyone at all. Hmm. Update. Okay.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I've never understood why guys are, like, embarrassed by the notion of buying pads. Because my takeaway is if a guy at a supermarket is buying pads, what people are going to think is, oh, you have a girlfriend or a wife or something.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Thank you everyone for answering my question. I talked to my girlfriend and even though I've explained the past, I tried to explain again one last time, thinking maybe if we could communicate our feelings more clearly, we would get past this misunderstanding. I explained my tattoo is personally meaningful to me in a way that has nothing to do with my ex.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It doesn't mean I haven't moved on or that I'm stuck in the past. Oh my god. I broke up with her because I can't take her fixation with my tattoo anymore. All right, yeah. Holy crap. Okay. What?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
With all these Reddit stories we read, every time they're like, there's no issue besides this one thing. And then something happens where it's like, I think there's issues besides this one thing. Mm-hmm. That is unbelievable.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That is a lot of bad. If when you drink, that's your tendency, then okay. Holy crap. Wow. God.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That's actually not a red flag anymore. You've made it to the thing. No, that's the red castle. You've now made it to the ship that you're... You've done a crime. That's a red flag.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
No, it's the unfortunate times when Reddit stories go past asshole conversations and it's like, oh, they're a criminal.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Like, hey, buddy, come on. They're like, I think you're the asshole here. Oh, my God, that's horrible. That's awful. Well.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
They got out. I'm sad that they did give this person a shot, and then they turned around and did that.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Fully press charges. They have evidence of it. Moving on from that nightmare. Comes from Am I the Asshole. Am I the asshole for not giving my girlfriend my social security number so she can run a background check on me? All right, interesting title. Let's get into this one. I, a 27 year old man, have been in a relationship with my girlfriend who's 31 for almost a year now.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
But I'm like, what do you think people, I just don't know what they think people are going to think. Yeah. Right? Like, what's the inference they're expecting?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
This evening she sat me down and said she needs to have a serious conversation with me and she asked for my social security number. I said absolutely not, why would you need that? And she told me about her ex-boyfriend who was basically living a double life.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He had a bunch of criminal charges in his past that he'd never told her about and eventually exposed her to some sketchy and dangerous behavior before she broke things off after he cheated. I said, okay, thank you for telling me that, but what does that have to do with my social security number?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
She said ever since then, she's had her friend that works for the federal government run background checks on people to make sure they're safe. And because our relationship is progressing, she needs to know I'm a safe partner for her. So she wants my social security number to check my criminal history. Now, for the record, I don't even have a parking ticket. I'm a nerd and a gym rat.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
All I do is work, go to school, play Dungeons and Dragons, come home, watch anime, rinse and repeat, so I don't care about a background check. She won't find anything, but I'm not giving out my social security number. I don't feel comfortable enough providing that to her friend. When I said that, she got upset and said I don't understand what women go through and it's about safety.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
And I admitted she's right. I have no idea what women go through, but that doesn't mean I'm giving my social security number out to a complete stranger. She says he isn't a stranger. He's one of her best friends and married to a close friend of hers. And I said, honey, that's great, but I don't know him. I don't trust him because I don't know him. That's my information you're asking for.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
You can trust him with your personal information if you want, but no one I don't know is getting my social security number or critical details. It's just not happening. And she said that our relationship isn't going to be able to progress unless I give him my social security number because she needs to know that she's safe and she's offended that I don't trust her taste in friends.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I got up and left at that point and told her I respect her concerns, but her past trauma doesn't give her the right to try and strong arm me into giving out sensitive information to someone I don't know just because he works for the federal government and has access to a database.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I used to work for the federal government so I can say from experience, everyone working there isn't some wonderful person. I'm not assuming he's a monster or anything, but just working for the feds doesn't prove anything to me. She called me insensitive and hasn't spoken to me since. Personally, I feel like she was gaslighting me into giving her what she wants, but I'm not sure.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah. And you know that cashiers are seeing crazy shit all day. Yeah. They don't care. They truly don't care. Yeah.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, he's paying the price for what her ex did.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, yeah. I agree with what you're saying, that this is not a environment for a healthy relationship. This amount of distrust, she's clearly gone through a lot. It must have been horrible what she went through, but like,
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
This is not gonna solve it. I also, the unfortunate reality is like, not all monsters have a criminal history. You know, he might have a completely clean record and is still capable of horrible things. I mean, anyone who watches true crime documentaries knows, it's not always like, oh, the signs were clear. It's like, no, sometimes it's like, oh, he was the most loved person in the community.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
You know, it's like, that's not going to solve this problem.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think what I think is fair when people, because she must have gone through so much, and I feel sorry for her, but what I think is the healthy thing that happens is people go through a lot in a relationship, and then in their next relationships, they're like, hey, I've learned where I draw my lines, and I will not tolerate, like, any sign of this thing. Yeah, like, there's steps.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
And I'm like, I understand. That's fair. That's great. It's like, hey, if you do anything sketchy or anything that... makes me feel in harm's way. This is over.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's a lot of steps.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The verdict is not the asshole. Comments, not the asshole. I just had a background check completed. I've had them every five-ish years for the last 20 because I volunteer with children. Some in-state, some federal. I also have been screened by the government for a permit several times. I have never had to provide a social security number.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Sadly, I think your girlfriend may be the criminal and you may be her long con mar.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Someone else said, her government friend is committing a felony. Not the asshole. You won't know part of this. That's crazy.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I was thinking, I'm not too aware of federal crimes. I am. A federal employee is not allowed to be doing that on the side.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Lastly, someone said, not the asshole. You don't even know if she's telling you the truth. She could be stealing your social security number for all you know. Run, run away. Clearly she isn't willing to address her trust issues. She needs therapy. Assuming everyone is a criminal and you need proof otherwise is incredibly toxic. There is the element that she's... actually the dangerous one here.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, I mean, there's a lot of steps. Like, she could talk to his friends, talk to his family. They've been dating for a year. Like, I feel like at this stage, she could be like, hey, I wanna, like, sit down with, like, some of your friends and, like,
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's just crime, crime, please be crime, please be crime, please be crime. Crimes!
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
After reading the comments I've been getting over the last few days, I decided to call her on New Year's Eve and give things one last chance because I'm the type of person that needs to know I did everything I could before I walked away from a relationship. And some people said she has valid concerns, she just went about them the wrong way, which made sense.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I told her I understand and respect your need to ensure your safety, but I'm not willing to potentially compromise my safety to make you feel safe by handing over my social security number to someone I don't know and don't trust. And it's illegal for him to even use a federal database for personal reasons. So that's out.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
But what I will do is pay for a background check of your choosing so long as it's a legitimate service and give you the results. I will not be providing my social security number to anyone, but my address, date of birth, et cetera, are all fair game. She refused and said that she has chosen a background check and that's having her friend do it because she knows that she can trust him.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
So I said that if that's how you feel and you won't budge, then the issue here is trust and I'm not willing to stay in a relationship with a woman that doesn't trust me because of some shit that doesn't have anything to do with me. Oh, okay. then I'd have no problem doing this because I don't understand how vulnerable women are in society.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
So I said I was willing to work with you up to a reasonable point, but now you're just trying to manipulate me and I don't feel safe being with you anymore. Because if this is how you react when you don't get your way about having my social security number, What happens the next time we have a major disagreement or a serious situation come up?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Are you going to keep crying to try and get your way or throw out another ultimatum to try and force me into doing what you want? She started saying that as a man, I can't understand what it's like to go through life as a woman and have to be afraid that this is what she has to do for her safety and security. And I need to just respect that and give her what she needs for her comfort.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I was like, I tried to compromise. You wouldn't accept that. There's nothing more to say here. And to be clear, I wasn't exactly calm. I have severe anxiety. So this was a really, really hard conversation for me to have. I was actively pacing around my house and sweating and forcing words out the entire time.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Then she started crying and asking about New Year's because we were supposed to spend it with her parents. I said, you should have thought about that before you tried to strong arm me into getting your way. This isn't a, and everyone stood up in a plotted moment. That's just how things went. I hung up and now we're over.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Obviously I'm hurt, but I'm realizing I dodged a bullet because there's no reason shit should have gotten this fucking messy. And before anyone tries to jump me in the comments, again, I offered to pay for the check, but she refused because it wasn't the test she wanted. I feel like I made a good faith effort to resolve things.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I hate to ring in the new year without a kiss under the mistletoe, but it is what it is. I don't know if she really is that concerned if I'm some lunatic criminal or if she's trying to scam me like a lot of you said. Either way, it's over now.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, and it makes me think about how in relationships, oftentimes when people are cheating on someone, they are then very suspicious of that person cheating on them. Mm-hmm. Kinda makes me think, like, she's so certain that he's gonna be a criminal and be scamming her, dangerous to her, it's like, is this projection? Are you scamming? Are you crime?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Are you crime? Are you crime?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Either way, I think he made the right call. This was not going to work out.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah. So what are your guys' social security numbers?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That has to suck if you get an absolutely radical social security number and you can't tell anyone. Fuck, I want to tell you myself. It's so sick.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I didn't. I know. That was awful.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I remember, I no joke, when I was like 18 and I had to start like knowing it, I remember being like, God, I have to remember this number. I'm like, I should get it tattooed on. How easy it would be to just like steal my identity. All right. Our final story. Last story. Our last story comes from Am I Overreacting?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Am I overreacting after I found out my boyfriend's online friend group I became part of two years ago has been just him the whole time?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Oh my God. I guess I should have been less oblivious, but since a little before we started dating in 2022, I was added to my boyfriend's, just friend at the time, three-person Instagram group chat with what he explained were some of his closest online friends.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The two other accounts seemed like real people because they had real followers and comments on their posts and drastically different aesthetics looks to them. We eventually made a Discord server for us that alone was convincing enough since multiple times we'd all be active at the same time. We never voice chatted, but I used to never voice chat either, so I didn't think twice.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The group got closer and last month we got together and planned a research trip to Hawaii for August. We live on the east coast of the US. Like, we booked everything. So imagine my surprise when I'm over at his house tonight and his computer is open and I just want to log into my Google Docs when I accidentally stumble across follower bot sites.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He was logged in and chatting with me as one of the individuals I thought had become close with. I just got this sinking feeling. I didn't jump to the idea that they could be fake either. I was like, maybe he just has their login since they're all so close and is way too interested in their messages.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
but then I noticed their only chats were the group chats and the server, and the real kicker was the email address it was signed up under was his backup email with his full name. I quite literally snooped until he got out of the shower and caught me, which I'm not saying was right of me, but I couldn't help myself.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
During my snooping, I gradually became devastatingly confident that he wasn't behind just one, but both accounts. I've never seen his face so red and he just absolutely panicked and started shouting at me to get out of his business. I couldn't even form the right words to say to him. In the end, I just walked out of his apartment sobbing.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's very early in the morning, I get that, but this screenshot is what he has to say and I'm starting to feel crazy. Am I overreacting about my discovery? Here's a screenshot of the OP and boyfriend's conversation. She says, I just want to know why. When it finally came time for the Hawaii trip, how were you going to explain that? What were you thinking?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He says, you know something I've noticed about you? You can never just be calm and there always has to be an issue. I know you were raised in a volatile environment and still have to relearn a lot about healthy relationship dynamics. but it's like you thrive on chaos only. And we were gonna see Wicked tonight. I guess there that goes. She goes, you can't be serious. I deserve answers.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I am honestly so creeped out. Basically half my life for the past two years has been a complete and total lie and you were behind all of it. He goes, okay, don't be dramatic. You know this isn't a big deal. You're just giddy to harp on this and make a bigger issue.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
You need to block him and never talk to him again.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Can I say, it's one of the... Okay, one of the... A red flag that I used to ignore that is such a big red flag is whenever you communicate or even like an argument and you're a partner or someone goes, oh, well, we were going to do this. I guess our night's ruined. Like you ruined our night because you communicated. I'm like that to me is such a like do not use it. You're punishing someone for it.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Right, and we were gonna see Wicked tonight. There that goes, I'm like, fuck you.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Me, myself, and I have great conversations, okay?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
You're out of the group. My friends don't like you. Sorry, you're off the Hawaii trip.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Was he going to dip out at times and come back with a mustache and be like, oh, I keep missing him.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think we're also probably missing a lot of information here because she's just reacting. This means that these friends probably had individual conversations with her. This was always a means of probably manipulation for him to get information out of her, to know everything about her that she maybe, he feels she wouldn't share with him directly.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
The first time I bought condoms, I remember being so embarrassed and so nervous and just being like, oh my God, this is crazy. And I of course go to the cashier and I just have the condoms there and I probably bought some other things just to be like, and just, you know, other stuff. But they of course, like some sort of like, not an error, but something where they had to then ask for assistance.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think, unfortunately, she's gonna look back and find that this is so much worse than she thought.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
This to me is immediate, immediate block and don't ever talk to this guy again. Comments, yeah, this is not okay. I'm blown away that this is actually real because what? How could someone do that to you, your partner of all people? And like, was he ever planning on telling you or just letting it ride out? What does he gain from this?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
So many things running through my mind, but the most disgusting factor is how he responded to it. And it honestly sounds so manipulative, like he's deflecting instead of owning up to his actions. I'm sorry that you're going through this. Someone else said, I'm trying to think of all the problems. He gaslit and is actively gaslighting you. He catfished you.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He generally manipulated you, and now he's going to spin. It's not a big deal, and if it doesn't work, he'll pivot to just a joke, or I did it for you. I would love to have a therapist weigh in on the tendencies and what they could mean. The guy is unwell. Distance yourself, and based on his access to bots, change passwords on everything. Go to accounts and check logged in devices.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I'm not joking, not overreacting. Someone else said, am I understanding this correctly? You, your boyfriend, and these other friends were all planning a trip together to Hawaii? Like, what was the plan there? How could he possibly have explained that away? All right, update. Oh my god. Tiny little update. Okay, just got this. He still hasn't explained himself essentially at all.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I am going to take the advice of the majority of the comments section and block on everything. Thank you so much for all of your kindness and support. I have not slept at all as this is such a bizarre situation, so I appreciate you all. Screenshot of OP and boyfriend's conversation. So he sent her a text. at 6.21 a.m.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
saying, do you want to get, he sent a text saying, do you want to get our tickets off the AMC app or buy them at the theater?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Are all of them gonna go or just?
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
No, it's scary. I'm glad she's blocking him on everything. I hope she just gets as far away from him as possible. I do think she should change passwords. I mean, that's extreme behavior, and I don't know where else that can... Move on to... That's, once again, past the red flag. Yeah. That's just... That's crime. We're there. Yeah. That's scam. We're at the destination. Woo!
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
So they literally held up the box. They're like, hey, what's the deal with this thing? Can I get a ring up on this? And just there, just holding it up for the world to see.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Wow, these were some wild ones.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think what makes me sad is how extreme these situations are. And yet people still need to go on Reddit and get clarification from other people of like, hey, am I overreacting? It's like... What? You needed to get a second opinion on that. That makes me feel sorry for so many people, but I know there's so many people out there who tolerate so much.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I really think, I think so many of these conversations, it was red flags, but I think the theme today was like trust. And I think if you're in a relationship and you don't trust your partner, that's a huge problem. That's like the number one problem, right? Because you cannot move forward when you don't trust your partner, whether they've done something or not.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Because the lady with the social security number, it's like, hey... that you can't function in a relationship with this, but it's also why lying to me is like the biggest deal. If your partner lies to you and the bigger that lie, it's like, how do you, can you move on from that? Because without trust, it's just so hard. Thank you both for being here.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Thanks for having us. Hey, you guys are green flags.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Hey, dude. Give us that social security number.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
All right, well, thank you for watching. And a reminder that last week we did our live show and you can still watch the VOD. It's still available until March 23rd. You can get tickets at live.smosh.com and go check it out. It was a blast, I'm certain. We haven't done it yet as I'm recording this, so I hope it was good. But thank you for watching. We'll see you next Saturday. Goodbye.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That's what I've always meant.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Pretty brutal. That is different for sure. Our fans don't know that any of us have sex. They don't know that. I think we were testing babies. That's going to be shocking for them.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Some comments on this. If a dude cannot fathom the full extent of what happens in a vagina without being an idiot about it, he has no business entering one. Not the asshole. Find a boyfriend who respects women. Get that comment. Green flag. Yeah.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Someone else said, someone who's not adult enough to buy something as trivial as pads or tampons isn't adult enough to be in a relationship. Someone else said, your boyfriend sucks. It doesn't happen often, but now and then my wife needs me to pick up pads or tampons when I'm out. Like any reasonable guy, I do it. Yeah, it's one of those things where, you know,
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
All right. So I have heard that these stories are going to have a lot of red flags. Green flags might be a little more rare. But we have the flags there if we ever so choose. Feel free to raise them whenever you want.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Reddit often jumps to like, get a new boyfriend, break up with them. But I have a hard time believing that this is an isolated thing. That this is probably, a lot of his behavior is probably reflected in this. And it is also something of like, do you wanna live with that forever? A person who's not willing to do something for you, as simple as this, I'm sure that's gonna,
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
be the case for bigger things. They're going to be bigger ass. Exactly. And it's just like, he's just not on your side.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah. Today's episode of Red Stories is brought to you by ZocDoc. Have you ever tried to see a therapist who only takes appointments in the middle of your workday or driven over an hour to see that one specialist who's covered under your insurance? You shouldn't have to settle when it comes to health care, and with ZocDoc, you don't have to.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
ZocDoc is a free app and website where you can search and compare high-quality in-network doctors and click to instantly book an appointment. You can filter for doctors who take your insurance, are located nearby, are a good fit for any medical need you may have, and are highly rated by verified patients.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
And appointments made through ZocDoc also happen fast, typically within just 24 to 72 hours of booking. You can even score same-day appointments. I've used ZocDoc before. I've had periods of time where I definitely need to make an appointment, and I really struggled to do it until I had ZocDoc. It made it so much easier.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Stop putting off those doctor's appointments and go to ZocDoc.com slash pitreddit to find and instantly book a top-rated doctor today. That's Z-O-C-D-O-C dot com slash pitreddit. ZocDoc.com slash pitreddit. Back to the show. Update. Update, he died.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Throughout the stories.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think we're about to get a lot more info on this guy. That's exciting. Yeah, have the red flags ready.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
We had a conversation last night, very long one, and I said everything I needed to say, including reading those text messages out loud to him, and he was in any way defensive. He called himself an asshole and recognized that what he said was really fucked up. Here is a breakdown of his answers. His vapes and his vape ran out so he did warn me in the morning about nicotine withdrawal.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, man. Shut up. That's crazy. I don't have to wait to be called upon. Free reign.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
So he said he was dealing with that all day and it made him irritated.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He said the supermarket he went to was a small Italian supermarket, and they didn't have personal hygiene products. He said his mother never talked to him about this stuff. He had a past relationship, but it was a short one, and he said that he was never asked to get this before. He said, I didn't know it was an emergency, otherwise I would have gotten it for you with no hesitation.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
He also admitted that it is not that he's embarrassed, he just feels social anxiety. Then I explained that there's a self-checkout. He said the last time I asked him to get me pads, he was at BJ's, and even though it was his first time, I sent him pictures of what I needed. He felt anxious, but since I said it was an emergency, he got it anyways.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Okay, man. I... I think, you know, he called himself an asshole. He should have just been like, okay, I'm sorry, next time I'll get him. That's where that can end. Yeah.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Do you think you both are good at catching red flags at this point in your life? Yeah. Okay. I think so.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think this is one of those situations where he's 28, she needs to expect him to be this way forever.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's also, I don't need to know about this stuff. If you tell me to buy something, I'll be like, yeah, I can go buy that.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I feel like all you need to do is just be like, hey, send me a picture of the specific brand. Send me a picture of the box, and I'll get that box.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
There was an edit apparently in this where she admits that there was one time where he had an emergency and she had to wipe his ass.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Yeah, my red flag is raised here. No, if someone wipes your ass, I think you owe them to buy them.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
That's... I think at that stage she needs to reflect on the give and take of this relationship because she is doing a lot for him. Hold on, here it is. Here's the words. I would like to add an anecdote. Two and a half years ago, he had a horrible accident while skiing, fractured his right leg, and dislocated his left shoulder so he couldn't move at all or shower and even pee or poop.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Guess who helped him with all that? Me. So she has, that was six months in that she was doing all that for him. And now, after all of that, he won't even go buy her pads. I don't know, man. That's tough.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
No. You don't have to worry about the cashier judging you. The cashier's thinking about how much they wish they could have a chair.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
Tell me I'm wrong. Every cashier in America's like, I just wish I could fucking sit down. It's some bullshit.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
I think I used to be a lot worse at it. I think actually, worst of all, there was a time in my life when I would see red flags and then choose to ignore them. And I'm talking about in my personal life. And that's kind of what I'm regarding here is just like in your own personal relationships and stuff of just not recognizing it. But I think we've all gone through that. And you kind of have to.
Smosh Reads Reddit Stories
Don't Ignore These Red Flags | Reading Reddit Stories
It's so funny, too, because it's, maybe this is, I don't think this is fucked up to say, but it's one of those situations where male insecurity, they do this thing where I'm like, be a man and buy them. Like what the hell? You look like a baby because you can't do this.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Hello, and welcome to Smosh Reads Reddit Stories. I'm Shane, and today's theme is weddings. And I'm joined by two guests who are married.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's one of those insults, I mean, almost any version of what the sister said to the fiance would have made her look bad, right? But boring is such a specific insult that I think makes, if you're calling someone boring, I think it always makes you look immediately horrible.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Because it's like, that's not really an insult. That's just you being a bully.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I just wish she was you. Anything is believable. It's possible she's just jealous of her sister. I mean, that's possible. I mean, there's a million possibilities. It doesn't really matter what the reasoning is when you're doing something so shitty like that.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
In-person tickets might be sold out by now, but you can get your tickets at live.smosh.com. The live stream is going to look incredible. It's going to be like you're there. And I hope you join us. Anyways, let's get into the show. So, weddings are notoriously problem-free.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
That's, you know why it's hard for me to imagine? Because it's so out of character for my siblings.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, it'd be really hard to go and be happy for them because this is diabolical.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I'm going to make sure people don't go.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
In her situation, whatever she wants to do is within her rights to do. And I mean, if she doesn't want to go, she doesn't have to go. She does not owe her sister anything after that. But it's always interesting when people talk about family stuff like... it's hard, you can't like judge what people decide, you know, because I know it's so hard.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But if, I think people should have the right to make that decision to be like, I'm not going to this wedding. It's like, yeah, you don't have to go because that's horrible. Like, is your sister even going to go to your wedding? Like, it's the science point to know.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I will say, even if she goes to her sister's wedding, it's now more of a question of do you let your sister go to your wedding?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
What is she gonna do at your wedding? So true. That's more the fear there. Comments. I think, and this, that's true. It is absolutely true. And I think the trend that I've seen at this stage with families, because they're always trying to keep the peace, there's always the sibling that is doing the chaotic thing or doing the horrible thing, but the family never goes after them.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And it might be because the family knows, like, oh, we're not going to, We're not gonna get through to them. We're not gonna be able to get through to them. But we do have a sibling who is, or a kid who has a little more logic to them, so we can make sure that they just deal with the bullshit. Be the punching bag, because we can't deal with the person who's throwing all the punches.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Someone said I don't think the sister is so much in love with mark as she is addicted to attention and control And the fact that her sister has anything at all including a good man bothers her It doesn't matter that the sister has her own man and is getting married It doesn't even matter if the man she is marrying is a good person who is loving and devoted to her There is someone in proximity to her and her sister that she does not feel ownership of Somebody who likes her sister better than her and she doesn't and she's not used to that
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
She's the star of the show. In her own mind, everyone prefers her. Everyone should. She's not comfortable with her sister being somebody's primary. I'm sure there are many reasons why she is jealous, but I think a lot of it comes down to needing to have dominance over her sister in every possible way. Truly sick.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I'm like, okay, you might be right. But hey, dominated?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
There's a lot of theories in the comments. And look, one of them's probably right. I also think these comments are speaking from personal experience a little bit too.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Lastly, someone said, It really is such a betrayal. It's such a betrayal.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I'm never quick, based on just one story, to jump to the cut people off advice. And that's only because I don't know the history, right?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Now, if this, what I assume and what I do believe is usually the case, because that's such extreme behavior, is it probably was a pattern. If you probably sat down and talked to OP and you're like, so has your sister done anything like this before? I would bet money that most likely it's, yeah, she's done similar things.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And at that stage when it's a pattern, it's like, all right, you either, you do have to cut them off. They're not going to listen to you. And if this isn't going to stop, they are actively harming you.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I think that's actually, in a lot of wedding stories we've read before, it isn't always day of that's necessarily the problem. It is the lead up.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I think if this was truly out of the blue, the family's reaction would have been so different.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
They'd have been like, whoa, we got to talk to her. Yeah.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Well, the show's been on for like 10 years.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Our next story comes from Today I Fucked Up, and it's from a few years ago. Today I fucked up by trying to fly my drone at my sister's wedding reception.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
So this had actually happened about a week ago. I wanted to shoot some cool overhead footage at my sister's wedding reception, and it was a pretty windy day. I go for this shot where I start close and fly out backwards, zooming away from the party. Just as I do this, there's a strong gust of wind that pushes my drone backwards so fast, I didn't have enough time to react as it went into the trees.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Now this is a DJI drone, so it has sensors to try and keep distance from objects automatically. The drone kept getting stuck in branches, getting itself out of them, only to fly right into another branch. All while this is going on, the whole wedding reception is gasping and moaning because I was so close to flying it out of the trees.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
All of a sudden, it flips over sideways and that was it, sploosh. Into the water below. Yeah, there was a river. Forgot to mention that. The drone had tumbled through the branches, bouncing off each one, just barely slipping out of their clutches, only to meet its ultimate demise into the depths of the river. This was quite the spectacle for everyone at the reception, but it gets worse.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
As people were coming up to me and sharing their condolences, a few mentioned the same crazy idea. You gotta go into the water and retrieve it. Okay. Sir, do not jump in the water. We have someone on their way to help fish your drone out of the water.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
You see, the wedding was at a private park and apparently some of the staff had caught on that I was about to jump into the river, which apparently was off limits. Of course, they waited until I had stripped down to tell me someone was on their way. So here I stand pretty much naked in front of the whole reception. Everyone is just staring at me dead quiet.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
All of a sudden, my grandma starts laughing and runs to me asking someone to take a picture of us. with me still in my underwear. This was quite the hit as everyone found themselves waiting to come up and take pictures with me. Shame, embarrassment, sorrow.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I'm not sure which emotion I felt more, but I had accepted my fate at this point and had no other choice than to stand there while everyone laughed and took pictures of me as I was cold and vulnerable. Oof. We have video.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And here's some photos of him in his underwear.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
You're like, what's the build of a drone pilot? It's that.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
This guy was so excited to write this tale out.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I love when there's proof that this is a real story. Also, this is written The way it's written, you're like, this is real.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And he has the footage. The footage is there.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
People love their drones. And it's fine.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
People love their drones. I remember one time. A previous apartment that I was living in, it was an apartment building, as they are. But I was on like the third or fourth floor of this apartment building. And one day I'm outside on my balcony and I see this drone flying around. And I see it flying far away, like out of the distance of my sight. And I'm like, whoa, look at that, that's crazy.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And it's flying all over the place. And all of a sudden it comes right back to like my balcony. And I see it just go into someone's window. And then they shut their window. And I was like, that's crazy.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's like, we have been spotted.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Handsome guy alert. I'm like, oh no, it's hunting handsome men.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Some comments. They definitely won't let you forget this, so you might as well try and own it. Someone else said, we can pinpoint a moment in any Today I Fucked Up where a vital error was made. For you, it was this. I juggled the idea around in my head for a few minutes before I realized I had already lost my drone. Can't get any worse from here.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Lastly, someone said, at least you didn't hit the bride with it. That's true.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Hi. Thank you both for being here.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Our next story, am I the asshole and also another am I the devil?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Here we go. Am I the asshole for making it clear how I'm not entirely happy at my best friend's wedding during my maid of honor speech? Ah. Yeah, yeah.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah. Yeah, you are. You had to ask the internet this question.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
You are. Oh no, but okay, but oh no, let's listen. Huh?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
All right. On Saturday, my childhood best friend got married. Her husband is very lovely and he takes care of her. They've been together for seven years and I've known him pretty well through my friendship with my best friend. But after they got serious, things changed. Our friendship changed. And yeah, a lot of you will say this is natural and priorities change and I agree.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
My take on weddings at this stage, after all these stories we've read and all the stories I've heard from people I know, is that in your family, whatever traits that you know certain family members to have, they're gonna have the most of that during the wedding. Like if someone's anxious, you're gonna see them at their most anxious. If someone's jealous, they're gonna be at their most jealous.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I agree that things can not always be the same and how her priority now is her husband and the family she'll create with him. But still, I feel completely mad about it. I know I should respect her and move on with my life, but I have to also make peace with the fact that this change does not make me feel well. I was her maid of honor, a great honor indeed.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
The entire time of the ceremony, I was sobbing, not because I felt touched, but because I mourned our friendship. That day was the day that my hopes of things returning back to what they used to be were gone. Everyone thought it was cute and how touched and happy I was, but I was not. But I couldn't say it out loud.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I had a maid of honor speech ready, but all of it was just a lie, so I decided to scrap my actual maid of honor speech and speak honestly. I said that I don't want to lie, I want to be honest, but I'm not happy. I'm not happy that this person she married is the reason our friendship changed. I'm not happy on this day.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I just pretended the whole day out of her sake but it would be a shame for me to get up there and lie about how happy and excited I am. I said I'm not happy but regardless I have to suck it up and congratulate the happy couple. There was awkward silence for two to three minutes after my speech. My BFF was whispering something with her new husband. The entire night, my BFF ignored me.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I asked to speak to her and she angrily told me how it's not the right time. Many guests gave me judgy looks. It had been two days and my BFF hadn't texted or called me and also ignored my texts and calls. During that time, many of our common friends said that what I did was very selfish and that masking selfishness as honesty is not an excuse to make things awkward at the wedding.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
My BFF contacted me two days after and only asked me if my purpose was to ruin the mood of her wedding. I said no, the purpose was to be honest. She said I'm trying to play the victim and how she can't believe I haven't even shown a bit of remorse about what I said. I said I can't apologize for being honest. She said many people believe I'm the asshole, including her.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Her husband now feels uncomfortable about me. Am I the asshole?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Slow vibes. It's also, what do you... What do you want? Slow vibes. Slow vibes. It's also, I mean, I think my thought for so many situations is what do you want to happen, right? Right. Do you want your friendship to be back? Because this is a guaranteed way to make sure it never comes back.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It just seems to elevate every aspect of a human being to another degree. Anyways, our first story, it was on Am I the Asshole? And also got reposted onto Am I the Devil? Always, always fun when that happens. We love it. Here we go. Am I the asshole for changing the wedding venue my fiance chose to something more flashy as a surprise? Okay. I...
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But she is admitting here that she's just not happy for her friend. I just think she was only thinking about what her friend can give her. She's like, oh, our friendship is gone.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But it's also getting blamed on marriage when it's also that they've gotten older. And as you get older, typically life piles on more layers of things that cause you to drift apart. Because, I mean, at this age, in my 30s, I know people who are in relationships, who are married, who are single. And I think that happens regardless of your situation.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
There's just so many things that happen in life as you get older that it's not as easy to just be like, oh, we're hanging out every week.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I just think the way that you go about this doesn't have to also be, even if she got coffee with her and told her this in this manner, I still think I would view it as kind of being, I don't know if it's like an asshole thing as much as it's more like you're screwing yourself over, right?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Present this to her, I mean, sooner than, don't let it get to this point if it's so important to you, but present it to her of like, hey, like, I feel like we don't hang out as much anymore. I'd love to hang out more. Present it in a fun way. Present it like, but.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I know, I'm now questioning of like, is this a friend where she made her maid of honor, but is that because if she didn't, too intense. It reads to me a little bit of like, maybe she is drifting away from you because it's not, she's not feeling like you're actually there for her. She proved here that she's not her friend.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's so frustrating though how often people use being honest as an excuse to just be selfish.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Horrible. Comments, you're the asshole. That was a personal conversation and you made it public. I would cut you out of my life if I were the bride. Damn. Someone else said, you're the asshole. It's your best friend's wedding day and you're trying to make it all about yourself. How much more egotistic and selfish can one be?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's not the time or the place to be honest about your feelings on the friendship. If you felt like you couldn't do the job of being a happy and supportive maid of honor, you should have just declined the role from the very beginning. You owe your friend an apology, although I don't think she'd want to be your friend anymore at this point. OP responded to another comment.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
She said, Someone said to that, And it's okay for you to both feel that way and express them, but at an appropriate time. Obviously, this wasn't it. Also, I don't care if their trip is in July. The time immediately after a wedding is a honeymoon period. You should apologize because it's the right thing to do. But you shouldn't expect her to ever talk to you again.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
OP also commented underneath all of this saying, I've been in therapy. I still am. My therapist said it's about my codependency issues and how I should make peace. with my feelings, so it will be easier to move on, and how sucking it up won't help. I did this because I thought it would help me move on more easily, and honestly, I didn't think it'd cause that much backlash.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I didn't consider it, to be honest, which might be a wrong call. Oh, so it was about you. She's like, oh, this is about me moving on. It's like, cool, man.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I really question what's actually being said between her and her therapist.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I, a 25-year-old man, am marrying 24-year-old woman this coming October. We both have very large families, but hers is really poor and kind of traditional. As a result, my fiance has been taught to always go for the cheapest option throughout her life, whether we are going out to eat or buying clothes or going on holiday.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
You know there was some 95-year-old there being like, who, who, who's that? Like he forgot about it by the end of the night.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
He's like, was that the bride?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I don't think there's gonna be an update on that one.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Update, guys, I apologize and I'm really sorry and everything's okay.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
All right, this next title is interesting.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Am I the asshole for refusing to leave a wedding because I wore a dress that looks white under a black light? Where are we? Crime scene wedding.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
A few months ago I attended a close friend's wedding with my husband. I wore a yellow dress. Think like Belle in Beauty and the Beast yellow. Bumblebee yellow. So yellow that I did not question if it was appropriate or not to wear to a wedding and neither did my friends nor family. All right.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
A member of the wedding party approached me while the black lights were on and stated that I needed to leave because my dress was white and inappropriate. I stated that the dress was yellow but the black lights were making it appear white. The member of the wedding party stated that if I didn't leave, she would make me. The groom shrugged and continued to dance. Of course. Duh.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
The groom was drunk. The next morning, I was approached by a different friend at breakfast, not in the wedding party, who stated that they heard what happened and that I should have left when asked because it made people uncomfortable and that I made it about me partying rather than respecting wedding etiquette. I have felt incredibly embarrassed about this since.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
So am I the asshole for not leaving the wedding when asked? Edit here, also the most controversial thing seemed to be the blacklight dance party at this wedding. It was the last hour or so and was just a way to have fun. It was not as weird or as tacky as people are making it out to be. Here's a photo of the dress.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Well, we've been planning the wedding, and the choice of venue was typical for her, a small local church where she was christened. Right off the bat, the place isn't suitable for the number of guests who will be invited, and I knew she only chose that location because of money, which is not an issue. I spoke to my father, and he agreed to fund a wedding abroad in Venice. Wow.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I think to a certain degree, being offended on someone else's behalf is controlling behavior. Yeah.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
That's what I'm kind of thinking. It's like, you think this person showed up with a white wedding dress at the end of the night in the last hour?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, like I said also, last hour of the reception.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Nobody's coherent in the last hour.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, you know, most of the wedding day, there's memories, it's all heartfelt. The last hour of any wedding is basically... It's blackout time. It's Vegas.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Nobody's gonna remember what happens there.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
If great grandpa's still there, he is dead.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Also, black lights at a wedding just sounds funny to me.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, what the hell is going on?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, she's a vampire. She's got to go. Get her out. Verdict was not the asshole. Yeah. Yeah, she didn't do anything wrong. This was clearly a drunk, overprotective bridal party person. Or just, I don't know who it was, but somebody there was overprotective. Comments, not the asshole. Who checks their attire under black lights to see if it passes? Ridiculousness. Rob Dyrdek.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I understand if it appeared white under normal lights. Ew, don't! They wrote, you can't write ridiculousness.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
No, you just say ridiculous. You don't say ridiculousness.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I understand if it appeared white under normal lights, but come on, this was an unusual situation at the end of the reception. You are fine, and whomever approached you was completely and utterly out of line. Some people have nothing better to do than look for problems that don't exist. That had 32,000 upvotes.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
That person didn't pay attention or see her for the whole night until then.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Someone else commented if the bride didn't have a problem then no one needs to chime in with their opinion The groom shrugged and moved on this guest was anal Someone else said not the asshole yellow is not white and unless they specifically told people not to wear anything that appears white under blacklight then it's on them. Info, because I'm nosy, has the bride or groom said anything to you?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
In my opinion, if they are okay, then I don't get the friends causing issues. OP said, no, I've seen them since and neither of them said anything about it. I'm trying to take a generous view and say the bridesmaid was just being protective and doing what she thought was right.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Give us an update or else I think this is fake.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Our next story, it's another Today I Fucked Up.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Okay. Today I fucked up by accidentally having sex with my cousin at a family wedding.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I went to my Lannister wedding. So this happened about 18 months ago, and this is from a few years ago. This is the olden times.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Oh yeah, of course. The before times.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
So this happened about 18 months ago, or somewhere in the vicinity of 18 to 20 months. I still get flack from both family and friends. So the setting, my uncle's wedding, it's around autumn, and my uncle by my mother's side from an exceptionally large family. This is relevant. is getting married for the second time. Now my family is very large.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Well, she didn't take it well and said I was a massive asshole and that she had much preferred the church venue. She said it was too embarrassing to cancel it now that I've told people, but seems really mad. I'm confused since that venue was never practical and I'm wondering if I'm the asshole here or if she's overreacting.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
My mother has three brothers and five sisters, all with children of their own, and some even with children of their own now. The wedding isn't what I would describe as large, pretty much encompassing just family and close friends. All in all, there can't be more than 50 or 60 people there, and around 60%, at a rough estimate or so, are related by blood to me.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
They make up the majority, is what I'm trying to say, and many are spread over whom I have only briefly met, or in some cases, never met. Well, you can see where this is going. For reference, I would be around mid-17 in this story, with the age of consent in my country, UK, being 16. The girl, who we shall call Isla, was 22 or 23. Okay. She's clearly older than me, but I thought maybe 19 or 20.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Anyway, we start dancing, touching, etc. She twerks on me a little, I grind a bit, and I presume nobody noticed due to accumulated intoxication and crowdedness around where we were. One thing leads to another, we start kissing, and she asks me if I want to go upstairs, which I correctly take to mean her room in the hotel.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I, of course, being a hormonal teenage boy, still am, jumped at the opportunity and said yes. I should say this wasn't my first time or anything, and by this point, I carried condoms around in my wallet when I went out and knew I would be drinking. So we proceed to discreetly, or so I think, take our leave.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Both drunk, obviously, but not to the point of not being in control of our actions or stumbling around slash blackout. etc. I get to her room, a bit of excited talk, and clothes come off. All is going well. Now, I should say that all this time, I'm assuming this girl is a relative or perhaps friend of the bride. Oh boy, I was in for a shock.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
As we were cleaning up, so to speak, we began a little small talk when before had mostly just been purely sexual. She eventually asks how I know the bride. Let us call her Emma. I stop, thunderstruck. The realization slowly creeped up on me and oh, the horror. I laugh it off, hoping in vain she is joking, and state I am the son of, insert mother's name.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
The shock is palpable on who I then realized as my cousin's face as she was putting her bra back on. She sort of freaks out and says she is the estranged daughter of one of my uncles who's had a troubled life whom she had very recently reconnected with. I did not know this. We essentially collectively let out a fuck. Ew.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
From there, we got dressed quickly and decided never to reveal this major cock up to a soul and hope to God we had not been noticed. Alas, we decided it would be best if she were to leave first and that I would follow around five to ten minutes later.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Well, I do, she leaves first, and I just kind of stand around in the hallway on my phone freaking out for a short while until I decide enough time has passed to erode suspicion.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Well, the first thing I see when I get down is the look of pure disappointment on my mother's face, the stupid fucking grin on my father's, and half my cousin's faces and my sister looking in disgust as though she was watching a particularly repulsive sea slug. One of my cousins, whom I am...
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
One of my cousins, who I am close to, pats me on the back, shaking his head, and laughing his absolute head off. I know I am defeated then, and quietly take a seat, expecting the utter bollocking I will later receive from my family. My elderly 90-year-old grandmother was there for fuck's sake, and word was not quiet.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I didn't see Isla or her father again at the reception, and later found out she told him, and he took her home, not to the hotel she had booked by way of taxi. So yeah, I accidentally took part in Protected, thank God. It is brought up at every, and I mean every family gathering.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
A couple of my cousins have taken to playing Sweet Home Alabama and asking when the next date is whenever I enter the room. After soberly explaining to my parents it was an accident and I fully believed she was not a relative, like they should have questioned it, they were okayish with it, but still disappointed and annoyed a little.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
My father asked me how I'd failed to notice Isla, apparently, sat literally in the row behind us, and I had no answer. Gotta work on my observation skills, I guess. Not only do my family still tease me, but my friends found out from my sister within days, and I've been relentlessly teased by them at most social gatherings since.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
You can imagine how many cousins slash incest slash Alabama jokes daily. I am ashamed to this day, even more so because she is an objectively attractive woman.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
As one might imagine, the limited interactions we've had since have been extremely strained and awkward, not helped by my dickhead cousins. There is another big family wedding coming up this summer, and since the announcement, the incident, as it's come to be known, has been all that's been discussed within my hearing." Okay.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
So this guy establishes that 60% of the people there, so more than half, are going to be his relatives. And he's talked about there are plenty of relatives he's never met.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And he still took that gamble.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, man. I asked that question earlier on.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Of course I feel bad for him.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I feel bad that his whole family's not letting him let this go. I'm surprised they went, you know, I'm surprised in the UK they went for Alabama jokes and didn't go for Game of Thrones jokes, you know?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Come on. The Lannisters hadn't been doing their work for years by that point. Yeah, they had. We apparently only have one comment to read because a lot of the comments under this were apparently really weird.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It got all Reddit under there.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Got all Reddit under there. Got a little Reddit under there. Put a cock up. A major cock up.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Major cock up. Someone said, hey, you just experienced something that I can guarantee most people have thought about. We all have that one cousin who we wish we weren't related to. Someone commented under that going, do we?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Do we, though? I imagine this story brought out a lot of the trenches of the internet.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Our final story. This comes from Relationship Advice and Best of Redditor Updates.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, I mean, absolutely, it has to be a decision together because you take that agency away from her, and it's so disrespectful, and now it's like, okay, is this your wedding? Is it my wedding? Whose wedding is it?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Future mother-in-law, who's 54, called me, a 23-year-old woman, stupid, and now I'm considering calling off the wedding. How do I approach the situation? I, a 23 year old woman, am engaged to John, who's a 24 year old man. We have been together for five years. We want to get married in July of 2025. I always thought that his family liked me because we get along well.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
He has two older brothers, 26 and 29, both married. Honestly, I was very excited to have them all as my in-laws. They were always kind to me. Some kind of important information. About a year ago, when I was scrolling on Instagram, I saw a profile that was kind of cringy, but in a cute way. It was an older woman's profile who shared inspirational quotes.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I remember one particular post, and it was something along the lines of, only stupid people pretend to know everything. Don't pretend, just ask. Honestly, this quote changed me in a lot of ways. Before that, I was always worried that I might embarrass myself if I didn't know something
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And after reading that quote, I realized that if I always pretend that I know everything, then I'll miss out on actually getting to learn about things. So I decided to change my habits and start admitting that sometimes I genuinely don't know. Someone is talking about the war in Kosovo? Okay, sure, but first let me ask some questions so I can really understand what we're talking about.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And I ask a lot of questions sometimes. I sometimes even open the notes app and write in some questions that I later want to find answers to. These are my latest. How does time work in a black hole? Why do some snails have shells and others don't? What food is okay for ducks? How does the light bulb work? The old ones with gas inside them.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Does everyone see colors the same and how can we know that? Sorry for the long introduction, but it was kind of necessary for understanding what kind of person I am. I know that sometimes I might come across as annoying. Now, on to the problem. His parents hosted a small barbecue last weekend only for the family. So it was the mom, 54, dad, 59, brothers, 26, 29, and their wives, 27, 27.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I was the last person who showed up because I had to work late. I entered the house, and when I was walking towards the back of the house into the backyard... I heard John's mom talking about me. To be honest, she wasn't talking about me, more like mocking me. I heard her say in a high pitched voice, how does the sun work? Where should I put the fork? Why does nobody like me? How do I wipe my ass?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I just stood there. I had this sinking feeling. I couldn't move, so I just stood there. And I heard them all laughing. One of the wives said, I actually don't mind her always asking questions. I think it's cute. And it made me feel hopeful that they will say something like, yeah, sure, we're just playing. We love that. But none of them did. Instead, the mom replied, it's not cute.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
She's just stupid. After that, they laughed again. I heard John laughing. My heart kind of broke at that moment because he didn't even say one positive thing. He didn't defend me, he just laughed. I quietly turned around and left the house. I texted John that I got sick and had to stay home. Now I'm wondering how I should approach this situation.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
We live together and I sleep in the guest bedroom for now and I use the excuse that I don't want him to get sick from being around me. I can't ignore him forever and I can't pretend to be sick anymore because it's been too long. I'm not sure how to proceed. Maybe it was just a misunderstanding. I'm considering talking to them about this, but I'm also worried that they won't be honest with me.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Now I feel like I'm just going crazy. I would really appreciate some advice.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
If she stepped in, she goes, I've got a question. Why are you all such fucking assholes?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
What does it take in one's life to become such a goddamn bastard?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
That, to me, frankly, the stupidest people in the world think they're geniuses, right?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And, I mean, they will make it clear. Like, they have the answers to everything. You see it on the internet, right? Like, some event happens, and there's a million people you scroll who just have all the answers. And you can tell they don't.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's just, well, it's just, that's a sign of stupidity is you going, oh, yeah, this makes sense to me, so I've got it figured out. Right. What she, she's actually showing a sign of intelligence of recognizing, oh, I recognize that I don't have the answers. Yeah. And there's curiosity there. Right. And a desire for knowledge. That, to me, is intelligence. Right.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Also, her questions she has in her notes app Some of these are very intelligent questions. It's not like, oh, I've got this stupid question. How does time work in a black hole? I want anyone to try to answer that. Ask that to the family.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Stupid is such a mean thing to say about someone.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And now you're also adding the fact that they're saying it behind her back and the fact that her fiance is included in it is devastating. I really hated that. It's not a matter of like what we think she should do. What would you do in this situation?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
You know what's extra hurtful is that the sister kind of stood up for her a little bit.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It was one of the, yeah, it was one of the sister-in-laws was like, oh, you know, I think it's cute. It's like, so that almost I think makes it harder that her fiance didn't defend her when one of the siblings already was kind of, Right. Because it's not like, oh, all of them were ganging up. It's like, it wasn't... You could have been like, no, I agree with her. It's cute.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
If she doesn't talk to him, that relationship's over. It might already be. Update!
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Here we go. First of all, I wanted to say thank you to people who reached out to answer my questions about black holes, snails, ducks, light bulbs, and other stuff. I would love to have you as my friends. For the other people who said I should just shut up, I don't really care if you find me annoying or hard to be around. I'm okay with that. I don't exist to please everyone.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I'm just here for a good time. have my own interests and learn. I didn't expect my post to gain so much attention, but I'm so grateful for the advice. Most of you told me to break up with him and at the very least confront him. So that's what I decided to do. You gave me a push and confidence to do it.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But before I did that, I texted the wife of John's brother, the one who said she liked me asking questions. I asked if we can meet up for coffee. She said, sure. We met and I didn't see the point in pretending to her that I didn't hear their conversation. So after some small talk, I just said, I heard you all talking about me during the barbecue.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
She immediately got sad and said she felt embarrassed. She explained that it wasn't a joke, wasn't out of context, that it was just mean and hurtful. She said she's sorry for not defending me more, but I said that's okay and I understand. I told her that I don't blame her for anything and just wanted to make sure that I understood the situation and see it for what it really was.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And it really was laughing at me behind my back, just bullying. At this point, I just had to confront John. In my last post, so many comments were saying that he will probably try gaslighting me, and you were right. We were having dinner together for the first time since the barbecue happened because before I tried my best to avoid him.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yes, I know, not very mature of me, but other than you guys, I don't really have a strong support system. My family and best friends are hundreds of kilometers away. I only have two good friends here. I was so stressed I thought I'm going to pass out. My legs were shaking and I was terrified because I knew deep down that this is the moment when my five-year relationship goes down the drain.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I said I was there and I heard him. After the initial shock passed, he got mad. He said it's rude to eavesdrop. I said it's rude to bully people. He tried telling me that it was just a joke, that it really was funny. I said that I didn't find it funny and went to the guest room to calm down. He started panicking. He was asking me to please talk to him.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
He was much more apologetic and said that he will be 100% honest with me. Thank you. The apartment has his name on the lease anyway. After I gathered some of my things and left, he kept texting me nonstop. He tried calling, but I didn't respond. I was very hurt because he tried to belittle my feelings, and only later, when he realized that I might break up with him, started apologizing.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
The next day, I decided to give him another chance to explain himself and I came back to the apartment. He seemed very sad and tired. He said that he told his mother that I overheard them. I said, I don't care. It's his time to step up and show me that he cares. I'm not interested in an apology from his mother. I'm already done with her.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I can't put up with this behavior and mocking me like we're in primary school. I saw a comment saying that probably her ego is hurting. I think it's true. She never got the chance or never had the desire to have an education. She is a very good homemaker, but outside of that, she doesn't have many interests of her own.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
If I ask her about making tomato soup, she'll be talking for 30 minutes lecturing me about adding enough sugar, but not too much. She will lecture anyone who is willing to listen. But anytime someone is talking about something she's not familiar with, she gets defensive and tries to imply that nobody cares about that. And if it's not relevant to her, it shouldn't be discussed.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Once again, he tried telling me that I should relax because it was only a joke and at this point I had enough. I took off my ring and told him that this behavior is a joke and I can't be the punchline. I told him that I wish him and his family the best and to look in the mirror to check if they really are as superior as they think they are.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I said I'm going to be back with my friends soon to pick up the rest of my stuff and to not contact me again unless it's about moving my things out. Sorry. And that's it. I'm done. Thank you all for the advice. Without you, I wouldn't have the confidence to leave this man. I know I deserve better. I can't be with someone who can't stand up for me.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And I wouldn't be able to feel comfortable around his family. So I'm done with the relationship. I hope they will treat his next girlfriend better. Thank you again, Reddit, for advice.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah, she sounds very smart. I get very frustrated. We sum up intelligence as like memorized knowledge.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But there's, you know, theories of like multiple intelligences. There's many different kinds. You might know someone who doesn't have a lot of knowledge memorized, but they might be extremely emotionally intelligent.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
There's a bunch of different kinds. You know, even memory has been proven to be like a muscle that if you work, you can get really good at it and memorize a lot more than you knew like a year before. So it's all fluid. But props to her, man, she really is, she does actually seem extremely smart.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Because weddings have a lot of identity to them. It's like, oh, this is about us and our story and what's important to us. And now, when you don't clue a person in on their own wedding...
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Her understanding of other people is far greater than this family's understanding of other people.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's been some time since I posted the last time, so I thought I'm gonna give you guys a small update because some people still keep messaging me. I appreciate all the kind words. So I got my own apartment now. I lived with my friend for a while and she was an amazing support for me after the breakup, but now I have my own place closer to my university and work.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Turns out my ex-fiance didn't tell his family that we broke up. I blocked them all except for the ex because we needed to keep in touch in order to get my stuff from the apartment that we shared. And nice sister-in-law, and a week after the breakup, she texted me and asked when I will come to the parents' house because everyone wants to apologize.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I called her and said that we're no longer together and I don't really want their apology. She seemed shocked because my ex was telling them that we're fine, she just needs some time. Ugh! Ex-sister-in-law told me that the family is still fighting over this whole ordeal and that the brothers are giving my ex a hard time about the situation. I told her nicely that I don't really want any updates.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I like her, but I cannot put my energy towards following their every move. She told me she understands. I don't know what happened after that with them. I'm happy. I went on a date with a cute guy I met in a cafe, but I'm taking everything slow and I don't want to rush any relationship.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I'm not ready because just three months ago I was planning a wedding and right now I'm single and focusing on studying and work. When I graduate, I want to adopt a kitten and that's my only goal in terms of any big commitment right now. I also enrolled in CS50 by HarvardX and I recommend you all try and learn something new today. If you have any questions, then feel free and ask.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I will try to answer in the comments. Oh.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
She puts my hair in an umbrella. Yeah, and the drone goes into the tree. And the drone goes into the tree and the naked guy goes, I gotta get it.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Do you think in the cafe, she was talking to this, like bumped into this guy and he was just like, how do they make coffee beans?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
He was like, what do ducks eat?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
He was like, you lost me on that one.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
That's what they say. They say that people who are funny are the smartest people.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Well, thank you both. Thank you both for being here. This has been a blast. And thank you all for watching. And remember, March 8th, we'll be doing Smosh Reads Reddit Stories Live. Get your tickets at live.smosh.com and join us. It's going to be a great time.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But we'll also see you next Saturday.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
The verdict is asshole and it seems like the reception from the comments is very much, yeah, you're being super disrespectful towards her and it is really disrespectful. Even if the initial thought is nice of like, oh, I wanna do this thing for you, it still just comes across as if he's not taking her opinions and decisions that seriously.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
So the verdict was asshole. Some comments. Someone said, you're the asshole. You gave her no say in any of it. Picked a venue, picked a different country, scheduled for a date, made the guest list, choose the invitations. Maybe she chose the church because of personal meaning. Maybe she chose it because it was cheaper. The wedding should be planned by both of you, which means...
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
If you didn't like the venue, it's fine to say no. Try to find a venue you are both okay with, something bigger, more options, but still relatively local. Did you even confirm that her closest family would be able to make it? Even if your dad pays for all travel expenses, not everyone can afford to take off work or can travel that far. She'd probably enjoy it a lot more as a honeymoon.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And if you have such vastly differing opinions about money, There are major conversations you need to have in general before marriage, which hopefully doesn't happen because she deserves someone who respects her. Do you live together? How are bills paid?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Guys, we have some really exciting news. On March 8th, we'll be doing Smosh Reads Reddit Stories live at the Dynasty Typewriter Theater, but we'll be live streaming it, and you can buy tickets for March 8th to watch it. It'll be our 100th episode.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
And apparently that comment was abbreviated too. Wow. They went ham on them. Damn.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But that is a good point of like, how are other people going to get there? A destination wedding is a big deal.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Yeah. So that is something to consider.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Someone else said, you're the asshole. A marriage is supposed to be a partnership. You operated completely behind her back, then revealed it once it was a fait accompli. That's French for an accomplished fact. They could have written that.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Ham on them. How can you be confused about her reaction? You think you sent the message, he's willing to get his parents to do extravagant things for us, or if you didn't tell her it's daddy's money, he's willing to spend so much to give me nice things. The message you actually sent is, he does not give one benighted fuck about my feelings and desires.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
He's always going to be making huge decisions behind my back. You'll be lucky if she doesn't call it off. Lastly someone said, I knew the money spent would make her anxious and she always dreamed of visiting Venice. So why didn't you just plan to honeymoon there?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's very true, like he clearly doesn't know her because her reaction was an extreme opposite of what he thought it was gonna be. And so that means like, oh, you're way off on what her values are. You don't understand her.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Like, he made the decision to basically plan a whole new wedding behind her back.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
It's gonna be really cool, so if you wanna get over there and get your pancakes out, it's gonna be a lovely time.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
We're going to the White Lands.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Our next story, this also comes from Am I the Asshole? Am I the asshole for refusing to attend my sister's wedding after what she did to my fiance?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I was like, I'm gonna stop. Kissed him and fucked him.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
So good. So this is a 28-year-old woman. So my sister, Ella, who's 31, is getting married in two weeks. We've always been close, even though we have our differences. I've always been more of a laid-back, introverted person, while Ella is the life of the party and loves being the center of attention. It never bothered me much until now.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I've been engaged to my fiance, Mark, who's 29, for about a year. He's wonderful, kind, supportive, and just an all-around great guy. My family has always liked him, or so I thought, but about a month ago, something happened that made me question everything. Ella asked Mark to meet her for coffee one day, saying she needed help picking out a wedding gift for me.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
I didn't think much of it at the time, but when Mark came home, he was really quiet. After some coaxing, he finally told me what happened. Apparently, Ella spent the entire time trying to convince him that I wasn't right for him. She told him I was too boring, that I wasn't ambitious enough, and that he could do better.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
She even went so far as to suggest that he could call off the engagement and see other people. Mark was completely blindsided and upset. He said he defended me, but it was clear that Ella was relentless. Okay, Sheena. Sorry. She said, They're begging me to still attend the wedding.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
Pancakes at a theater is pretty intense.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
They think that missing it would cause a huge rift in the family and that I should just let it go for the sake of peace. But I don't know if I can. Every time I think about what she did, it makes my blood boil. I feel betrayed and hurt, and I don't know if I can just pretend everything is fine for her big day. Mark supports whatever decision I make, but I can tell he's hurt by this too.
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
So am I the asshole for refusing to go to my sister's wedding after what she did to my fiancee?
Smosh Reads Reddit Stories
Weddings Gone WRONG | Reading Reddit Stories
But if you do buy tickets and watch the live stream of it, you can make yourself pancakes and take a photo of yourself eating pancakes while watching it.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Hello and welcome to Reddit Stories. I'm Shane, and it is the holiday season, which means we've got some holiday-themed Reddit Stories for you today. And I am joined by two people who are bringing the holiday spirit, Trevor and Arasha.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
2024 update. He sucks. He sucks, she's still doing pottery. I made some great urns. Okay. Moving on to our next story. This one is more recent. This came from this past month. Whoa. Am I the asshole for telling my sister she's not allowed to bring her homemade food to Thanksgiving because her cooking is ruining the meal?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, taking ownership of something she made.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Like, I've had a lot of underwhelming holiday foods, but I've not had bad. Yeah.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Okay, here we go. Every year, our family does a big Thanksgiving dinner, and we all typically bring a dish or two. My sister, who's a lovely person in every other way, insists on cooking something homemade every time. The issue? She's not a great cook. And I don't mean just not great. I mean she has somehow managed to turn classic dishes into borderline inedible creations.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
For context, last Thanksgiving she showed up with her special recipe, stuffing that was over seasoned with random spices like cinnamon and cardamom. It was dry and the flavors were confusing and totally off for stuffing. Only one person took a small bite and the rest went untouched. Another year she brought a green bean casserole that had some kind of strange chewy texture.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I make really cool vases as a hobby. These can take weeks to complete and are always made with the gifty in mind. My mom, who's 50, and I have always been into nature together. We hike, we own animals, we eat outside if we can. I guess being into nature sounds weird. We just like being outside. So I made my mom a Siamese cat urn. It looks like a vase, but the top is the cat's ears.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
She later admitted she used coconut milk and almond flour to experiment. No one wanted seconds of that either. This year, I'm hosting Thanksgiving. Since I'm responsible for putting it all together, I wanted to keep the menu consistent so that people could actually enjoy a cohesive meal. I thought I'd avoid drama by asking her to bring non-food items instead, like wine, soda, or even some flowers.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Thanks for watching! I told her that everyone appreciates her effort, but that she could contribute in other ways and still be part of it. She doubled down and said she's bringing her famous green bean casserole, whether I like it or not.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Now, my mom and a couple other family members have chimed in, saying I should just let her bring whatever she wants because it's Thanksgiving and it's the thought that counts. They're acting like I'm committing some huge offense by wanting the food to be enjoyable for everyone and not having random experimental dishes that no one will eat.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
But I feel like I'm just trying to keep the meal enjoyable and frankly edible. I don't think it's wrong to want guests to actually enjoy the food, especially since I'm putting in a lot of effort to host. Am I really being unreasonable here? Am I the asshole? Oh, that's tough.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Tell someone, don't cook. Don't bring your food. I'm like, damn, I wouldn't be able to say that. I don't think so. I wouldn't, especially because I'm like, this is one of those situations where I'm like, is it really hurting anyone that it's just going to sit there and nobody's going to eat it?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
She does not say whether she reacts, because you'd think that you bring it a couple times and nobody's touching it, that you'd know.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I don't think so. In fact, she refers to her green bean casserole as she's bringing her famous green bean casserole.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Her coconut milk and almond flour green bean casserole.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
That's right. Ho-ho-hos. That's right. Wow, Trevor, really cool sweater that you wore today.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It is super cute and I love the way it turned out. No one died or anything, it was just the style of the piece. I had finished it and taken it to my apartment, wrapped it up, and been so excited about it. Well, my boyfriend's mother came over and he didn't get her a Christmas slash birthday present. She loves cats, so he just gave her the piece I made, which she loved.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It's really hard, because it's like, here's someone who's so excited to do something for people. And it's heartbreaking that it's not good, but it's like, to tell someone, hey, don't contribute, is devastating. I know she's saying, oh, I'm asking her to bring wine and soda and stuff, but I'm like, she wants to make something and feel special. It's tough.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah. It's so funny to me because I'm just a very different type of cook. If I ever am cooking for a party or a gathering, I am finding a recipe online that has five stars and I just follow the recipe. Because all I'm trying to do is make something that I know a lot of people are gonna like. I'm all for experimenting, but I'm like, that's for me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Like, if I'm gonna experiment, only I'm gonna eat it. I'm not trying to experiment or bring it here and punish people. But to experiment to that degree when you're bringing it for other people is just bold. It's bold unless you are a chef. Like, unless you know the theories and stuff, but adding cinnamon and cardamom to stuffing...
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
So you're interested, so you're gonna call me?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I'm definitely the same way. I cooked a couple things for Thanksgiving a couple years ago and I made mac and cheese and I found a recipe online. I was like, I need to find the best recipe that I know is gonna be good and even still, I was like, I hope this is good enough. But it was good. Right, right.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I almost wonder if she wanted to be sly and get away with this, is asking for a dish, a Thanksgiving dish that's kind of like an optional side dish. You know, green bean casserole's almost there, you know? But something where it's like, you don't necessarily need to have it to feel like you got the complete meal, but being like, oh, could you make a pie? Could you make a dessert?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
My boyfriend does not live with me. He has his own apartment near his school. His mother came over before we went over for dinner to see my new kitten. She was in tears over how nice the present was, and I ruined it. I told her that the presents must have gotten mixed up. That was made for my mother. She got a bit upset, gave it back, then my boyfriend went out to dinner with her.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
We're gonna have several desserts, but could you make another one?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
That's some crazy experimentation to have coconut milk and almond flour in your pantry. You're just asking people. Very specific ingredients.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
The verdict was asshole. They think she's an asshole for saying, hey, don't bring stuff. The comments we have here, someone's asking for info. How does your sister react when no one eats her food? If she reacts poorly, tries to push people to try to have seconds, and is generally a sourpuss about it, then I think suggesting that she take control of wine slash crisps,
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
slash non-baked goods is sensible, but if she doesn't comment or make a big deal, then it doesn't really sound like her cooking badly does any harm. No one eats it, she feels like she's contributed, and all it takes is throwing away the food at the end. Minimal hassle for a peaceful holiday that everyone enjoys.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Someone else said, rather than throw it away, it would be better to cover the dish and send it home with her. At least it won't be wasted as she seems to like it. She might also actually realize that nobody else likes it. Someone else said, let her do it. Her bad cooking is a tradition. Just make another vegetable that people will eat. Someone lastly said, a soft you're the asshole.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Just let her bring what she wants. It's not hurting you. You don't have to eat it. It might even be fun to pretend it's the best thing ever and throw some away when she isn't looking to make her feel good. It could be part of the traditional holiday experience. OP responded to that saying, I get that and maybe I'm overthinking it.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It just feels like a small battle I'd rather not have every year, especially when I'm hosting and trying to make sure everyone genuinely enjoys the meal. I mean, I can definitely go with the smile and nod approach for the sake of family peace, but it does feel a little exhausting to pretend every time.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I guess I just don't want to encourage her thinking that everyone actually loves it, especially when it's clearly not working. But you're right, it's just food, and maybe I should focus more on making her feel included than on the menu being perfect. I'll try to keep this in mind and relax about it. Something I'm curious about too is if...
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
She's asking her not to cook, but a bunch of people are doing the thing where a bunch of people cook and contribute. That would make her feel really bad. Because you were kind of saying, oh, I'm going to handle all the cooking.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It's a silly situation. Exactly.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He said it would be best if I didn't come. I guess she cried the whole way and he didn't have a present for her, so he looked like a bad son. I have trouble seeing where I am at fault. My boyfriend wants to talk tomorrow. I am not sure if he is going to break up with me or if he wants to yell at me for it. I just need to know what people think. Was I a jerk? My boyfriend seems to think I was.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
What if, yeah, what if OP and all of, everyone at this party has terrible taste. Terrible taste. Yeah. And she's actually the genius. You guys. Making delicious stuff. That's what I'm saying.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
You're right. People murdered Jesus.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I think she could be Christ. Oh my God. What a good point.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Update. No way we get an update. We're going to know. What do we think is going to happen?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Thanks to everyone who offered advice, I tried to compromise, but it's already turning into a whole thing and Thanksgiving is still a few weeks away. After our last conversation, my sister was being pretty cagey about what she planned to make, so I reached out to my mom, hoping she could help smooth things over. Instead, she got defensive, saying I'm overthinking and that it's just one dish.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I told her I wasn't sure it was just one dish anymore, especially after hearing about my sister's grocery haul, including canned oysters and edible glitter.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah. Then my mom let slip that my sister has been hard at work on some creative menu she's planning as her Thanksgiving surprise. Apparently, she's been telling the family group chat, which I wasn't included in, by the way, that I'm being controlling and that she wants to expand everyone's palette with something truly unique.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
To top it off, my cousin sent me a screenshot from the group chat where my sister said she's bringing not one, but three dishes to Thanksgiving now. She's calling them her Thanksgiving trio experience, complete with their own place settings and little menu cards she's designing.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I'm officially panicking because I have no idea what she's planning to serve, and from what I've heard, it's not remotely traditional. At this point, half the family thinks I'm overreacting, while the other half is texting me with things like, is she really bringing glittered sweet potatoes? I feel stuck. If I try to control it anymore, I'm the bad guy.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
But if I don't, Thanksgiving might turn into a tasting event for my sister's avant-garde cooking. So yeah, Thanksgiving is weeks away, and it's already becoming a family spectacle. I don't know whether to brace myself or just preemptively order pizza.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
What if this is all a big family prank on OP that they just continue to do? I really hope it is. Because damn.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
We're recording this a little bit before Thanksgiving, so this has not happened yet. We'll probably have updates. By the time this airs, we might comment down below about it.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I have to know. I love oysters. I do not think they belong in Thanksgiving dinner.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I think when you're making a whole menu and you're bringing a whole bunch of things, you're making a tasting event, you are kind of taking over someone else's hosting event. But this is a family thing. Mm-hmm. Families operate very differently, like each family, and so it's kind of more of a family gathering.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yes, it's at her place, but it seems like, from what they've described, it's kind of like a big get-together where everyone contributes.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Every single Reddit story we read with Family Dynamics, I always wish that I could go and just meet this whole family and hear the whole story, because I'm sure my opinion would shift probably 90% of the time. Yeah. Because OP is always going to paint themselves to be in the right. Yeah. It's kind of hard not to.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Even if they have the best of intentions, because you... when you're in the wrong, you often have blinders up, or you're kind of unaware of what you're doing that's wrong.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
This is hilarious, though. Awesome.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I love this guy very much and really love his mom. She is super sweet and kind and never really gets nice things. I still don't think it is my job to cover for his lack of foresight. Her birthday comes every year on the same day. It's not like it surprised him. I got her a card and a book, which I thought was nice.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Next story, this is a Today I Fucked Up. It's from seven years ago. Today I fucked up by catching on fire at a New Year's Eve party. Classic.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Classic move. A group of five of us arrived at a small party, 10 to 15 people or so, around 9.30 p.m. We seemed to be the last people arriving and everyone was happy to see each other. After the hellos, our group decided to go to the kitchen to get some drinks. Now this kitchen was pretty narrow and there were about 10 of us standing in there waiting to get our drinks.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
As I stood in my spot right in front of the gas stove, one of the girls complimented my brand new button-up flannel shirt and it seemed like it's going to be a great night. Note, I'm completely sober at this point. Now, apparently someone was making tea on the front burner. I did not realize that someone was making tea on the aforementioned front burner. It all happened so fast.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I feel heat on my back as someone yells, you're on fire! I pause for a couple seconds as my fire safety knowledge is completely lost in the moment. I cannot take off my shirt as it's a button up and start rolling on the floor after 15 people shouted at me to do so. After rolling on the hardwood floor for 10 seconds to no avail, someone mentions that there is snow outside. Thanks, Ohio.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Luckily, the back door was right there so I was able to go outside and roll in the snow. The fire was extinguished shortly after. I was probably on fire for a good 20 seconds. I come back inside to a sea of horrified faces and I'm convinced the damage was not too bad, I was wrong.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Shortly after, my roommates drove me to the hospital and we watched the midnight ball drop together with me laying down on my belly in the ER. A day later, I'm still in the hospital with my second degree burns, no third, all over my back and I should be released tomorrow. Ooh.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I like to think that he tossed something into a trash can, perfectly nailed it, and someone's like, oh, you're on fire. And he's like, thanks.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
She thanked me for them later over text, but she seemed really sad about the cat vase. I guess she was hoping I either made her something or my boyfriend actually got her something she really liked. She loves cats and he has never gotten her anything cat themed. It is always some cooking supplies or an apron, which means he sucks at presents. Damn. So I'm just not sure what to think.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I also like that someone complimented his brand new flannel shirt.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Hey, I like your button-up flannel shirt. What other kind of flannel shirts are there?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
in a flannel shirt. Oh, so OP included photos that we're not gonna show, because they're apparently pretty graphic. He got burned pretty bad.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
No. I reckon no. Poor dude. He was on fire for 20 seconds. We're getting reactions from our producers over there. It must be gnarly.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I wanna see. Flannel. All right, you're gonna get our reactions. Live reaction.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Oh, that's got to suck so bad. Oh, that sucks really bad.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
So he kind of like can't wear a shirt for weeks.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Comments, rest in peace, brand new flannel button-up shirt. Ha, ha, ha, ha. Someone else said, the question we should be asking is what kind of bastard makes tea on New Year's Eve at 9.30 p.m.?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Lastly, someone said, as someone who has had third degree burns, you have my sympathy, friend. Burns are absolutely not a fun experience and I feel sorry for anyone who has the misfortune of experiencing them. But hey, on the upside, at least now you have a bitchin' story and can laugh about it with your friends in the future. Remember, look hot as you can for New Year's Eve tonight, lads.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Johnny, maybe try not to be as hot as you were last year, though, yeah? Hey, nice. Good joke.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, that guy's going to tell that every year.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Like, you remember that New Year's Eve seven years ago? That New Year's was fire. This New Year's Eve, he is going to tell that story. Yes. Seventh year in a row he's telling that story.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I know Ohio's a meme. Yeah, Ohio's a meme. Because all the worst shit happens in Ohio. I only know the Dark Souls Ohio meme. Yeah. Or the Elden Ring Ohio meme. But Ohio's just like, it's the freaking hellscape.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Our next story is another am I the asshole. Am I the asshole for giving my mother-in-law a fake copy of my house key and exposing her during Christmas dinner? Let's fucking go. Let's go. That's awesome. Holy shit.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Does anyone have any idea what to do in this situation? Wow. My thoughts exactly. Couldn't have said it better. Santa's watching, okay?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I want to preface this by saying that I, a 34-year-old woman, married my husband, who's 37, a year ago. His mom is Snoopy and annoying as fuck.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
That's crazy. She can't help it. That's just how she is, as my dear in-laws say. My husband and I purchased a new house recently. My mother-in-law kept pushing to get an emergency key. She promised that she would only use it in an emergency, but given the fact that she had an emergency key to our old apartment and walked in on us being intimate, twice, my husband didn't think it was a big deal.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I just couldn't trust her. I just sent her a fake key after she kept pushing and she had a smug look on her face after I hand delivered it to her. Days passed and during Christmas dinner, my mother-in-law angrily called me out on the fact that I gave her a fake copy of the house key. She shamed me for doing this in front of everyone.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
But in my defense, I asked her how she found out and said she found out days ago when she came over at 4 p.m. while my husband and I were out. I reminded her, didn't you promise you wouldn't use it unless there was an emergency? So you tried to get in when there wasn't an emergency and you broke the promise you made to us. She looked red in the face.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
The other family started staring and some even laughed at her for the face she made. She suddenly got up from her seat and rushed into the kitchen where she had a huge meltdown. So loud the next door neighbors must have heard. Literally, I've never heard a 60-year-old woman throw a tantrum like that. Needless to say, dinner was awkward and my husband and his sister were giving me looks.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
My husband went off on me in the car and said I lied, manipulated, humiliated, and exposed his mom and said he wouldn't have let me get away with it had he known. We had an argument and he is demanding I apologize to his mom for my childish behavior and for ruining Christmas dinner for the whole family.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
No, man. No. That's absurd. I'm just such a private person, I would not, if someone showed up unannounced and opened my front door, I'm like, you lose your privileges.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And they be fucking, and she shows up whenever they be fucking.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
In Ohio. If that happened once, do you know how, like, if I'm him, I'd be like, we're putting up, like, planks of wood over the front door.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
No, she sucks. And then she threw a huge tantrum. But somehow everybody's on their side? Well, just the son is defending her. It doesn't sound necessarily like everyone. We don't hear about everyone else. The son is defending.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Don't you care about your own privacy too? I'm like, yeah, you care about your wife. You care about her privacy. Aren't you also pissed this is happening? He's kind of like, he says like, oh, it's not that big of a deal. It's like, she walked in on you guys twice? Twice.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
There's been a lot of stories of parents who want to continuously barge in without even an invitation.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It's kind of a double whammy. You're a bad son and a bad boyfriend at the same time.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
The verdict was not the asshole. Comments, what was possibly the logic to blame you for it? OP says, he blamed me one time for not locking the bedroom door, which is something we never do, and the second time for when she walked in on us making out in the living room.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He said intimate stuff should happen in the bedroom just to be extra careful about people walking in, aka his mom, and saw no issue with her walking around in the apartment like she lived there.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
one time for not locking the bedroom door. No. So not only is she walking into the apartment, she's like walking into the bedroom.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
If I'm her, I'm setting up home alone traps around the place. Hold on, we gotta lock the bedroom, but what if my mom walks in?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Or are you... Frankly, you could lie in this situation and be like, oh shoot, my gift for you is on the way.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
No, if I'm her, she'll walk in and have a paint can to the face. That's how it's going, man.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Someone else said, not the asshole. You did expose his mom, and rightfully so. She needed to be exposed. Your husband is out of his mind for enabling and encouraging his mom's demented behavior. Mother-in-law and husband are major assholes. Lastly, someone said, OP. Not the asshole at all. The fact that you're dealing with this is utter BS.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Your mother-in-law is so out of line for invading your privacy, calling you out in front of everyone, throwing a tantrum. Holy smokes. There are so many red flags here, I really hope she doesn't cause your marriage to suffer. I feel like that's where you're headed. OP said, unfortunately my husband always thinks that his mom is doing nothing wrong and I'm the crazy overreactor.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Despite trying to explain to him, I feel like my voice is never heard.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Why are you going to the bedroom? What was she doing?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Like, frankly, classic. That way you're trying to not hurt their feelings, but you did mess up. But at least you can do that. Don't take something that your girlfriend spent weeks making Yeah. Passed off as your own.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He's 37 and she's helicoptering like that.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, he was pissed at her, yeah.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, seriously. All right, next up. Am I the asshole for not getting on a flight upon finding out that he put my kids in economy?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
So my fiance has three kids from his former marriage whilst I have two from my former marriage as well. I quit my job to start focusing on getting my degree. He's become the breadwinner, if you will, although I still contribute with my savings. I also do 80% of childcare and chores.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Long story short, he wanted me and my kids to attend Thanksgiving with his family who are located across the country and we were supposed to go yesterday ahead of time to get a rental place. He booked our tickets and everything, but later, before the flight, I found out that he, his kids, and myself were put in first class whilst my two kids, 14 and 10, were put in economy. I was stunned.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He acted like it was no big deal and told us it's just a few hours and the kids could just hang in there for a little while. I asked how he could think this was acceptable and he got mad and said, since he's the one paying for the tickets, then we go by his rules. I immediately turned around and took the kids and made my way out of the airport.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And then get mad at her when she's like, no, I made this for my mom.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He started following us, screaming at me to go back, but I refused and told him that I no longer felt like spending Thanksgiving with his folks after this. My youngest cried because she never flew without me. He went with his kids, me and the kids are home,
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He has not stopped calling, trying to berate me, and even had his mom text me that I needed to get over myself and stop teaching my kids to be spoiled and entitled. She said that the fact that I was willing to miss Thanksgiving with the family over something so trivial shows my real character and personality and mindset or lack thereof. I have not replied, but I feel horrible. Am I the asshole?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Should I have just let it slide and just went? In case I wasn't clear, me and the kids left our family slash hometown so we could go celebrate with his family in his hometown. My kids weren't too excited about leaving their grandparents for a week or so.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
That's such a deliberate, conscious decision. Totally. I kind of don't use this word. I try not to use this word, but I'm like, that... It comes across to me, that's abuse. That's treating these kids in such a different way. Oh, yeah. That is psychologically, that's going to affect them. And he knows that's going to affect them.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He's literally, you might as well tell those kids, hey, you're not as special.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I mean, what a horrible thing. You're supposed to be all a family.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
You kind of have to all be a family. You can't do that. Right. It's so manipulative of the husband, too, because he knows she's getting her degree, she's still contributing as best she can, but she's not currently the breadwinner. Right. And it seems like he's, I don't know, he's using that to his advantage to punish people for no reason. Yeah.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And I understand, too, that for a lot of people, just because they're married, it's not like her kids are his kids, right? That might not be their dynamic. They're 10 and 14. But he loves her, and so him treating her kids that way is actively disrespecting her as well. If I'm her, I'm going, oh, you don't love me. You don't care about me. If you don't care about my kids, you don't care about me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I just think this is such a clear sign. And I know the Reddit advice is always like, divorce, but I'm like, this guy clearly... Yeah.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And he had not told her this until they were at the airport.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah. And she also said her daughter had never flown separately from her on a flight. So he was going to do that and then be like, oh, it's no big deal. And they're old enough to get it. Okay. Exactly. If 10 and 14, they're like, yeah, he hates us. They're like, wow, yeah, that's an asshole move.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Right. Verdict was not the asshole. I think it was great of her to stand up to him in that moment because that sends a signal to her kids like, hey, she's on their side. They saw that. She cares about them. That matters. Comments, not the asshole. His kid's in first class, your kid's in economy. That's a bad sign for the future.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Then his response is to berate you and future mother-in-law calling your kid spoiled and entitled. Even worse, it would not have ended there. I would be done with that relationship. Someone else said, no, you are right and not the asshole. Either all kids fly one way or no dice.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
If you can afford first class for four, you can afford first class for six, or all fly economy if you don't want kids to feel entitled. He has clearly shown where your kids stand, especially over his kids. You may want to rethink marriage to an asshole like that. Lastly, someone said, not the asshole. Your fiance seems to be missing the point.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It's not that you expected your kids to be in first class, but that once everyone else was in first class, it was not okay to put them in economy. I would be very worried about how he treats your kids in comparison to his own from now on. My brother's widow is remarried to someone who makes a lot of money. I can assure you that he treats her kids exactly as how he treats his own.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
The separation is the problem here. I fly economy, most people fly economy. Economy's fine. If he wanted to treat himself and her to be like, hey, let's ride first class, all the kids can go at economy. That's fine, but don't separate the children. That's also like, that's gonna create a crazy dynamic for those siblings. Like the three who get first class, they're gonna know too.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And that's gonna make them fucked up.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It's cartoonishly evil. Right. To go on and like actually book those tickets and do that on purpose is really, I can't get into the head space.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, he's also saying like, his response was, oh, well they'll just hang in there, it's fine. I'm like, then why didn't you all fly economy?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
The dynamic seems a little weird. Her also like, she seems to be someone who puts a lot of blame on herself, because earlier she's like, I know the nice thing would have been to let him take it. I don't know if that's the nice thing. I don't think that's nice to do, it's just,
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It's hard to go from blatantly making a choice like that to being like, you're right, my behavior's bad. This is, I think this feels conscious to me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, this is a reflex. This is like, he really thought this out. Update. What do we think? So they're engaged. They're engaged. They're not married. It's their fiance.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Which means she can a lot more easily get out of this. Break it off. Doesn't have to sign a paper. I think this is a break it off moment.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I'm currently getting myself and the kids packed so that we can stay with my mother. This has happened before in other instances but I kept thinking to myself, this is not right but I have invested too much time and effort in this relationship so maybe this shouldn't get in the way. And I try to minimize most situations where I find my kids being put last.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Not only that, but he tried to give me an ultimatum regarding getting my degree, and what was my response? This isn't right, but kept making light of it and letting go. Now he's probably bad-mouthing me to the whole family, and so is his mom, bless her effing heart. The kids and I are leaving.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He'll be coming back to an empty home, except he'll find some company with the engagement ring that I took off and left on the nightstand. Distance and some reevaluation is needed right now. Thank you to all who reached out with helpful input and perspectives. You're right, my kids come first and that's what I keep trying to do and I hope I won't ever fail. Thank you so much for the support.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Can't be surprised that there was a pattern. Right. She's like, oh wait, this happens a lot.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Well, I'm so glad she got out of that, man. Yeah.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Bless her effing heart. Our last story.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
One more for holiday gift. Am I the asshole for telling my brother he cannot stay with me over Christmas if he brings his prosthetic leg?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
My younger brother has a prosthetic leg. I think it is creepy AF and I have no idea where he got it. I'm reasonably certain that it is something I would rather not know. To be clear here, my brother has two perfectly healthy legs.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Still attached to his body. He just has this thing he takes with him everywhere. I don't know why I don't wanna know. No. He wanted to stay with me rather than our parents while he is home for the holidays. I said he was welcome to stay so long as he doesn't bring that thing into my house. He said it wasn't a big deal and that he would leave it in his luggage.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I agreed on the condition that if I saw it outside of his luggage in my home, that I had the right to destroy it. He backtracked on staying with me and is at our parents' house where he is miserable. They still treat him like a little boy instead of a guy who's almost 30. He called me again after supper and asked to please stay with me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I said he could so long as we together took his thing and put it into a storage unit until he leaves. I get the key, he won't do it. He says that I'm being a bitch for not letting him stay with me. I think he needs to get therapy or a girlfriend, boyfriend, dog, cat, hamster, something. Just not a goddamn prosthetic leg. That's so funny.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Sorry, you're gonna have to stay with mom and dad. And he's just like, you're pulling my leg. Come on, come on.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Leave your third leg at home. You gotta put that third leg in a storage unit, man.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It's one of the limbs from Talk to Me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I fully, man, from the title to what the story actually was, because I thought, here you have this brother showing up with a prosthetic leg and he's like, you gotta take that off, man.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
You gotta take that off, you gotta hop, you gotta hop around my house. That's not what God intended.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Dude, that's unbelievable. That's awesome. Verdict was not the asshole. Comments, I know this is extremely distressing for you, but I'm laughing so hard. At first I was like, is this asshole serious? She won't let her brother bring his leg? Like his whole ass leg he needs to walk around because he literally lost a leg in some horrible accident?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
But then you clarified both his healthy legs are still attached and I lost it. Not the asshole, but you and I are not the same. I would need to know all of it. Where did you get it? Why do you have it? What do you do with it? Did you steal it off a bum or something? Then I would stare at him uncomfortably until he broke and told it all to me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I may later regret my decision, but I don't often think that far into the future when something catches my attention. Someone else said, I'm a prosthetist and I have to ask, what does this leg even look like? Below knee or above knee? Does it just have the pylon bare or is there a foam covering so that it sort of looks like a leg?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Is there a foot shell on it or is the foot component just sort of hanging out? The reason I'm asking is because A, prosthetic anything is mind-bogglingly expensive and B, you can't just have a prosthetic leg if you have two perfectly healthy legs. You literally need a stump to make one that's specifically yours. Did your brother receive it from someone? Did he steal it?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And just to be sure, it's an actual prosthesis and not a leg brace of some kind. I've had patients and their families make that mistake before. OP says, it looks like a carbon fiber cup with a steel knee and lower leg and foot. They respond, oh Jesus, AK prosthesis are not cheap. That's an entire car right there. I would actually grill your bro on where he got it because it is 100% not his.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
If he stole it, he's looking at felony slash grand theft charges. If he bought it, check his and your parents' financials because again, these things are insanely expensive and he doesn't sound like the brightest bulb. Make sure he does not try to sell the prosthesis or any of its components. I get that they can be hard to get for people who need them the most,
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
But if the components are damaged in any way, they can lead to gnarly injuries for when they inevitably fail. If you truly do want to get rid of it, there are organizations out there that will take old prosthesis and refurbish them. Lastly, someone said an emotional support prosthesis leg. That's a new one.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
There's always someone in the comments who's a professional in this field. Yeah, yeah.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I like to think that he was on the street and some random person came up and just gave it to him and was like, here, take this, and then ran. Like it's cursed.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Update. Let's go! We gotta, I hope we get some information.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I didn't realize how much attention this was going to get. Enough that someone informed the woman my brother stole it from and she was able to figure out what happened. She called the cops and he got arrested.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He stole someone's leg? And was walking around with it like a viking? Dude, what? Holy shit.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I guess he was sort of trying to do the thing where he could be the hero that tracked down her leg. Please don't ask me what the fuck was going through his head. The leg was expensive enough that he is facing real criminal charges. That's all, sorry there is not more to tell. What do you mean? What? So that person was right. This could be felony slash grand theft charges.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
These things are worth, like, over 15K, I guess?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
OP was saying that he was gonna try to like play the hero and bring it back to her and be like, oh, I found it. I found, and I knew it was yours.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Oh my God. Her brother is one of the, characters from It's Always Sunny in Philadelphia. Literally. This is a horrible person.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
A horrible person who's also really stupid. This is... Which is funny, but they're still a bad person.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, they are a full criminal now. I think we should hear him out.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
She doesn't need to feel bad about what she did. This is on him. Side note, she spent like two paragraphs giving us exposition on how she and her mom loved nature, only to lead into her talking about a gift that is a Siamese cat ring. Completely unrelated. I was like, well, there's cats in nature.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
You know who's aware of this? You know who saw this? Santa.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Santa saw this. This guy's on the naughty list for a long time.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Well, it's not Christmas yet. He was gonna give her another leg.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I feel so bad for the lady who lost her leg. You already lose a leg. And then you get another leg. And then you lose that one. That one gets stolen. I'd be so pissed.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
If I'm her, I'm becoming the Joker. I'm full on the Joker.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I'm replacing it with a gun now. My next leg is a shotgun.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Someone was like, hey, I was on Reddit. I was like, wait a minute. I know your leg is missing. I found it. I think we found it.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Somehow to me, if he goes to prison for this, Which maybe it won't be prison. Maybe it'll just be like a massive like fine. I don't know. But him in prison, something about this, I feel like despite even if he was like talking, like hanging out with a murderer, they'd be like, so what are you in for? And he's like, I stole someone's prosthetic leg. Even the murderer would be like,
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
The holiday season can be a time for a lot of drama for a lot of people. Yeah. Have you ever dealt with holiday drama?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
the fuck is wrong with you?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He's like, dude, that's uncool. That's really uncool, man. Dude, does Santa know? I killed a man, but that's really uncool. That's just like comic book villain. You can never live that down. There's no explanation for it. That is awful. There's no... Zero justification.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
You are full on a villain forever. Oh, well, I'm so glad that he was tracked down and she got her leg back, I'm assuming. Yeah. I hope so. That's what's important is she got her leg back.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Awesome. Maybe if they can get a lawsuit going, she can have that leg plated gold now.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
That would be pretty cool.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Anyways, thank you both for being here. These were some crazy stories. Hey, thanks for having us.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And your boot. I'm going to steal that.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I just found out my crutches are gone. It starts with the crutches. Thank you for watching. Let us know what other themes and subreddits you'd like to see on this show, and we'll see you next week.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Ho, ho, ho. Chur's not running on an open fire.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Hey, I know you really love cats. I know you're a huge fan of cats. Here's The Matrix on Google.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
It was an urn. Like, okay. My mom really loves dead cats, so I got her a Siamese cat urn. I feel so bad for the boyfriend's mom. She just wants a gift, man. She just wants to be thought of.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And she thought she had that false hope for a moment of like, oh my gosh, you made me something so cool. Right. She's saying, oh, she probably thought that I made it for her and that meant something to her. But what I think could have been really thoughtful is if the boyfriend weeks before or months before went in and said, hey, you make such great stuff. Can we make one for my mom?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, you know, that would've been great. That's a joint gift. Yeah, imagine being a mom.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, you don't come to dinner. I'm like, the fuck, dude?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Comments, I don't really have advice to give, but I want you to know that I think your actions were quite reasonable. Your boyfriend should not have taken the gift that you'd made specifically for your mother. It sucks that his mother was hurt, but I think if you'd let him get away with it, it would set a bad precedent. Good for you for standing up for yourself.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, I'm sure. Okay. Yeah, I bet. I think I've gotten pretty lucky. I don't think there's been too much holiday drama for me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
If he decides to break up with you over this, it's due to his own flaws and immaturity. He could have asked you to make something for his mother or found something that she'd like, and he didn't. Don't apologize for your actions. If anything, he owes you a massive apology for trying to steal your mother's present and making you look like the bad guy to his mother.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Someone else said, to be honest, I'd dump him for giving away something that you'd made for your mom without consulting you and blaming you for the fallout it created. He could have asked you to make one for her. You're not a jerk, he is. Lastly, someone said, you did nothing wrong.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
You made something that you spent a lot of time and love on for your mother, and if he doesn't understand or respect that, then that's on him. While that sucks for his mom, that isn't your problem. You seem like a compassionate person, which is why you feel bad, but I think your boyfriend was expecting to use that in his favor, which isn't okay.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And then there's the added layer of like, you do that, okay, you do that, which is shitty to do, but now that you've been caught, now that your girlfriend, like, handled the situation, you're gonna try to make her feel like the bad guy. You need to, at least at that point, be like, I, you gotta admit that you messed up.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
But he truly seems like he did not think about his mom's birthday slash Christmas until it was the moment of.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
That's the good ending to this Christmas movie.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah, definitely. I want to thank everyone for all the help. A few people advised that I should have just let his mom have the gift. This is not something I was comfortable doing. I don't make art to sell. I make art to give to people who I love very much. So each piece has a lot of love in it. My now ex-boyfriend showed up around 4 p.m. and wanted to talk at me.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He just told me he was disappointed and that he had taken a lot of sweet talking to make his mother understand what happened. He told her I mixed up the packages, but that I had one for her that I just needed to get. I told him I didn't have anything for her and that I was not going to be helping him out. He could go buy one for her and pass it off as handmade, but I was not covering for him.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I told him I felt that his behavior was cruel to me, the effort I put into my art, and my mom, his mom, just everyone. He told me that he expected better. He would not apologize. I told him... Okay. and a lightly cracked mermaid statue. I am not sure how to feel about this, but Dobby is free. Insane reference there. Wow, so he really was like, he was locked in.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah. No, there's a lot of, I mean, look, by this point on Reddit Stories, we've seen everything. Like, there's proof that anyone can be a huge asshole. But the amount of boyfriends and husbands who treat their partner, like, so horribly. I'm blown away. The entitlement is kind of blowing my mind. It's pathetic.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Well, let's see, we've got a bunch of stories here. This first one comes from Best of Redditor Updates. Okay, my boyfriend, who's 22, gave a handmade Christmas present to his mother, 40-year-old woman, that I, 22-year-old woman, made. Okay. My boyfriend gave a handmade Christmas present to his mother that I made.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
He definitely is upset that he doesn't have full control over her now. That's what it seems like he was upset about and now that he doesn't, he was just trying to guilt her. throughout all of this and then kept failing and he got really mad and probably was thinking that by threatening breaking up with her that she'd be like, no, no, no, no, no. But then she stood her ground, thank God.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
And I think he's now gonna be like regretting it.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
I think it's really important in a relationship to recognize like, oh, I'm feeling really guilty. And then to kind of, when you're having those moments being like, what is my partner's goal? Is it just to make me feel guilty? Or it's a good thing in your own self if you're saying something or doing something to your partner and going, what is my end goal here?
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Am I just trying to make them feel bad? Because if that's it, that takes some, that's a serious thing to acknowledge both in other people or yourself because it's like if you're getting to that place, that is nothing but pure manipulation at that point.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
Yeah. Well, in the case for her and... I mean, we have this one story, but in the case of so many people, they're not in a relationship. They are... They have to wedge themselves or fit into this other person's life, right? And they're controlling you because it's like, no, I get to live my life and you have to change everything for me and accommodate me. And that's not a relationship.
Smosh Reads Reddit Stories
Not So Happy Holidays | Reading Reddit Stories
That's not how it should be. Well... I'm glad they broke up. And it's been almost 10 years since that story, so. Any more updates? No more updates.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
George is like, I support the DM.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's so crazy. He hates you. How would you justify a bird in a dungeon? Great question. Maybe it's like a kiwi bird.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Yeah, yeah. I couldn't think of the word non-flying bird. Flightless. Flightless bird, yes.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
To me, it's just, it's so funny that I can't be mad at this DM, where it's like, yeah, it's like, well, you're not feeling good, so everything sucks. And also, this thing hates you. That's really funny.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
What if that was like the bird's nest and he kind of burst through the door? Totally. Going first, like it's reckless.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
That makes me want to play D&D.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I love a game where you can be like, fuck you.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Oh, what are we doing here? Maybe he bought the bird repellent.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Yeah, we haven't fought enough animals in Dread. I think that's, yeah, that'll be my.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
They're like, and God doesn't like you.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
A religious DM that, like, you know, infuses the campaign with, like, God, that feels really, Christianity is, like, really funny.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
That was a good Tim impression. They're an IT guy. Tim? We are an IT guy.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I think it's the best thing we've done at Smosh Games.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
That's awesome. That'd be sick as fuck. Yeah, cameo D&D where it's like, you just have a cameo up for every NPC. It's like, can you ask them that? It's like, give me $100 and we can get another cameo from them. Oh my god, that's so terrible. Can I have a crazy opinion? Yeah. I don't think, like... I see nothing wrong with, is she getting paid?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I don't think that's enough. I think in LA that might not be enough, but somewhere else maybe. Maybe.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
If you're already showing your breasts on the internet, it sounds like it could be a fun little side quest. No pun intended. I'm thinking as a player who's not expecting that, That would be a little confrontational. I might be uncomfortable. I don't think I... I don't know. That is... But if everyone's in the know, everyone's consenting, I think it's hilarious.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
And I think it's hilarious to put the ask out there.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I think this is awesome. Okay. I think this is, like, the funniest thing you could do. I mean, look, when people, like, because we'll... This makes me want to die. It's like... No, if I were actually involved in this, I wouldn't want to actually be involved in this.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Well, to me, it's like, you know, if someone's like, oh, and there's going to be, like, a stripper at this, like, bachelor party, I'm like, I actually don't want to go. I don't want to see this. I don't want to be anywhere near this. But if you're like, yeah, then we're having someone, like, call in as, like, the tough...
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Do I want to be in the game? No.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
We'll see you next week. I love giving her like, I'm going to text you somewhere between four and six. That's like the beginning of driving. It's like, I'm going to give you a five minute window.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Just at your computer, just no sure on just your reflection in the fucking... I'm gonna need a beautiful naked priest hanging dong. 50 bucks an hour, 50 bucks an hour.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
No, that's the other thing. It's like, I feel like people are in a space where it's like, people are getting more and more comfortable where it's like, you know, truly, like, it's okay. Like, if I, like, as long as you're okay with it, like, living in perpetuity, you know, which is a whole other, I don't know. As long as everyone's okay with it. Yeah, yeah, yeah. I can still laugh.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
And you have to submit a photo. To me, the entire thing is so unnecessary. Like, that's what makes it funny. It's like, nothing about this needs to happen. You're going the extra mile in, like, such an unnecessary, stupid way. That's why I feel like the players can't possibly know about it.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I think it's another case of it's kind of funny. Oh, yeah, it's definitely funny. It's also like Mother's Day weekend? Right, what is this business, I wonder? Who's traveling on Mother's Day weekend?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Yeah, to me, it's also like, yeah, it's like, well, I already took the PTO. I don't know. It just doesn't feel, why is it his responsibility?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I don't think it's giving the PTO, I think it's just right.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
He doesn't want to go to bed, let me say. You could kind of pull the, oh, I would need more context for both, because on one hand, it's like, what if this woman's mom isn't doing well? And then in the other case, it's like, hey, what if Zelda was the last game I ever played with my dad? And it's like, Zelda's really important to me. You can pull those cards all day.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's just like, ultimately, who's more worthy of PTO? It's like, look, I wish that they could both... The workers are mad at each other. They should be mad at the system.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Because if someone was like, oh, I'm taking the day off to play this video, I'm like, okay, loser.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Yeah, no, a secret gamer. I've never once divulged that I play games. Nobody knows that Spencer plays video games. You wouldn't know by looking at me. I should have had the shirt. I should have had the shirt on. It's like I paused my game to be here.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
We need to do cutaway gags in Reddit stories where it's like, you wouldn't know by looking at me, then it cuts to Shane and then it cuts back to me and I've got the twirly hat on and I pause my game to be in a big lollipop.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Saving the Princess? What if this isn't about Tears of the Kingdom? This is about Link's Awakening, the remake.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's like, bro, you've got to go to work.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
The guy you were making fun of earlier.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
She's like, wow, isn't this monument gorgeous? Yeah, whatever, fucking, yeah.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I love seeing gamers protect other gamers.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's like, yeah, my wife was mad I was playing video games in the delivery room. It's like, bro, loser.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
This happened to Amanda in Smash vs. Christmas. Yeah. Yeah. She fell in love with Carol. Yes.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
This is literally how it feels when you guys aren't into a game that I put on Smosh Games.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
This was posted on our Christmas.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's just. It's crazy that like, you know, the vibe of like, or like the stereotype with D&D is like, oh, it's like a nerds game. But it's like, it's a game of reading the room. Sure, it absolutely is. And the DMs, their biggest role, I would say, well, I mean, I would let you say this. If you want to say it's about reading the room, I'll let you say it. It's about reading the room, gang.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
This board game sucks, dude.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Whenever Angel and Amanda talk during Resident Evil, I pause the game. I'm like, so you guys, I created this. You guys aren't into this?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Waiting. I was like, wait for the text, wait for the text. Yeah, I was like, that's who they need to break this tension up. They need a beautiful princess or a beautiful priestess.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I also like, for the time being, it's like TBD. Maybe, yeah. Maybe quit for a while.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
No, I was going to say, when you threw blackmail, I was like, what is that?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Yeah. Yeah, what the fuck? What was the line he said? He's like, I'm not going to put any more time into this. Yeah, he put 15 minutes into it.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's almost like parasocial. I don't know if that's the right word. Yes, there's something like that. It's like, oh man. Yeah, I'm trying to think of the word when... It's like parasocial with your characters that aren't real. Yeah, where it's like, if you are being the character and I fall in love with that character, and the character likes me, I'm like, oh, that George likes me.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Babe, you don't know. You know I don't love engaging with the things you've created.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
That's for sale, DM chair never sat in.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Saying you're going to the bathroom then leaving, that's really funny. In the middle of a game?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
If he had said an hour, maybe I might have felt like a little sliver of like, oh, you gave it the old college try. 15 minutes is crazy.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
That was one of those where it's like, I'm just nodding that because that was really good. Thanks.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Oh my God. I thought it was gonna be like the person wanted to like sing everything.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
And it's like, yeah, no, dude. Like we're trying to chill out and like play a game.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
This is something much funnier.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Has there ever been an idea that you've just been like, I really don't like this, and you've kind of tried to sway them away? Well, yeah, probably. I don't think I can remember.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
This is like finding out about racism from like Detroit Become Human or something like that. It's like, whoa, I never thought of it like that.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Look at that. He's like, whoa, guys, we should do something about this. D&D, everyone. This is so funny. Yeah. There's a story I know like this, of something like this happening to someone in real life, where something very innocuous was like, oh, whoa, I guess people of color really do go through it sometimes. It's like, Yeah. Really? What? Really?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I don't know why that taught it to you, but hey, I guess if you learn somehow.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Yeah, and this NPC really doesn't like you.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
He hates you in particular.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
That was a lot of fun. I'm glad we didn't have to... That last story, that comment was like, oh, that's everything we needed to say.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
We wanted to have her princess, sorry, keep going.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
My eyes hurt. Revisit it, like come back to it.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
And so he's just completely- So if you ever like watched a movie for, like if it's like, oh, your partner's like, oh, like I want you to see this movie with me. It's like one of my favorite movies. It's like, okay. Yeah. And there's two hours.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
You gotta power through those first 15 minutes. The game really opens up after the first 15 minutes.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Where it's like, yeah, hey, it's about a relationship. It's like, well, I don't know.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It sounds like she needs like a sensitive gamer boyfriend. Yeah.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's like, hey, bro, do you enjoy storytelling? It's like, bro, fancy a story?
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Courtney Miller's Disco Elysium. Yeah.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
But no, I think that is closest. Or I mean, what was the game you and Damien played forever ago? Doki Doki Literature Club.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
I think dating sims and visual novels are often conflated. I think there's a lot of elements that they share.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
Otherwise, essentially, anytime, yeah, if your partner makes you do something, I'm like, I'm being blackmailed. You're committing fraud right now.
Smosh Reads Reddit Stories
Critical FAIL Stories | Reading Reddit Stories
It's scary campaigns you can play with your friends.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Which is actually awesome.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I don't think I did, I think I was safe.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I'm gonna preemptively guess that maybe they're all working at a hospital or the wife is a medical something.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
The doctor was a woman.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Fine, women can be hairdressers.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, we'll see if they're cringy.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Well, that was cringy of you to say.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Oh no, I reach out to my network.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah. Maybe he should have sent it to his wife.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
He's like, dude, that's your belly button.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I mean, the boss could have done a lot. The boss could have been like upset or like, you know, it sounds like they handled it kind of like friendly, being like, dude, what the hell, you know?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I mean, like, do we have the photos so that, you know, we could maybe just, like, put our input in?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Can we maybe just see it?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Oh. Hey, that's okay. Hey, man. That's the story. Hey, man. Yeah.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
And I'm sure, like, him being a, in his words, 28-year-old kissless virgin has probably contributed to that. Like, his confidence over time has probably sunk down. Yeah. And that's why something so, again, like, it makes sense to get overwhelmed. It's not like, oh, my gosh, this is so crazy and rare. It's like, oh, that's unfortunate.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Totally, totally. You're almost starting to form that as your personality.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
If I had to guess, maybe this person was in a very specific friend group growing up, or inside of their little community, they must have been the last one to get their first kiss or something, and so maybe it started to feel like they were very behind, When in reality, I think there are a lot of people who haven't had their first kiss until their late 20s.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
They just don't like admit it or say it out loud.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
It's almost like a different marker is going to sprout.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Maybe it could even be attributed to like this zoomed out image of validation, right? Because what he's seeking is from someone else rather than an internal confidence boost.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Right, it's like maybe before he was like, I have never had a girlfriend. Now he has a girlfriend, but he's like, okay, but she hates me because I'm ugly. Like, for sure, because she doesn't want to be with me.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
interior like work so yeah and and when we're talking about it uh in a sexual context it feels really sensitive but i think that that can parallel absolutely lots of different things right like it's kind of like like if you're pursuing a job right you really want to get a job but you're like but i suck and i really i'm not qualified and then you think getting that job is going to validate you but then you get the job and you're like i don't know why they gave it to me i really don't deserve it and you just
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
keep pulling yourself down.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Exactly. You're so right, yeah, it's like it's rewriting the narrative, just giving it a different perspective, but you can see how many times he chose to bring himself down, even the idea of, oh, she was laughing harder at my terrible jokes. Like, King, you were being funny. Stop, dude.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Quick little update.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I don't think he needs to worry about that.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
To new beginnings for him.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Hopefully like reaching out and only seeing these positive comments introduces him to a different community.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
All right, screenwriter.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, dude. I'm down.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Okay, but where did she order from?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Taco Bell, it's gotta be.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I thought it was gonna be her own shadow that she kept seeing. And I was like, that's just a really bad high.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Poor thing. Hey, we've all been there.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, when you got the dispatcher on the phone.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, she probably put the pen down for a couple weeks.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I mean, it was after work. She was just, like, relaxing.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
She's like, yeah, you play?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I'm calling the cops. They're like every night, every night.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Girl, that's what you're gonna eat on your munchies?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Give me this, I have no salt.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I guess that's what a bad high can spiral you into.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I actually haven't.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Exclusively, I'm gonna go home and have a bad night.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I was gonna say she deserved it, and then I remembered the postpartum depression.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Because she can't use chopsticks.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
And usually that is, I think, the best way to diffuse a situation that cannot ever have fingers pointing back to you when you just call it out, right? Like, hey, I'm going to stop you right there. You're being incredibly insulting.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Maybe some familial expectations as well, because she started by saying, I'm 25 and I don't have kids, which doesn't seem too crazy to not have kids.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Some sort of rivalry or competition.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, you start to boil up, and if you don't want to be disrespectful in the way of leaving the table, then I guess naturally if somebody's temper reaches that point, you might spit something out like that.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
She ate with that.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
You can be a big asshole.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, but then there's also that saying, the person who throws the second punch starts the fight.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
You're like, hey, why'd you do that? Why'd you do that?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, no, then he starts the fight. No, you started the fight. That's what I'm saying. I don't know if I completely back that, but it's definitely something to consider here because you could have stopped it.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Guys, I'm just relaying the expression. I didn't come up with this.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Right. Yeah, true.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Right, they're just trying to protect the entire family, so they're just like, just don't listen to them. And it's like, well, no, you're actually making it worse.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I'm curious why they were so quick to be like, to OP, to be upset with her about what she said. Was it because hers had more weight?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Which is kind of selfish behavior, though.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
She really just said that? Across the bar.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
We have the footage.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
No, no, of course not.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
That's wild. This is crazy.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
When the whole, like, internet thing happened, when, like, I forget, it was, like, Windows or something that was down, I was at the airport, and there were so many people yelling at the, like, They were just like, we don't know anything. Everything's down. And people were like, well, I need to get to Massachusetts. And I was like, well, you can't. Nobody has any update for you.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I know, and it's so sweet that they're so similar in personalities and they relate as well in a lot of their insecurities, which by the way, so messed up for people to ever use the sentence, can they speak, in front of another person. Like just pretending that they're not there, that like totally threw me off.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
They're untrained. 30 cents for their meals though.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
That is some crazy family drama, though. That is some beef. That is some tea that if my mom served it to me, I would be definitely spewing it out at a restaurant.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
But it seems like they're very similar and maybe somebody who would have gotten freaked out by somebody making them breakfast would have reacted differently, but it just feels like a little misfortune. Nobody necessarily misstepped.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Oh. She's not the one.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
She's not the one. If you can't fart.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I can still smell it.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
We all had Chipotle.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
We all had Chipotle? Remember, like right before the show?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Yeah, that's insane.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Right. But he thought it was gonna be like a and it was a
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I mean, we've all been there. Like, you know, when you were younger and you farted and you were like, no, it was my shoe. And then you're like rubbing your shoe against the floor. Like, I know why he did it. I'm not mad.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Farts are funny, and if you don't think that, I think that's- Yeah, dude, it's hilarious.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I love a good fart.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
This is such a clear case of how we can be read a story and think it is just tailored one way, but when you hear it from a different perspective and not the person who's a part of the story, it is a completely different tale. There's always one person's side of the story, the other person's side, and then the truth, right?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
See, but it's so interesting, because he was like, oh, I immediately tried to play it off. And she is saying that he did not play it off at all. And I'm sure that it's not necessarily that embarrassing, but it also probably wasn't as smooth as he described it. It was probably somewhere in the middle.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Which is definitely the cringey part of it.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
And did you clear the room?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
So funny the way she wrote it, too. Like, that was last weekend, he's dead.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I really hope so. That doesn't seem too cringey to me.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
roughhousing on the second date. Damn, they were really roughhousing. Talk about nuts.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I think it's worse to be cringey than be embarrassing.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Right. And when you consider the personalities that she set up in her original post as well, they're both already, in her words, weirdly quiet, so I'm sure that they... They're similar, so her feeling is probably his feeling. Exactly.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Whoa, happy ending.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I just learned this as well.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Sure. It's giving like lean cuisine.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
But it's like, when you're cringing at someone, it's like, ooh, that gives me the edge.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
And the first flavor is nuts. Hold on.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
I'm just gonna quickly bulk order.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
45 grams of protein.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Well, so then it becomes cringy then, right? By our logic. You're right.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
So then fully commit to it, bring the dog food every day.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Nobody would blink an eye.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
So are you guys saying that we should do it and see if anybody says anything?
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
Don't attribute it to age.
Smosh Reads Reddit Stories
Stories That Made Us Go "OOF" | Reading Reddit Stories
We fed Angela cat food, so.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
My girlfriend thinks it's weird to give the same perfume to both your sister and your girlfriend. I think that I got a gift that I knew each of them would like and enjoy. And that my thought process was that if they happen to be the same perfume, oh well. Is that it? That's it. Here's the deal. Am I the asshole?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You did it. Hey. Well, let's see if any of these stories make you go, what the hell's going on?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
It's fine if he's fine with it. My thought process kind of is that when you do like the same gift for a bunch of people, that can work in a lot of contexts, right? But like this is two very important people in your life. Like this is your partner, this is your spouse. Or this is your girlfriend and this is your sister. To get them the same gift kind of shows like
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
To me, it's like it's not as special. Oh, right. Because what's important with a gift is the thought that goes into it, right? And I think this is a perfect example that this is probably an expensive perfume, but because he got them the same thing, he was just like, oh, this will work for both of you. As opposed to putting special thought into both of them.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Huh? Huh? Wait.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
It also depends on the girlfriend, right? It depends, like, some people's love language is just not gift-giving to the point where they wouldn't care about this. But clearly, his girlfriend did care. And he didn't think about that.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I'm like, yeah, you're right. Perfume for old ass ladies by Calvin Klein. And I'm like, awesome. I'll get there. Citrus and vanilla, or whatever the fuck it said.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
What is going on?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's dreamsicle right there. The verdict was asshole. They did determine he was the asshole. Now, this is the thing. On this show, we read so many stories of people doing horrible things, that this is a little bit more of what I call sitcom-level shenanigans.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
OK. Our first story comes from Am I the Asshole? Am I the asshole for telling my girlfriend to suck it up around my clown figurines? Oh, she's gotta love the clown figurines, or what are you even doing? What are you gonna do? This is just fun. This is a 26-year-old man. Me and my girlfriend, who's 24, have been dating for two years. Since we started dating, she's known that I love clowns.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
So yeah And and the comments show it like top comment gently. You're the asshole. I Your heart may well have been in the right place, but perfume is a pretty romantic gift to give your partner, and it absolutely sucks the romance right out of it to give the same gift to your sister. You're not necessarily an asshole, but you're definitely the asshole here. That has 8,000 upvotes.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
OP says, fair enough, I see your point. There is definitely a point to be made of like, oh, so when I wear this perfume, I'm gonna smell like how your sister smells too. Right. And that's, That's not.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's not conducive for romantic situations.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
See, I love giving gifts, I love trying to find the right thing, but I'm really bad at shopping. I don't know where to find shit. Me too. And I don't even know for my own sake. I'll be like, oh, I want this thing. I don't know where to get it. And then I'll try to search and I'm just really, that's where I'm bad. That's where I'm bad at it. So I'll be like, oh, I know this person likes this thing.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I'm like, I don't know. Where is that? Let's see. Or what kind of thing out of that interest do I get? Right. Got it. That's where I start to struggle is the second part. Right. I feel that. So update? No update. Yeah. But we have two more comments. Not necessarily an asshole, but you should definitely put more thought into the gift.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Why would someone want the same exact thing that you gifted someone else? Instead of getting them something unique that matches them specifically, it's giving off the vibe you just got something quick to kill two birds with one stone. Oh. Yeah. Lastly, someone said, you're the asshole. The only way this would be worse is if you bought lingerie.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I remember that one.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Am I the asshole for correcting a coworker about something?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Huh? What the heck? What the F? What the H-E double hell?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Correcting someone is a scary thing.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Correcting someone, even small, small little things, it can be a tricky situation.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
How much did you do that in school?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
They probably ripped you up.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
They hated me. I can't believe I'm going to write this, but I don't know whether or not I'm actually this insensitive during this time and age, or if this is an extreme overreaction. But I'm going to let you guys decide because I like to assume you guys are more emotionally savvy about this topic, so here we go.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
So about two weeks ago, me and another coworker were talking about the topic of chocolate milk. And well, she's one of the 10% of Americans that actually believe that chocolate milk comes from brown cows. Correction, apparently someone commented that 7.4% of Americans actually believe that chocolate milk comes from brown cows, which is a lot less than 10%, but still a lot, yikes.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I admit that I guffawed a bit, to which she took offense to, but I ended up apologizing, but telling her that I thought she was a bit silly and told her that chocolate milk is actually just regular milk with chocolate syrup, to which she got defensive and said that she didn't believe me. So I asked her if I could show her proof that she was wrong, and she dared me to do so.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I have several porcelain clowns displayed around my house on walls, hung from the ceiling on little swings and on shelves. I adore these weird little creatures. Well, last week I bought two Venetian masks from the thrift store and they're in great condition. I got them for a decent price too. She hates them. She said they're creepy and give her bad vibes, whatever that means.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
So I bought regular milk and chocolate syrup from a nearby store during my lunch, mixed it up, and gave it to her to drink. And she was like, ha ha, I was craving chocolate milk, and you got me.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
The long con. Okay, she ended up drinking it and just left in a huff and apparently just told our shift manager that she was leaving for the day because she felt attacked by me and demanded she needed a mental day to which the shift manager didn't approve of, but she left anyway, so whatever.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
But apparently this whole thing got everyone else's attention because my coworker made such a big scene about it that it apparently attracted enough attention that my store manager had to personally call me to his office yesterday and tell me about what happened that day.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I didn't know at the time, but I really offended that poor coworker of mine so much that she told my store manager about how she couldn't work with me anymore and that she even reported me to HR for discriminating against her beliefs. and that I apparently caused enough mental damage that she couldn't even go back to work due to how much I humiliated her over chocolate milk.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
My store manager even wrote me up and warned me that the next time I acted in such an offensive manner like that, I would be fired. I mean, I'm already quitting and starting a new job anyways, but I'm worried about whether or not I'm actually the asshole for this and if I should be more careful for my next job.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
They work at the place that makes Cadbury cream eggs with their chocolate chickens. Where are we? What's happening here? Oh, my God. Some people really, some people cannot handle. It's like buffalo chicken. You're wrong. And it's like buffalo chicken, which comes from buffaloes.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Or chicken. Or Rocky Mountain oysters, which are oysters that are up in the Rocky Mountains.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Also, it's chocolate milk!
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I know. Look, nowadays, especially with the internet, we all believe things that we find out later we're wrong. Like, it's so common. I think it's important to have that amount of doubt with anything where it's like, oh, that fact that I know. Oh, is it wrong? Oh, okay, it's wrong. We all have these things, but it's important to like, when you're like, oh, wait, is that right?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I told her that I would take down the masks when she's staying the night, but I'm not getting rid of them. She told me that was fine. Yesterday she got up and told me that we needed to talk. She told me that she's sick of seeing my weird decorations and clown toys everywhere, that they're ugly and creep her out.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And I sometimes even just second guess that stuff myself and I'll Google it and I'll be like, wow, I can't believe I was thinking that.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I'm curious too, I'd be fascinated. I don't know much about HR, like in a business setting, what are the parameters of how you go about these things, right? I just keep thinking now about her, once she finally drank the chocolate milk that he made right then, if she just took a sip and then she goes, we really landed on the moon, didn't we? Like, it's probably what.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Why would the wind blow, no. The verdict was not the asshole. And the comments, not the asshole. The good thing out of this is that you're moving away from this work environment. I can't believe someone would go to such an extent over chocolate milk. Random gift idea on your last day of work, bringing chocolate milk as a gift for everyone for the fun of it. She's gonna kill you.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
This last comment says, where does she think strawberry milk comes from? That's pigs. Someone replied to that saying, not the asshole, where does evaporated milk come from? And someone said, the souls of dead cows.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
It's ghost milk. Ghost milk.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
We don't know. I said pigs.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And then it gets even weirder once it's just like, where does oat milk come from? Goats. Almond milk. That's crazy.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Oat milk is just skim.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
True. Yeah. It's true.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I asked her where this was all coming from because she has never mentioned my clowns before, and she said me bringing those ugly fucking masks into our home was her last straw. And my obsession with clowns was charming before, but now it's just disturbing.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Whatever conspires, if at the end of it someone hands me a glass of chocolate milk, I'm not gonna be upset.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You're gonna chug it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You're gonna chug it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
All I wanna see is Shane chugging chocolate milk.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's why you got wrote up.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Garcon? Garcon? It is low-key really good.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I don't hate that opinion. I knew we were kindred spirits. That's right.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
We had like no food in this place. Guys, guys.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
There was nothing there. No. You guys can't do this. What do you mean? This lifestyle is crazy.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
No. No, I offered. She said no. Before she did.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
They have a PlayStation, one couch, a shit pillow, and no art. It was a wee. My room was awesome, and we had an N64, too.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I told her that I would take down the masks when she was over, but one, this isn't our home, it's my apartment, and two, she's known about the clowns for years, and to try to stop me from decorating my place how I please is controlling. She told me either get rid of some of them or we're done. I told her to just suck it up while she's here, and if she can't, then I'll come to her place every week.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Okay, so this is just Shane's shitty room. No, we were out in the hallway in the kitchen. The kitchen, which was awful. It was big, but it was awful. Most of the cupboards were coming off.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Of course it was, and you guys were like, home sweet home.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
There were ants and flies. Really cheap. I can't.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I don't know why this is making me laugh so hard because I'm like, it's true. These guys exist. And it's you guys. It was like over a decade ago, Amanda. No, and that's fine. The cow that made the milk is dead now. Can we move on? It's all happened. Oh, God. And us women, we still come over. And we still sleep over.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's good shit. Who bought that? Oh, that was me. That was my private reserve. So I'm just worried about you then, I guess.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah. There was nothing to hunt. The stray cats that lived in our backyard were eating everything.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I can't, I can't.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
There was a whole family of stray cats that lived on our roof. Babe, I'll go get you something.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Day in the life.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
The shed where Shane lived. Let's move on. This week's Reddit Stories is also brought to you by DoorDash. Guys, Mother's Day is tomorrow. If you're hearing this and you haven't gotten your mom something yet, you're dangerously close to becoming the subject of one of these Am I the Asshole stories. But don't worry, you still have time to redeem yourself.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Moms deserve their flowers and so much more. They deserve a day off from all the nonsense we put them through. You know, like when you call just to ask, mom, what's my blood type? Or how long do I cook chicken before it's not a biohazard? Moms carry a lot of the mental load for us. So let's give them a real break this Mother's Day. And if you're stuck on what to get her, DoorDash has you covered.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You can order beautiful bouquets of flowers from your local florist, add in her favorite snack, or surprise her with something unexpected. Like I know my mom always loves flowers or a cozy candle. Or maybe you can get your mom that special treat she really likes but never buys for herself. It's the little things that make a difference.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
If you still need a last-minute save so you're not the drama this Mother's Day, grab your phone, open the DoorDash app, and make it happen. Here's the deal. For a limited time, use code PITREDDIT to get 50% off up to $15 value when you spend $15 or more at local florists, convenience, grocery, and retail stores on DoorDash.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And from now through Mother's Day weekend, your flowers order will unlock savings toward more gifts that'll take cooking, planning, and more off Mom's plate. Select merchant and items only while supplies last. Offer ends 5-11, terms apply. Trust me, your mom will thank you for this one. Now, back to the show. Our next story.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She didn't like that answer and called me a child before leaving. I texted her to apologize for telling her to suck it up about the clowns, but she hasn't responded to me. So am I the asshole for telling her to suck it up about my clown figurines?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Am I the asshole for telling my girlfriend she needs to get a real job and she will never be a famous comedian?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
The wording is just... This is a 31-year-old man, and my girlfriend is 28. She and I have been together for six years and have been living together for the last two. I'm going to attempt to keep this short, so please ask for details if I leave something out. Girlfriend has always enjoyed doing comedy and has done open mic nights since we've met shortly after college.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She had a real sales job, though. That was her Monday to Friday 9 to 5 job where she made decent money. I have a good but hard job and make almost triple what my girlfriend was making when she had her job. I said had because last August she quit her job because it was taking away from her comedy ventures. She told me a year from now she thinks she can really make it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I was a bit skeptical, but since I make enough to support us, I encouraged her because I want to be a supportive boyfriend. Since she quit her job, she began doing Uber and DoorDash, which is where she makes 100% of her money. Her comedy has gotten us zero dollars. Over the past few months, I have started to resent her though.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She constantly complains she has no money, yet drives for Uber or DoorDash maybe three times a week for maybe four hours at a time. I've been paying a lot more for household expenses and I'm not saving as much as I'd like to anymore. She sleeps till noon because sometimes her open mics run real late before she even gets to perform,
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And when she gets up, she just bums around on TikTok and YouTube looking for inspiration. She also gets very moody with me if I don't come to 90% of her open mic performances. Even after working a 14-hour day, she will get mad if I don't go to her open mic at 11 p.m. on a Tuesday. Last night, I did the unthinkable. I asked her to consider going back to a full-time job.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I said she should still do her comedy, but I'm struggling with taking care of our expenses all by myself. When she gave a dismissive answer, I told her firmly that she will never be a famous comedian.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I said she's 28 and it's time to grow the fuck up and join the real world because this is totally unfair to me that I bust my ass while she lives in La La Land and that she can't be this naive at this age by thinking she's going to support herself with this. She stared at me in silence for a few minutes, started crying and went to stay with a friend.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She called me a fucking dickhead asshole and I'm the worst friend ever. She has not answered her phone today yet. So am I a fucking dickhead asshole?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, there's a lot of communication that should have come before. It gets to that point. And telling someone you're never going to make it is also just simply, you can't say that as a true statement. You just don't know. You don't know. Now, what is true is she's trying to break into one of the hardest industries to break into. Like, definitively.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And even if you are successful, I think any stand-up would tell you it's going to take a long time.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Baby, but but also it's 28.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, and how he's feeling is completely fair. Also, she, how she's going about this is a bit weird and all over the place, because it's like, you quit your job because you're trying to go to all these open mics, but you expect him to go to the open mics. But that's why you quit your job, so you can go to them, because they're late.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's really awkward. But eventually, eventually, if she wants a future with this guy, she's going to have to be able to.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Oh, what he said was way too harsh. The verdict is one we don't get often here, which is everyone sucks here. And people are like, hey, I think everyone sucks here. And I definitely see that because... What's needed is just some communication between the two of them. Because also what she's saying is like, oh, I'm gonna make it in the next year. It's like, that's also just not gonna happen.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That doesn't happen in the industry. Even if things go really your way.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Also, making it pretty early on is probably still not enough to pay bills. You're gonna be making some headway, you're gonna be making some connections, that's cool.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I think what's also tough is that it's like she quit her job to pursue this other career, but that new job is only the show she's going to at night, so what he's seeing is also her at home a lot. She's doing DoorDash for a total of like a, 12 hours a week.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I was going to say, like... Most stand-ups I know or people in stand-up are, you're a full-time performer. So you are usually working during the day. You are usually doing other things. They're usually like actors or yeah, like pushing their comedy out on other platforms. So you kind of have to be multifaceted nowadays.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You have to be doing a lot of stuff. And the people I know who are, finding any sort of success, they work their asses off. They're doing a lot of stuff. And I think if she wants to, I think she might need to be realistic of like, if she wants to make it, she's gonna have to, it's not gonna be easy.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I also wonder what city they're in and stuff. Yeah, where are they? I don't know. And I don't know much about the stand-up sphere, right? I know it's a whole other industry. But it's similar to what we do. I also, my thought is like quitting your job, I'm like, as a stand-up, don't you need like a lot of material? Like, being at home all day, you're not going to get material.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And watching stand-up on TikTok and YouTube is not your own material. You need to like go out and be out to get stuff. Maybe I'm wrong there. That's your type five right there. Don't need material? I could be wrong. Yeah, because a lot of people I know who are at stand-ups, they don't always have a partner who can provide for them. So they are having to work and provide for themselves.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Getting into any sort of creative industry is fucking brutal.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I also, unfortunately, reading the story, I question how funny he thinks his partner is. You know, because it's like, if he's going to her shows and he's like, oh my god, she is so good at this.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And she's killing the room. He's not mentioning that. You know, because the story that I think about when I think of stories like this is the guy who made Stardew Valley. Because he spent like five years working on this. But his girlfriend kind of had to like provide for them because he was making this video game that was not out.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
But she probably at some point saw and was like, this looks cool as hell. I see the promise of what you're making here, so we're gonna, this is our endeavor together in a way. And now, I mean, I think that game's made a little bit of money. Just a little bit.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Right. What I will also say is with stand-up, you could also be an incredible stand-up and it's just such an awful industry.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Even if you're incredible, it's still gonna probably take you 10 years.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, man. Comments? Was there a discussion on how long you'd be willing to foot the bill before she started working again, or was this left unanswered? OP responded, she told me she thought she would see significant progress in a year. I didn't agree to help for a year specifically. I think what has set me off is that there is literally zero forward progress. I think it's also rough.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I mean, I learned this the hard way. I think we all do when we come out and pursue an issue like this. Being like, okay, I feel good about the next year or whatever. It's kind of like... If you enjoy this and you wanna do this forever, even if you're not gonna get paid, then that's great. If you're expecting something to happen,
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Either get rid of some of them or we're done. Like, depends on the clowns.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
The masks seem to really take it to the next level.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah. Especially not their home address. Yeah. Well, it's also the thing that we learned of like, there's no such thing as success either. You'll book something and be like, my big break. And then all of a sudden cut to three years later and you're like, oh, I can't get an audition. What the hell happened?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
But for most people, it's just, you can't expect success. like success to just come. You have to enjoy doing the thing. Like if you enjoy acting, enjoy like going to acting classes or doing local theater plays. Like that's, if you enjoy that and that's all you want to do, then yeah, you can keep pursuing it and doing it. It's almost like you can't, it's not pursuing.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
It's like, no, you're, if you enjoy being an actor, be an actor. Be an actor. and know that whatever is happening on a day-to-day basis might be what happens forever. And if you're okay with that, then great. You can't do it on the expectation of something big happening to you.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Other comments, I'm listening to Leslie Jones' memoir right now and she mentions frequently how she doesn't believe in starving artists. She says you have to work to support yourself if you are trying to make it as an artist and she worked many, many odd jobs until she made it, even during times when she lived with a partner.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
While I do think OP was a little harsh, his girlfriend is taking advantage of the fact that she lives with a partner to support her. If she was single, she would not have this luxury. She doesn't even have to go back to a regular nine to five, it sounds like. OP would be okay if she drove full time for Uber Eats, which at least would give her some flexibility.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Lastly, someone said, as a girl who took care of her boyfriend in the almost same scenario, but let it carry on for way, way too long, you are not the asshole. it is not your job to take care of both you and another human you did not birth, and it is not your job to cater to emotions because in the end, who's catering to yours here? Care about yourself.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You can love her, but she can love you too by being able to take care of herself while still exploring her passions.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
But yeah, I just think, to speak about their situation, this just needed way more of a game plan together. It just sounds like they're both on their own journeys.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
specifically with stand-up, being like, oh yeah, I think I'm gonna make it in the next year, that shows that she, I don't think she knows much about the industry. Very clearly.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
But it's always like my favorite thing with stand-ups is like, oh, this new stand-up that I just found. It's like, yeah, and here's this set from the 90s. You know that one? You're like, oh my God. Yeah, it's brutal. All right, our next story. What the heck? Am I the asshole for not explicitly stating my punch is non-alcoholic? Okay.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I, a 25 year old woman, recently attended a potluck style work party and brought punch, which has since caused a problem between myself and another coworker, a 42 year old woman, who we'll call Sandy. Last week, my boss hosted a party at his house to celebrate the end of the busy season and a job well done.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
All of my coworkers and their spouses were invited and we decided it would work well to do a potluck to offset the cost of feeding everyone. about 35 people since not everyone who came brought a spouse or significant other. I volunteered to make a punch that I've brought to previous work events that everyone said they enjoyed, as well as some fruit to go with it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
This was a casual party with alcohol present, but since I have some coworkers who don't drink, I didn't add any alcohol to this punch and figured that if people really wanted some, they'd just add it themselves. Fast forward a couple hours and Sandy is getting even louder and more dramatic than normal and is stumbling around the party.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I didn't think much of it and figured she brought her own drinks or was adding some of the host's alcohol that was put out into something else. She suddenly fell off the chair she was sitting on and made a big show of saying that it's because she was so drunk. She then asked me in front of the rest of our coworkers what it was that I put in the punch. I was confused and told her what was in it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Just a mix of ginger ale, 7-Up, orange juice, and a can of juice concentrate. And she wanted to know what alcohol I put in it. because she's been drinking it all night and is really feeling it. I told her that I didn't put any alcohol in it and asked if maybe someone else had spiked the punch bowl.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Nobody said they added anything and one of my coworkers who doesn't drink even said that they'd also been drinking the punch all evening and was still completely sober. I also would like to clarify that I understand how context can matter. Like if everyone else was really drunk, then that can make even a sober person feel like they're loaded, but that definitely was not the vibe.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Sandy was the only person acting drunk. She then got really quiet and went by herself to the bathroom. The rest of my coworkers and I exchanged some awkward glances and tried to laugh it off. She left shortly after and I received an angry text from her about how I shouldn't have embarrassed her like that and that now she looks like an idiot in front of our bosses and the rest of our coworkers.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She's been hostile to me at work ever since and is basically refusing to talk to me. I didn't think I did anything wrong, and most of my coworkers agree with me, but some say that I should have just let her go on thinking that the punch was alcoholic to savor the embarrassment. And I'm wondering now if I'm in the wrong. Am I the asshole?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She's like, like, Sandy. Do you think Sandy sobered up, like, immediately? She was like, what the hell is wrong with you? Oh, my God, I'm so drunk. There's no alcohol in the night. What are you talking about? How dare you? Dude.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Hello. Welcome to Smosh Reads Reddit Stories. I'm Shane. Today we've got some classic Am I the Asshole stories for you with a lot of them that'll make you go, huh? A little bit of WTF in there. I've got two people joining me who make me say WTF all the time. Amanda and Damien. And I'll keep making you say it until you learn your lesson.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I think it's a bummer when you're 42 because this happens. Nobody likes you when you're... This is common in, like, middle school and high school, right?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
If you do enough. But it's like when you're young or, like, when you're first, like, drinking, you know, it's like... I don't know, I can see you being fooled and because of peer pressure, wanting to fit in or whatever. You're 42. It's embarrassing is all I mean.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You drank a lot of fruit punch.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Well, that's what Sandy did.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's his interest. It's kind of one of those things that's a tough deal breaker where it's like you can't tell someone to change their whole interest or vibe. That's who they are and that's what they like. It's going to be hard to like... bring that together if you really can't stand it, if it terrifies you. And I relate to it terrifying you. I don't like things with faces, with human faces.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
But still, she's not the asshole here. You should put a note for non-alcoholic punch so that just people know who are trying to avoid alcohol. Right. For Sandy's sake. Sandy. That's not what I would have been. Oh, Sandy. You don't need to label things as non-alcoholic so that people who are drinking alcohol know. It's like, how dare you? Yeah, it's more specifically for people who are sober.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I still feel like, I don't, it's like great, you got to, hey Sandy, awesome, you got to feel drunk and you're not gonna be hungover tomorrow.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Placebo effect is real, her reaction after finding out that it wasn't alcoholic is what, makes her an asshole. She got stooped.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, especially when someone just tells me a fact. It's not like you didn't insult me, you just are telling me a fact about this situation. That's not punch, that's chocolate milk. But there are no brown cows in the Tri-County area. Where did you get this?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And now she did it sober, so she's responsible.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's true. Comments, of course you're not the asshole. Sandy was experiencing a placebo effect, not uncommon when people truly believe they're drinking alcohol. That's embarrassing, but it's not your fault. The truly a-hole thing to do would be to let people believe an alcoholic punch was alcohol-free. That could really harm someone.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
If she makes your life hard over this, you're going to have to take it to management for mediation. It's a ridiculous thing to hold against you in the office place. 20,000 upvotes. That is true. You can't bring that to work. Someone said, how would it be any less embarrassing if the punch actually was alcoholic?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Either way, it means Sandy doesn't have the sense to limit or moderate her drinking in front of her bosses and coworkers at a work party, not the asshole. Someone else said, oh, Sandy, Sandy, Sandy.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Someone said, my sister-in-law got so drunk once off of Sprite that she ended up in the bathroom eating the strawberries and cream conditioner before crying for 30 minutes about how bad her strawberry daiquiri was.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I don't know, placebo can be extremely powerful, but usually the context is also important for these things, and if she's saying nobody else was really that level of drunk, it's wild that she got to that level. But it also means, it means even though she wasn't drinking alcohol that night, it's like, you might need to tone it down a little bit.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I don't love decorations of any sort that have a human face to them. It just makes me uncomfortable. Especially if it's dark, I'm just like, I look over and I see a little face there just like,
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
If you were drinking that much that you believed you were that drunk.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Or Spencer. That's how Spencer gets when he's off camera.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Doing cartwheels. Anyways, wild.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's Bill Skarsgård. She got pulled over by a cop, and the cop was like, have you been drinking? And she's like, yes!
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yes, but no! I have! And I wanted to drink! And the meter's showing zero, and she's like, no, I promise I have! I'm drunk!
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Straight from the tea to the brown cow! No!
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Our final story. This is the one! No! Huh? Am I the asshole for not attending Bachelorette trip? Is there an article there?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Am I asked for not attending bachelorette trip? For not attending bachelorette trip. No article. My best friend is getting married this June and I am one of the bridesmaids. Her bridesmaid trip is set for the end of May in Chicago. We will be driving there and it's over four days. However, I don't want to attend the trip anymore.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
We have booked the Airbnb which was $176 per person and I paid my portion. Her demands from us for a wedding have gotten out of hand. Her wedding is over three days and we have three different bridesmaid dresses which have cost me $700 and it costs $200 to get them altered. Makeup for the weekend is $225 per person and I haven't even gotten my shoes or jewelry.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Not to mention she is requiring us to have certain hairstyles which would require hair extensions which would cost me at least $200. Financially, this is becoming too much for me. I know I agreed to be her bridesmaid and I am willing to fulfill my duties during the wedding. However, going to Chicago and spending all that money is something I am no longer willing or able to do.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I won't be asking back my portion of the Airbnb because that was my contribution I made willingly. I have yet to tell her that I won't be going to Chicago, but am I the asshole for not going? Up until now, I have attended and participated in every way as a bridesmaid and been there when she needs me, but the trip is too much.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
To expect all your friends to spend two grand for the bachelorette. So may in Chicago, I don't know. That weather's gonna be weird. So wait, was this one planned by the bride? Because isn't it a lot of times the maid of honor who plans the... But either way, it should be discussed of like, hey, we want to do this. This is the cost. Does this work for everyone? I don't know, like I, that's how.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
It sounds like, because she's talking about having to talk to the bride about this.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I'm very, I'm very conscientious of when I'm making other people spend money.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I can't imagine not considering it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Like just being aware of like, Oh, other people are spending money.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
To the extreme, and I'm just like... The verdict was not the asshole. Comments, not the asshole. If you can't afford it, you can't afford it. Tell her. If she really is your friend, she'll understand. Someone said, info, did you talk to her about it becoming a financial burden for you? And if so, did she try to accommodate some of the costs for you?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
OP responded saying, I have talked to her about the change in my financial situation, mostly because of a job change and also unexpected health costs for a health condition. Oh. Okay, math. Yeah, that's good. By my calculations. Calculator. Update.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Oh my God, yay.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Four months later, under a new post titled, am I the asshole for taking my friend to court after she kicked me out of the bridal party for cutting my hair? What? Things are really spicy enough now.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
We're eating today.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Get your chocolate milk out. Oh God. Get your chocolate milk out because this has gotten spicy.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
See what I, it cools you down.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
For my friend's three-day wedding, I had to buy three different dresses, including alterations and specific shoes which totaled over $700. She also wanted specific hairstyles for each day. Unfortunately, starting in March, my hair started to deteriorate. Due to health reasons, my hair was falling out in chunks and in May, I made the difficult decision to cut my hair.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I told the bride about my decision two weeks before the wedding and she didn't say anything bad. The following week, she came over to my house and when she was about to leave, she brought up that she was concerned about my haircut and I told her it would look good even though I wouldn't be uniform with the other bridesmaids. The following day, I received this message.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
After our recent conversations, I'd like to remind you of my boundaries. I've been very accommodating and graceful, but I can't allow you to disrespect me. As you know, my wedding has been something I've dreamt of for many years.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Husband and I have invested a lot of money into the video and photos of this day, and as we reflect on this day in the future, we want to see our vision reflected in the memories. Since I asked each of you to be a bridesmaid in 2019, I've been very clear and communicative in my request.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
the timing of your decision to cut your hair and not income in advance is very upsetting to me i would have felt respected if you had communicated with me more than a week prior to the wedding so we could have worked together to find a collaborative solution your inconsistencies have concerned me and while i sympathize with your health concerns i'm not willing to compromise my vision to accommodate you or anyone else when you have informed me in advance and we could have found a better solution
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Since this is something you can no longer fully commit to, I need you to please step down from participating in my wedding. This was three days before the wedding. I immediately sent her and her husband an invoice asking them to reimburse for the dresses and shoes, keeping in mind that one of the dresses is still in her possession, even though I paid for it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Neither of them replied, and so I decided to take it to court. I was told I was inconsistent and selfish after I spent the past two weeks helping her plan the wedding shower. I worked with another bridesmaid to surprise her with a bridal shower after our bachelorette trip had to be canceled. I spent hours helping her out with wedding details.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
When she asked me to help her tone up before the wedding, I sent her a personalized workout program and even went with her to the gym to show her the ropes. When I agreed to be her bridesmaid, I was more than willing to oblige with what she asked even if at times it was a lot of time and money. So am I the asshole for taking her to court because she kicked me out for cutting my hair?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, I don't know what health concern it could be, but I know that regardless, losing your hair, that's an extreme thing.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I don't understand the stipulation. The extensions already was weirding me out, because it's like, you want everyone to change their bodies for this. That's a lot.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
No, the I'd like to remind you of my boundaries was kind of all I needed. I probably, it's like you can just stop reading there. Like, your honor. You can't. He's like, I'm going to save everybody's time here.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
And it's very clear, based on that response, it's like, you shouldn't talk to this person or be friends with them. So there's nothing, there's no harm in going through court. I mean, I don't know much, all I know about court is just that it can be a lengthy, exhausting process. But, it's like, if it's worth it to you, until it gets to the point where it's not worth it to you,
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
is cutting these people out of your life gonna be more important than getting that money back?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I wonder how the other bridesmaids feel because like if I'm sitting there and I know that this person like is losing their hair and so they're like, yeah, I'm losing my hair in clumps. I got to just shave it all off. And then they get kicked out of it because of their health concerns. I'd be like... damn, are we really going to this wedding?
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's also fair.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's unfortunately so true. What a bitch. We have one comment on this. I'm very sorry about your health situation, OP. Not the asshole. This is not how a friend would treat another friend and supposedly valued one at that since she asked you as a bridesmaid. I'm also sorry you found out this way. This woman is not your friend. Opie responded, that's honestly what sucks the most.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I thought our friendship was much deeper than that. The fact that she was at the house the night before for three hours just hanging out, talking and helping her with the wedding stuff, just to receive this the next day, I know for sure I don't want her in my life, but that doesn't negate that she's someone I loved, cared for, and all the memories of our friendship. Devastating. Yeah, devastating.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Friend breakups are really hard. Yeah, but what is also really harsh is realizing that someone never respected you. That's brutal, because it's that thing where you then almost flashback and relive your life, and you're like, whoa, wow, all these situations, I thought we had mutual respect going, and we didn't.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
So apparently there were a lot of no one's the asshole verdicts in the comments. The verdict was not the asshole. But a lot of them were saying, hey, I don't think anyone's the asshole here. And I agree, the suck it up comment might be, depending on how exactly that was worded, I mean, if he just said suck it up, yeah, that's rude. But I think they're just truly at an impasse.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, but it makes me question how it's always been going.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Okay, this has been a long time coming. I've had a lot of people reach out to me asking what the results of the case have been. Unfortunately, I could no longer post comments on my previous post as well. I figured I would wait until everything was done to update everyone all at once. In December 2021, I got the notification that a court date had been set for February 7th, 2022.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
It would be virtual, and since it's small claims, we would represent ourselves. I began gathering my evidence and created a virtual file, which I shared with the court and her seven days before the hearing. On the day, she did show up. We were given the chance to settle, but that was unsuccessful.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
When we returned to the hearing, I found out she also had made a virtual file with her evidence but never shared it with me. The court then made her share it and what a surprise I had. She had copied my entire format for presenting evidence. Keep in mind that this is a format I created. She didn't even have the decency or brain cells to make something up herself.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
The hearing proceeded and we were both given a chance to share our side. I won't go into the details of it, but it took probably 10 to 15 minutes. In my state, they do not give you the verdict right away and it can take up to 90 days. And so I waited and waited and waited. Then yesterday, May 5th, almost 90 days after, I got a verdict. I won.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She has been ordered to pay me the total of $808.94 for the dresses and shoes. I have to return two dresses and shoes I have to her. The verdict goes into effect May 30th. I don't see her appealing it, or fingers crossed she doesn't. All in all, I am very happy with the outcome and so ready to close this chapter. Thank you to everyone who has been so invested in this with me.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I hope this was the season finale you were looking forward to. P.S. My hair and health are doing much better. My three bald spots are growing again and I couldn't be happier.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah. just truly threw away a friend. But she clearly has no respect for anyone. No. Oh my God.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Like, this is a tough thing where you guys gotta... decide if you can handle this. Because making someone either adhere to something that makes them uncomfortable, or giving up something that means something to them, that's tough, you know? That's really hard. There might be a compromise in there, like the clown room. A clown car.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
It might have played a part in why she won.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah. And she just copied her homework.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, judges love when you do that. Yeah.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, good for you.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Hey. Hey. Vanilla milk.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Vanilla milk. Vanilla milk. Thank you both for hanging out with me.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah, I appreciate it, man. Thanks for having us. Yeah, of course. This was great. Thank you for watching. Let us know what other themes and subreddits you'd like to see on this show. We'll see you next Saturday.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah. Yeah. Everyone knows that.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
That's how you make something worse. If you think something's haunted, if you think something's haunted, you don't put it deep in the basement. It's going to get more haunted.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I watched it when I was like five or six. I still like clowns. I got a fender bender with a clown car and all of them got out. I haven't seen a clown car in a while.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Comments, not the asshole. As someone who isn't into clowns but loves Venetian masks, I can understand being creeped out by some of them. However, her turning this on your entire interest for clowns that you've had your whole relationships makes her the asshole. Also, if she's giving you ultimatums over how you decorate your own space based on your own interests, she's not the one.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
There will be someone who will appreciate your collection if not add to it themselves. OP responded saying, that's the crazy thing. She has bought me little clowns before. She has found a print of two clowns kissing at an art fest she went to and she picked it up for me.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Okay. Interesting.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Yeah. Does she hate Venice? It is sinking, that is sad. That is, it's very sad. Someone said, good thing you found this out about her now. It isn't going to last. You're not the asshole right now because it is your place. But if the relationship progresses, you're likely to have a place together and then she won't allow it and you'll be right back at this point but with more feelings.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Better to cut bait now and both get on with your lives. Find someone tolerant who doesn't care what your hobby is and you can put up with her creepy 18th century gothic porcelain doll collection too. Lastly, someone said, well, not the asshole, but no assholes here. She has the right to have an opinion and voice it out. You have the right to keep your stuff.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
If both can't fit together, you part ways. I think what you explained is reasonable, and she is entitled to her preferences. Yeah, I mean, I disagree with small things of how they both went about things, but overall, the end dilemma is the same, and they're not assholes for how they feel about something.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I think maybe it's as things are getting more serious that she's starting to be like, oh, shoot.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Update. I knew it. I wanted to clear up some things I saw in the comments. I had a small collection started by my grandparents when I was a baby. That's where I got my first swing jester. The collection has grown in the last two years to expand to common decor and not just dolls. For the update, she saw the post, she read the comments, and called me today.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
She wasn't too happy about being called the asshole, but she apologized for being controlling. Turns out she wanted to see if I'd get rid of my collection if it meant keeping her, like it was some relationship test. No, she did really hate the Venetian masks and didn't like that they are hanging above my bed.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
No, I do. I do. I would actually say out of everyone here, I feel like you both, like, can handle weirdness pretty well.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
I told her that if it came down between her needing me to get rid of them slash sell them for expenses, then I would of course do that. But I'm not just going to get rid of my collection because someone says so. She asked if we could move on from this and I told her no. I don't like that she tried to test my love by asking me to get rid of my collection. She left, we're officially broken up now.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
On the bright side, I can fill my house with more clown dolls. I even found a Music Box one online that I might get. Thank you, everyone, for helping me figure out that I wasn't in the wrong. And to those saying I'm a serial killer for owning clowns, I've read quite a few comments from people collecting dead things, so I think I'm in the clear on that. Yeah, there's some wild collections.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
What if he was like, well, sometimes they're over my bed. And then sometimes I find them in other parts of my house. Yeah.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
You can handle it.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Today's Reddit Stories is brought to you by ZocDoc. When was the last time you needed to go to the doctor, but you pushed it off? I'm too busy, it'll heal on its own, or I don't know which doctor to go to. Look, it's easy to make excuses. Booking a doctor's appointment can feel so daunting. But thanks to ZocDoc, they make it easy to find and book a doctor who's right for you.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
ZocDoc is a free app and website where you can search and compare high-quality, in-network doctors and click to instantly book an appointment. We're talking about booking in-network appointments with more than 100,000 doctors across every specialty, from mental health to dental health, primary care to urgent care, and more.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Plus, appointments made through ZocDoc also happen fast, typically within just 24 to 72 hours of booking. You can even score same-day appointments. When I used ZocDoc, I was amazed at how simple it was, how streamlined it was. I hadn't gone to the doctor in a while, but using ZocDoc, I made an appointment within a couple weeks.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Stop putting off those doctor's appointments and go to zocdoc.com slash pitreddit to find and instantly book a top-rated doctor today. That's z-o-c-d-o-c dot com slash pitreddit. zocdoc.com slash pitreddit. Back to the show. Our next story, am I the asshole for getting my sister and girlfriend the same birthday present? Cake.
Smosh Reads Reddit Stories
Stories That Make You Go "HUH?!" | Reading Reddit Stories
Okay, here we go. My girlfriend and sister have birthdays in the same month, so I went shopping for their birthday presents at the same time. They both like perfumes and both have similar preferences in perfumes. Sweet, edible, gourmand, and I found a perfume that captured the vibe and did it really well. I knew they'd both like it, so I bought two bottles and gifted one to each.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Hello, and welcome to Smosh Reads Reddit Stories. I'm Shane, and today's theme, updates. Yeah, it's a good one. And before we get into these stories, I have an update for you. Later today, we have our 100th episode, our live show, and you can get tickets at live.smosh.com. It's gonna be at 4 p.m. Pacific Standard Time. Get your tickets, check it out.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I took it as a challenge and slowly learned to enjoy it, but now I feel like the minimum isn't enough because I'm handling so many projects and my tasks have leveled up a lot. Today, I finally got the guts to message my boss to ask if a raise was possible. I was polite, just asking if it could be considered and explaining why I felt I deserved it.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
She just ha ha reacted and even sent a heart eyes emoji. I don't know if it was sarcastic, but I was just asking a simple yes or no question. I didn't even mention a specific amount. Now I feel like I'm being treated like shit. As much as I want to leave immediately, I still need the money, but this really motivated me to start looking for another job as soon as possible.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Okay, according to one user, 13,000 in the Philippine peso is close to 224 American dollars.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
So she texts her boss going, hey, can I get a raise? Would a raise be possible? And the boss texts back, ha ha, heart eyes emoji.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
You have the answers. Let's read these comments first. Your boss is deflecting the conversation at hand. 13K, as you're already aware, is too low, especially as a starting salary. Immediately drop your job as your priority in life and prioritize getting a job that knows your worth. Someone else said save up while planning your exit strategy. Don't make it obvious.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
All right. Let's get into our first story, shall we? Yes. This one comes from Relationship Advice and also best of editor updates. Ex-boyfriend and I were van-lifing across country. He kicked me and all my stuff out last week. I am now two states away and have his dad's watch. He's demanding I deliver it to him. Oh my god. Okay. There's a lot to unpack there.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Lastly, this is translated from Filipino, those who work at McDonald's are paid even more. Okay, so I wanted to get a baseline of like, what is this? And so it sounds like this person's really getting screwed. They're making payroll systems. They are learning whole lines of code. They are having to teach themselves new skills. They're not being compensated for that.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
They're being absolutely used here and disrespected by their boss. And at the very least, it might have been an accidental text, but the boss should have followed up by being like, sorry, that was an accident. Let me consider your proposal.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
It's very real. It's very rough. Okay, update from two days later. Thank you for the advice and for giving me a reality check. Here's an update on my story. I waited two days for a proper response, but I guess that was her response. Regardless, I had already planned to resign and was just looking for another job to transition into.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Just a day after posting this, I was able to quickly land an international client from OLJ. OLJ is an open resume and job posting board, who is paying me four times my monthly salary. So it was monthly. It was a monthly salary. Still. The task seems easier than my usual work, at least in theory, but I still have some concerns since the tools are new to me and different from what I am used to.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
However, I believe we grow the most from challenges that scare us, and stepping out of our comfort zone is where real learning happens. So thanks for motivating me to apply, ha ha. I immediately submitted my resignation. My boss later replied, apologizing for the late response and saying she was actually considering my request.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
She could have mentioned that when I first asked instead of just reacting with a ha ha and an emoji though, lol. She then asked if I could at least work reduced hours as many of their clients had started with me. That made me smile because suddenly she saw my worth. Yet, when I initially asked for a raise, it seemed like I was not even worth a simple reply.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Not even a two or three letter response like yes or no. Unfortunately, I did not do what some of you suggested. Ha ha reacting to her message or replying with just an emoji instead. I told her that I had already made up my mind and kept it polite because I did not want to burn any bridges, as I still appreciate the experience I gained from the company.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Thank you all for helping me realize my worth. I have learned my lesson and will never go through that again. Very nice. That's very heartfelt.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah, I like what Spencer said of like, you know, when you go all Reddit on them. Yeah. And it's true, it's like you see some comments like living out the fantasy. And it's like I respect what she's doing where she's like I'm leaving, I'm screwed. They're screwed over on like a real level. I can just walk away and not have any sort of like.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
So yeah, like the title says, we were both remote workers and decided that we could van life and see things while still working. We lasted about a month and last week he flipped out over the way I sipped my coffee and told me I had to leave. I thought he meant like we would pack up and figure out how to get me home.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I agree. Not that the person doesn't deserve it. No. It's just a matter of being strategic.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
They're still a student Because they're always learning. Oh, yeah, dude. Hi, I did and everyone clapped The sex story comes from relationship advice and also best of editor updates, okay?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
This is a 24-year-old woman. My boyfriend, who's 30, keeps disappearing into the bathroom for an hour or more with a stick of butter, and the butter is gone when he finally comes out.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I don't, I haven't seen this in probably over a decade, but like there used to be like magazines in bathrooms. Sure does, yeah. And it's like, I'm like, people really sat and like read magazines. Well, you didn't have a phone. Right, before phones. Right. You're just like chilling in there. Yeah. Reader's Digest. Is that where it's from? That's why it's called that. Stop. No way. No.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
No, he meant I needed to get out with all my shit in the middle of a state park in New Mexico and figure it out. I was scared and pissed so I hurriedly packed everything and got out. A very nice older couple had heard the screaming and saw me with a pile of my stuff and asked if I needed help.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
There's no way. It's Reader's Digest because it's from the bathroom? I believe so. That's such bull. Emily, if that's not true, then you need to go on TikTok and lie and spread that lie everywhere.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Emily, I love how often that happens to all of us.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah, to everyone watching and listening, let's spread a huge lie.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
And it's like when they're in the elevator in Severance. I watched her entire perspective on life shift. That's an easy one to hold for a long time because when do we think about Reader's Digest? Never. Never. All right, let's get into this story. Yeah, let's see if this can stop, if this can top our reader's digest. Before we get into this, what's happening with the butter?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I don't remember what happened. Oh, okay. I was like, the store, the boyfriend is going into the bathroom with a stick of butter. He's in there for an hour or two and comes out with no butter.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah. Somehow that's the most innocent option here.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I said yes and they said they would drive me to Albuquerque in their RV and we could figure out what would happen next. Uh... Well, it turns out in the hurry of packing, I grabbed my ex's watch. That was his dad's. I got in touch with him and told him I was sorry. It was truly an accident and I had no intention of keeping it. How would he like me to get it to him?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I have been dating my boyfriend for two years and we finally moved in together. Ever since we moved in, I have seen a new side of him. It's a very odd issue and I can't wrap my head around what to do. At first I started to notice butter was disappearing quickly. I assume maybe I lost track of how much we had or maybe he was cooking when I wasn't around, I don't know.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
But one night a few weeks ago, I saw him try to stealthily take a stick of butter from the fridge, which I pretended not to notice, and he took the butter with him into the bathroom. Now, I have noticed my boyfriend spending an hour or more of time in the bathroom since we moved in, but I never saw him take the butter before. I was so confused.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
When he came out of the bathroom about an hour later, I saw no sign of the butter, but I also saw he did not put the butter back in the fridge. It was gone. I tried to subtly keep an eye on him, and over a week, he did this three separate times, and each time a stick of butter disappeared. Finally, I said one day, where did all of our butter go? I hardly used any this week, and it's gone.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He pretended to not know and said maybe we had forgotten to buy it. I said, no, we had four sticks before. Now they are gone. He just acted like it was a mystery and said, guess we should order up some groceries.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I'm so mad that I know that. And do you know that Reader's Digest? Yeah. By now, I was getting very confused, so I ordered groceries and made a point of saying, good to finally have four sticks of butter. This should last us quite a while. And he's just like, yeah. He made no comment. On the first two days, whenever I used a small amount of butter, I would remark about how much butter we had left.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Finally, one day, I saw him do it again. He took a stick of butter into the bathroom, was gone for an hour or so, and came back with no butter. I couldn't believe it. So when I made dinner, I acted shocked that one stick of butter was gone. He said maybe we only had three. But he knew I'd been making a point of it. Wow.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He then started apologizing for being misleading, but said, let's just not talk about it. And when he saw I was getting mad, he said, what if I just order my own separate private butter?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He's saying he doesn't want to talk about it, but he goes, so she's like, I was like, okay, but what are you doing with the butter? He asked me to promise him to never ask about his butter activities again and to just put it behind us. He said, just look the other way on this one thing and stressed how it is not a big deal at the end of the day. I was like, okay, I guess.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
but I have been so confused and even disturbed about it. Like, what is he doing with the butter? Why was he lying about it? Why won't he tell me? I don't even think he's eating it because he's not an overweight guy, and I feel like if somebody ate that much butter, they'd become hefty, but he shows no signs of it. I'm just like, who is this guy? Am I overreacting? It is just so odd.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I see him in a different light, and I am not sure what to do. Should I just ignore it?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I think, unfortunately, this is similar. We had a story about a jar of peanut butter that, you know. Okay.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Link to the episode, but later. No, so there was a story where a roommate was using a peanut butter jar for reasons and then putting it back in the pantry. That's insane. So my inclination is to believe this is. But also like. How was it? We don't know. But my inclination is that this guy is using the butter for sexual purposes.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He said I needed to meet him in Utah. I said that was ridiculous. I could send it to him. He said that it was too valuable to trust to mail or FedEx and needed to be hand delivered. I said I was in Kansas and not coming to Utah, but I would return the watch to his brother when I go home in March. He said no. The only solution was for me to drive it to him. I said I didn't even have a car.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I'm also amazed. Not good for his pipes. He's not eating it, right? No, we don't know that. He moaned. You can moan while eating, I do it. She's saying she doesn't believe he's eating it, but the butter is gone. Yes. Now, she is saying that she's heard moaning. And the sink running. And the sink running.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Now, if he's not eating it, how he's making the butter completely disappear is, I mean, this is the procedure. The true magic trick.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Is your friend from Neverending Story? We re-clocked the same thing.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Okay, there was one comment. Someone said, okay, what the fuck? And someone replied to that saying butter is the fuck. Butter might be the fuck. Before we get into this update, there's one producer note here left by Emily, and she says, I learned a lot today about butter stuff with a unhappy face.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
So the comments had a lot of theories.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I think we're about to find out anyways.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
This is posted a day later and it's posted to today I fucked up. Today I fucked up by confronting my boyfriend who kept secretly bringing sticks of butter into the bathroom for an hour or more and coming out without the butter. This morning I said look, yes you should buy private personal butter for your activities but I said I need to know what you do with the butter.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He got very quiet and then he said, fine, I'll tell you just this once. And he told me, he told me everything. I was so mortified and confused. I cannot tell you what it is, but I will say it is a sensual activity, extremely sensual. It is definitely an inappropriate use of butter. I cannot even type what it is due to how graphic it is.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
On one hand, it's just butter, but on the other, I can no longer see him the same way. I am staying with my parents. To make matters worse, a friend of his found my other post and sent it to him saying, LOL, this must be about you. I guess he used to do it in college too and he is furious and now other people I know in real life know what he does with butter.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He said you're probably fucking half of Lawrence, use one of theirs. At that point, I blocked him. The watch is pretty valuable and has a lot of sentimental value and I will return it. It was my oversight that I have it in the first place. What are my obligations to follow his instructions to get the watch back to him? I feel like she's asking more on a legal sense. We're both lawyers.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He is angry at me for exposing his butter-based proclivities. Now I have probably ruined my relationship and everyone knows my business, causing me shame and humiliation. I can't believe what he does with butter, though, and I don't think I can be with somebody who does things like that. You can't say I can't believe. She said it like nine times. Yeah.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I consider it a momentous fuck up for me to have ever confronted him about it. This is my mistake because I can never unknow what I know. So that means that she, if she didn't, she'd be fine not knowing this and continuing that just knowing it, she can't.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Unfortunately, my brain is just thinking of every single possibility.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
And if you're busy today, you can still get your ticket and then watch it anytime until March 23rd. It's going to be a doozy. I for one can't wait. It's going to be a doozy. It's going to be a doozy. We won't be able to go back there again. That's for true. Yeah. Ian, Damien.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
What? I mean, she's specifically saying that he's doing something with the butter, right? That what he's doing to butter, she can't move past.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I do feel bad for the guy that this somehow someone knew, and now this is everywhere. But that's also not her fault.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I guess on that note, her first post when she's truly innocently like, I don't know what's going on here. This is so confusing. And she doesn't think it's gonna be anything. But the second post, she does go, and she's posting that, oh, people have already found out who he is. But then also still posting publicly saying what he's doing with it is so wild. I can't think of him the same way.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
She's like, you're not supposed to eat it, you're supposed to shove it up your butt. You'll get the calories if you eat it. This story, because it's about the butter, it's funny. I think there's a very real version of this story
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
of when it comes to what people are into, any activities they do, and it's tough, because in a relationship, people might discover something about their partner, their partner might even share it willingly, and be like, hey, I can't, this is hard for me to handle. I'm not into this.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
And that's okay for it to be a deal breaker, but it's also like, the guy needs to find someone who's okay with what he does with butter.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
All right, our final story, and I'm a little confused by it. I'm not sure what this means. Sound it out. It comes from Relationship Advice. I, a 36-year-old woman, found out that my husband, who's 38, has a Camilla, a 42-year-old woman. Camilla. What is the Camilla situation? If I can recall.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah, I don't know what he's thinking there.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Because I watched The Crown. Okay, good, good. So Prince Charles, yes, Prince Charles in the 90s I was like, well, you tried. Prince Charles in the 90s was in love with Camilla. He wanted to be married to her, but he was told he couldn't because the royal family was like, no, you can't. You gotta marry Princess Diana.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
And he's like, all right, I will, but he treated her like shit because he just wanted to be with Camilla. So then as soon as Princess Diana's dead, he's immediately with Camilla. But I also know this fact that Camilla wanted to wear, she had to wear gray to her wedding because the queen wore white or she wanted to wear whatever she wanted to wear.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I think the queen wore, and you're not allowed to dress how the queen dresses at the wedding. So the queen like fully shaded her so nobody gets to wear a little hat.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
All right. Here, let's get into this.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I've been married to my husband for two years now. It's a first marriage for both of us. His family has been very good to me. They immediately accepted me, welcomed me in, started including me in family events, really made it not even a second thought to say yes when he proposed after a year of us being together.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I noticed on social media that there are always likes from a teenage boy on posts that he puts up about me. I thought it was a bit weird that he's friends with a teenager, so I looked through the photos I could see on his profile. There are a few with my husband from about eight to 10 years ago, as well as another woman. When I asked my husband, he said that the boy is his ex-girlfriend's son.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He explained that they were very serious, but that she had ended up getting married to someone else. This seemed odd to me, so I asked my mother-in-law about her the next time I saw her. My mother-in-law rolled her eyes and said, don't even mention Val. I am so glad that you came along because that girl was so bad for him. She was unemployed, a single mother, and just very trashy.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
We never would have accepted her. Oh. Quote, Is there any good way to approach this?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I almost think this is one of those situations where it's like a gift. It's like he told you flat out how he feels about you. I think that's one of those situations where I'm like, you should go. No, you think so? He inferred that, like, yes, I would rather be with this person, but I'm with you. Yeah.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
The Camilla's married to someone else.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
You're saying maybe he doesn't understand the severity of what he said.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Of course, yeah. Some comments, someone said, considering Charles cheated on Diana with Camilla, that was quite possibly the worst analogy he could have made. Someone else said, tell him that his analogy made things a thousand times worse as Diana was obviously nothing to Charles but someone his family would accept but who he personally didn't care about.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
As a result of said atrocious analogy, you have lost a lot of faith in the strength of your relationship and if he wants this marriage to work out, he will at least remove them from his socials for now and attend marriage counseling with you. Someone else said, I couldn't be married to someone who told me that. He basically told you that he wanted to be with her but you're acceptable to his family.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I guess what we're saying, though, is this at least calls for a lot more conversation. Absolutely. To be like, hey, we need to talk about what you said.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I'm also assuming if these people live in the UK, I'm assuming that's a much more well-known story. Tons of people here in America just don't really know it. I mean, he's 38. He's 38, so it's actually... It is a known thing.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Wow, okay. Pretty good. Sorry, I'm a little slow. Was it really the coffee sipping? Oh, it sounds like they got on each other's nerves immediately. Yeah. They lasted a month vanlifing. Oh, that's right. But vanlifing, it's like, you know, living together with someone is a huge test. Living in a van? Yes. Down by the river? together? No, insane. That's a lot for some people.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Well, let's get to this update. Oh, there's an update. No, I'm kidding. Okay, so this update came 20 days later. Divorce could happen in 20 days. So 20 days later, do you think they're going to make it is one question. Gosh. Do you think he's cheating on her is another one.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Okay, let's see. Thank you to everyone who responded to my previous post. A lot has gone down since I posted, and not much of it has been good, to be honest. I'm starting to wish that I'd left well enough alone, but I guess I'm stuck now.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
So I sat down with my husband and told him that this whole Val thing was really bothering me, that I'd never heard her name before for someone he held in such high regard. He explained that she had cheated on him and had married the guy she cheated with. They stopped speaking for a while but they started being cordial again as she was having problems in her marriage and through her divorce.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He swears on his life that there's only friendship there, that he can't ever forgive her and that he has no interest in her romantically anymore. We share location history on our phones and have cameras on our house so I know he's not lying about seeing her. My My husband was my first in a lot of ways, everything except my first kiss, so I tend to be a bit more jealous than others.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
My husband has more of a past and it makes me very uncomfortable even though I know it's a reality that I have to accept. I'm also diagnosed as on the autism spectrum, so I tend to be socially awkward and miss certain cues, which caused me not to really have close relationships up until him. Are you serious right now? He's talking to Val again? I'm going to asterisk him. Okay. Whoa!
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
My mother admitted that they had arranged my marriage. We'd been seeing each other for a month and I met his parents.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Sorry. It's almost like he was trying to tell her everything. You can't just guide cues past her like that. She'll dodge him every time, I know that. We'd been seeing each other for a month and I met his parents.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Shortly after, his mother called mine, explained about Val, how they were afraid he would go back to her, and how they wanted to do everything they could to make sure that their son married the right girl. I asked my mother why she agreed and she admitted that they were afraid I was gay and that I wouldn't ever have children. She said that's why my husband was immediately invited to every holiday.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
That's why he was introduced to multiple relatives in a very short time. That's why they referred to him as family before he proposed. They were trying to set the tone in my mind. My head was spinning. I told them I had to go and I couldn't talk to them anymore. I drove home and felt like I couldn't breathe. I walked into our house and told my husband everything. He laughed, he actually laughed.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He told me that he'd figured it out a while ago and thought I had too. He told me that his parents paid for me to go on vacation with them. They made a point of getting everyone in the family to share how much they liked me. They gave him extra gift certificates to take me out to dinner and other events.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
His mother cleaned his apartment and did all of his laundry while he was at work so his nights and weekends were free for me. When he said he was going to save the money for a ring, they gave it to him, and they kept telling him what a good match I was for him. He asked his parents while we were engaged if it had been the plan to keep him away from Val, and his mother admitted that it had been.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He told me that he fell in love with me while we were together. What he feels for me is real, and that he loves the life we have together. He said it doesn't matter how it started because what we have is strong and real. I don't know how to feel. I can't even talk to anyone because I'm apparently the only person who didn't know this happened. I feel like such an idiot.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I am furious with his parents for doing this, furious with mine for going along with it, and hurt that he didn't tell me the truth once he figured it out. I don't know if I want a divorce, My husband has been trying very hard to be supportive of me. I've told him I don't feel like talking.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He keeps asking me if he can get me anything and asking me little questions to try to get me to talk, but I can't even get my feelings straight right now. I feel betrayed by every person who is supposed to care about me, and I have no idea what the hell to do now.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Oh, yeah, that's not a good movie. And I get it confused with... This fits the definition of gaslighting, correct? Like massive, group effort gaslighting. Absolutely. Because they altered her reality. It feels illegal.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
This guy is a massive jerk. I mean, for one, dumping her off just randomly in just some place and just leaving her there without a car or anything.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah, because the idea, I mean, I can't speak on it. But in this situation, what really happened was that she was mass manipulated by everyone around her. They're like, okay, we're going to do all these things to make this happen so that you think that this is all convenient, that this is all working out, that, oh, this is perfect. But it's that the whole family is secretly making it feel perfect.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Their reasoning is insane, too, of like, we thought you were gay, so we thought this would be, it's like, what did you think was gonna happen?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah, you have to have them to carry on our family name. Some comments on the update. Wow, just wow, this is some Truman Show level betrayal. I'm sorry, friend. If I could, I would give you the biggest hug. Someone else said, my dear, this sort of happened to me in a roundabout way in my early 20s. When I realized what happened, I left and started my own life.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I had great adventures and fell in love with a wonderful man. We just celebrated our 30th anniversary. You do what makes your heart happy, not those who arranged a manufactured relationship you weren't even part of. Sending you bravery and compassion. Trust your heart, not them. That's very sweet.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
There was another comment by OP saying they are looking into therapy, which I think in that situation.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
They all probably go to therapy already. It's called the mirror.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
All right, that has been Smosh Reads Red Stories. Thank you both for being here.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I appreciate you. And thank you for watching and listening. And once again, we have our live show today, 4 p.m. Pacific Standard Time. Get your tickets at live.smosh.com. And hey, if you can't watch it today, you can still get your tickets and watch it anytime until March 23rd. The VOD will be available, and it's going to be a wild time. There's going to be updates. There's gonna be updates.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Get your butter out, guys. And then get your butter in. Sorry. We will see you guys hopefully later today. And we will also see you next Saturday. Goodbye. Bye.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
And I understand that's hard, but you're responsible for their safety. She's extremely lucky. And so is he. Lucky that someone was able to pick her up.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Lucky that someone was able to pick her up, and lucky that the people who picked her up weren't serial killers. Or anything else.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
So we'll get into some comments. A lot of users pointed out that This reminded them that they were making comparisons to what happened to Gabby Petito, which shows the severity of this type of situation. Other people said, you gave reasonable options. Let's say he files a police report that you stole it. You have proof that you contacted him and asked where you could send it.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Totally. Someone said, I'd say she needs to stop catering to him. She has his brother's address. Send the watch to him, provide him with the tracking number and be done with it. I've sent the watch to your brother's address. Here's the tracking number. It should be there in X amount of days. Do not contact me further is all she needs to do.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
For a guy who stranded her over sipping a coffee, she doesn't need to bend over backwards for this small of a mistake.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah. Someone said, the guy abandoned you. You offering to mail it to him is honestly an impressive move on your part. He's continuing to insult you after you made that very reasonable offer. Do not meet him in person. If you do, you're potentially putting your safety at risk. I agree with that. Lastly, someone said, leave the watch in the middle of some state park like he did to you. Yes.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yes, petty revenge. There's the argument of being like, I don't have the watch. Just an iced out lizard. Sasquatch, a photo of Sasquatch.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
It's the bread and butter, and from what I've heard, butter might come up later.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Okay. What do we think is gonna happen next? Do you think she's gonna mail the watch? Do you think she's gonna keep the watch? Or do you think she's gonna go try to meet him?
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
It could be a secret fourth option.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
There's gonna be a reveal. Some character development on his part.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Okay, here we go. Well, so lots of, this update came a week later. Well, so lots of mixed advice, but most people said the best option was to contact his brother. Before I did that, I decided to unblock my ex just to give him one more chance to give me an address where I could ship the watch. Actual text conversation. Me, hey, I'm sorry I blocked you.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I just didn't appreciate the insults, but I want to get your dad's watch back. Can you let me know where to send it? I'll pay for shipping, no problem. Like, less than 30 seconds later, he responds, I stashed the watch in your bag because I wanted to prove to myself what an awful person you are, and good job at proving me right again.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I actually believe he did put the watch in there. Seriously? I think it's a manipulation tactic. Now, it doesn't really matter, I mean, at this stage, because I don't think she should ever be in contact with him again. She needs to stay away from him. But I think it's very likely that he's telling the truth as a means of kind of keeping her close. It also doesn't make sense.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
It doesn't make sense. He's like, you proved me right, you're a bad person. It's like, I'm trying to give it back to you, dude.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah, after he sends that, she writes, I was like, wow, so many people in the original said that he probably put the watch in my stuff as I was packing in order to force communication and force the opportunity to see him again. Well, you were exactly correct. I didn't even respond to his text and blocked him again.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I have no intention of keeping the watch, so I decided now it was time to contact his brother, who along with his wife has always been very nice to me. He was super appreciative, and we spent a couple days going back and forth figuring out the shipping, but the watch arrived to him on Friday, and all is good. He even Venmoed me $1,000 for being so honest, contacting him, et cetera.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Ian, you've started this the most Ian way possible. Hey, butter, that sounds cool. I've heard that one of the stories later involves butter.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
I make really good money, so I told him it wasn't necessary at all, but he insisted, so we agreed to donate it to a food pantry here in Lawrence. but I'm still so creeped out thinking about the day when he kicked me out of the van and he was screaming at me, calling me all sorts of names and scheming to stay in touch with me.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
He was slamming all my stuff into bags but that was cover for him hiding the watch. The fact that it was so deliberate yet he thought of it so quickly is so scary to me. We got along so well before we left and he always seemed like such a great guy. I don't know if the confined space of the van is too much for any couple or if it brought out a side of him I didn't know was there.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Makes me sad and scared at the same time, but relieved it's over.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
It's tough, man. I mean, with so many relationships, people, you have those blinders until you don't.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
You know, you have those blinders until kind of like the bad thing happens, and then you're like now aware of that thing. Like, it's almost the difference. It's frankly, it makes me think of like what we talk about with so many age gap relationships. When like an older guy is dating a younger woman.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
And it's like, they're probably not going for a woman in her 30s because she has dealt with a guy like you. She can clock. And now she's gonna clock it. Yeah. So you can't get away with that. But I think it's different for every person.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Like, that's so made up by him. Well, I'm glad she's out of it. Yep. Oh, yeah. Happy ending. She got $1,000 out of it. And she got a – who gives somebody $1,000 for just like a simple task? So we believe from the comments that it might have been a Rolex. Okay.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Okay, our next story comes from PH Careers, a subreddit dedicated to careers in the Philippines.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
Yeah, and it ended up on Best Redditor Updates. My boss just ha ha reacted to my message asking for a raise. Ooh, you gotta kill him. Or her. I don't know your boss. I posted here a while ago asking if having 13K as a salary as a software developer was enough. I'm a graduating student and this company hired me after my internship.
Smosh Reads Reddit Stories
Updates ONLY | Reading Reddit Stories
When I accepted the role, I expected to do the same tasks I did during my internship, so I thought the pay was fair. but then they gave me more complex tasks like creating a payroll system, which meant studying thousands of lines of code, hundreds of tables, and the whole process from scratch. Mind you, it's just me and my senior in the team.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Hello, welcome to Reddit Stories. I'm Shane, and today's theme is family. Notorious for being extremely chill. Zero issues. Family. Joining me are two people who I consider family. Angela and Chance.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It absolutely is. But it's amazing, and it's rare in these Reddit stories for the spouse to stick up for them. Oh, really? We're not used to that, I feel.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
They do, there are plenty of times they do, but it feels like I would say 70% of the time, when it's family related, the child will be like, oh my, it's just like, my parents do this, don't worry about it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
She didn't even think that it was true. She was kind of like defending the family. She was like, oh, yeah, it's okay. And he was the one who's putting his foot down going, no, it's not. So really props to him. Comments. Not the asshole, it's pretty clear the issue isn't her food, it's her. For whatever reason, they don't seem to like her. Good for you for standing up to them.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
OP responded, having that confirmed sucked badly, but I wasn't going to pretend it was okay to treat her this way either. They wouldn't come right out and say it either. They tried to hide behind the food. Someone else said, not the asshole. Your kids won't be missing much other than the company of toxic relatives who treat their mother poorly, yet she is too kind to hold a grudge.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Why do some of your family treat her like that? Do they treat all in-laws as poorly? Opie said, no, just my wife. The others are treated fine. Someone said, start a new tradition with your younger brother and sister. Invite them only to your house. Forget the rest of them. He said, that's the plan.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Is this at all something you guys relate to? Like, as far as having dated someone that your family wasn't fond of or, like, vice versa?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Let's find out where this goes. As the title says, I purchase all of my sister's OnlyFans content. A paltry $200 to $500 every two-ish weeks. What? For obvious reasons, this is a throwaway. Now let me explain. Okay. Here comes my sister's OnlyFans she started before the first child and was very vocal about it. I ignored it for the most part because I didn't care.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It increases the whiteness by... It definitely increases the whiteness.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Did he not even clock it? Was it one of those situations where he was like, oh, I didn't think about that?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. Wow. Okay. Our next story comes from Am I the Asshole? Am I the asshole for refusing to demote my dog after my sister gave her baby the same name? We have read many stories like this. Demote. What is demote? Demote my dog.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'm assuming, as previous stories on Reddit have been like, when a family member has a kid and they have the same name as a pet that's already in the family, they're like, you need to change the name of your pet so that they're not the same name.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
The pet was there first. So there's a famous story where a guy had a cat named Nigel, and then someone had a... Well, that's your first mistake. Don't you name your baby Nigel. No, it was a fiancé that came into the family, and they started calling the fiancé Human Nigel. Because the cat was named Nigel. So there's Nigel and human Nigel. That's awesome. That's awesome.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, there's been several stories. There was one where I think someone had a pug named, like, named, like, Doug or something, and then someone had a fiancé named Doug, so they started calling him Doug, too. That's awesome. It's incredible. That's fun, though.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Just take a fucking nickname. Oh, dude, I'd be all in on that.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
If I met someone and they're like, my cat's name is Shane, I'd be like, no way!
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'd be stoked. All right. I, 26-year-old woman, have a dog named Charlie. Charlie is a golden retriever I adopted four years ago and he's my best buddy. My sister, Emily, who's 29, recently had her first child, a baby boy. She and her husband named him Charlie. You... At first, I thought it was funny and didn't really think much of it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
But then Emily pulled me aside during a family gathering and said it was confusing and disrespectful for me to keep calling my dog Charlie now that her son has the same name. She asked me to rename my dog. I told her no. Bye. Bye. Bye. I have no idea how I'm in the wrong here. The world's gone crazy. I love my dog and I didn't name him to spite anyone.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
When she found out she was pregnant the first time, I worried about both their financial situation and frankly, my sister's more than a few crayons short of a Crayola pack.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I also think it's not my fault they chose a name already in use in the family. Am I the asshole? No. Yeah, no.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
They willingly named their son Charlie knowing that the dog is named Charlie. For years. That's just the case. And, like, especially with a kid, it's like you're making that choice. You know, even with fiancé situations, I'm just like, I'm sorry, that's the pet's name.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Uh-huh, Charles the dog.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, no, that's absolutely insane. Comments here, there was a post years ago about a guy who had a cat named Nigel and his sister or roommate started dating someone named Nigel, so they called the cat Nigel and the guy human Nigel. Charlie the dog is already Charlie. It shouldn't be a big deal. Baby Charlie doesn't care, only the parents do.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I initially offered to help financially, but she has decided that she doesn't want help and can do it on her own. So I decided to enlist the help of a friend, so I don't have to view the content, to use my money to subscribe anonymously and purchase all of the content she produces, thereby providing support and a little extra help without her knowledge.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
If it was a problem, they could have easily prevented it. You're not the asshole. Lastly, someone said, adopt a second dog, name it Emily. I was about to say the same thing.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
That is pretty funny. I hate to say this. I am a little skeptical of this story. I'm a little skeptical it could be AI.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
And I'll tell you why. Reading it, they use a semicolon in perfect form.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Nobody's using semicolons here. The story's a little too perfectly just kind of laid out.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
What's the... People are farming karma. Karma is kind of like how you generate a profile on Reddit. So if you post things and it gets a lot of interaction, your profile gets more karma. And then you get... And then you kind of like... Your posts get seen by more people. You kind of like... It's kind of being an influencer on Reddit, right? Being verified.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, people farm it. And it's really lame. But... But there are some things AI can't do and that's like misspelling and bad grammar.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Most stories we read have some bad grammar that we fix or misspellings and I'm always kind of grateful for it because I'm like, a human typed that out. But nobody's using semicolons.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, there's not a single grammar mistake in here. My parents have weighed in, comma, and while my dad says it's ridiculous to expect me to change my dog's name, comma, my mom says I should, quotations, just consider it, and quotations, to keep the peace, period. I'm like, that's a goddamn good sentence.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'm going to be, look, I've spoken about how I feel about AI. I'm very scared by it. I don't like it. But it will be funny because all the sci-fi books for decades were like, AI is going to take over the world. What if we finally create true artificial intelligence and it's an idiot?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Like, what if it's really dumb? Guys, we've created a new intelligence and it's an idiot. And we're embarrassed. And we shouldn't have. And God comes down and he's like, now you know how I felt. He's like, look at you fuckers. We're like, wow, okay.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, thanks, Charlie. Thank you, Charlie. Fake dog.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
That's also ultimately the thing. We don't really know. That's what sucks, but that's our speculation.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
That's also what I wonder. Sometimes some people might not feel confident in typing out a story, so they use it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Obviously, I will never reveal I am her largest supporter. I have never seen any of the content aside from a few face pictures to confirm it was her account. I do this solely to help her and to help support my nephew since she refuses all help I offer. Is this wrong? I don't know. Does it feel weird as fuck? Yes, yes it does. Do I regret it? Not even slightly. So does he watch? He said no.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I still... Yeah. We don't know that, and ultimately people farm karma. We want to hear your voice. People farm karma on Reddit all the time.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Okay, next story. Am I the asshole for doing a half-ass job taking family pictures at a wedding after being told to shut up and stop being a smart ass? Well, you know this one's real. You know right off the bat this one's real.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. they wouldn't stop talking or looking away from the camera. I tried politely reminding everyone that the camera was the big black thing on the tripod and that it took still images, not video. I was repeatedly told to shut up and stop being a smart ass and that they knew what a camera was. Thank you. Thank you.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I replied that I had tried to explain to them that the camera was the big black thing on the tripod and that it only took still pictures. They said I should have waited for them to be ready. So I started posting short video clips of people being jackasses.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My mom said that I went too far and that they won't ask me to take pictures for them again. I did a fake cry and said boo-hoo. She called me a smart aleck. Please let me state that I do not think I am the asshole in this situation, but many people do. They are upset because they don't often dress up and get together and they didn't get good pictures.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Wrangling people is tough, wrangling drunk people. Angela's really good at it. You are?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
With, you're the Caesar Milan. Dude, that's such a good sketch idea. The Caesar Milan of drunk people. Oh my God.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, he's doing this fully as a favor.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
You know what it makes me think of? Because this has happened, this happens a lot, right? Where people, it's no longer just celebrities who get called out if their behavior is bad or they say something wrong. People in public, if you're gonna say a horrible thing to someone, people are filming and it might get posted and you might get outed as being like saying this awful thing.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
So what he does is he gives a friend money and that friend is the subscriber.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
And what people often respond with is like, well, you don't know the full context. You don't know what that person was saying to me. And it's like, too bad, you said what you said. If you're being a jackass to someone If you're saying something that's going to make you look bad, even kind of out of context, you kind of have to be aware of that nowadays. I'm not saying that's right or wrong.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'm saying that's kind of the reality we're in sometimes. It is tough because I guess I'd say the only thing that I could maybe see this person being an asshole is talking to this cousin before they post it. Because by posting this stuff, it is going to stir up stuff. Totally. It might...
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
cause stuff for them because it was their wedding and people might go, oh, I didn't know I was being filmed and that this was gonna. But I'm getting the vibe that the cousin probably wouldn't care.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
And I don't know if that friend watches. This is a beautiful, beautiful thing. That friend is like, yeah, I don't watch it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
And that's kind of all that matters. Comments, not the asshole. The photos are an accurate reflection of their behavior on the day. The only people whose opinions matter about the photos are the bride and groom that hired you. They like it, then no issue. They've embarrassed themselves and don't like that their online tantrum turned around on them.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It's easier to be right until evidence comes forward. Someone said, I used to do wedding photography and this happened from time to time. I sometimes assumed that the disrespect was due to me being a woman and sometimes that they were just oblivious or drunk. Lastly, someone said, That's true.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Him saying that he's like, I am not watching the content. I'm assuming it's.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It could be anything. It's true.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I know, who knows? But I think ultimately, if all of this is true, I think this is a kind gesture, it's fine, it's sweet, and I get it, it makes her feel like, oh, well, I'm earning this money, and she is, but instead of just giving her the money and she feels guilty about it, this is through a way that.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
He doesn't need to call her a few crayons short of a Crayola pack. No, he didn't need to say that. He did not need to say that at all. No. Because I'm confused and hurt. Yeah. Yeah, some comments here. This is so wholesome, even though the post has a disturbing title. I am sure there are other ways to assist, like trusts and such, but for anonymous instant short term, why not?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you. I'll ask that when we meet up, but I don't see it as a real reason. I've also seen people saying it's very unreasonable to go no contact, very limited contact because of this, which I agree with. I think she was just saying that to scare me, which is still very gross, but we still went and she messaged me back, so I guess we will just see.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I think the energy that we have oftentimes is like cousin energy.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Take it to the grave, though. Someone else said, while your intention is good, do you know if she is making enough money from other users? You may be the only reason she is doing OnlyFans actively. Oh, that could be true.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My husband also might come with me because I don't know how my parents will react when I ask them my questions. They know we still went, so I'm not too scared, but I can't be sure. I'll update with how the lunch goes soon.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Ooh, okay. Like Snow White porn or some shit. All right, final update. Place your bets. What happened?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Okay, fine. Well, here it is, fellas, your final update. Around 1 p.m. yesterday, we went to lunch. My husband didn't come because he had an important meeting at his work. Great for him. I wasn't that scared anyway because we were going to a pretty popular restaurant, and it wasn't like I would be alone with them.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Someone else said, I have a feeling that had she known she couldn't do it on her own and had she turned to you for help, she could have had a more realistic approach to the situation with a higher chance of finding a more wholesome approach to tackling it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
We got there and I sat down. I started talking to my mom and dad and started asking my questions. It was mostly just, why would you get so mad? And it's my money and I wanted to take my daughter on a fun vacation with her parents before she has a brother. And I was met with them gaslighting me and thinking because they don't love Disney, I can't go. I was on the verge of tears and leaving.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
So I asked my final question that I really wanted an answer on. This can't be over a fucking phone. There has to be something going on to make you blow up like this. They then told me what really happened. Okay. I knew it. I knew it. I don't know why we never got the phone back. Probably we'll never know. But here's the official ending of this crazy ass story.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
OP responded, unfortunately, she's one of those extremely stubborn people and will vehemently deny she isn't doing it on her own even when everything points to the latter. Lastly someone said,
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. You know, it's like, oh, the worst thing that could have possibly happened to me happened. You know what we should do about it? Never go to the happiest place on Earth ever again. That'll solve it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
No, but people do this all the time, right?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I think that's fair to say. I'm sorry that I yelled at you about the cousins.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
They take it out on just all sorts of things other than the actual problem.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Fucking bizarre. That is so weird. No, she blamed specifically, she blamed the housekeeper.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
For going through the phone. For being like, oh, you told me, like, don't tell me that because you told me you ruined my marriage. And so it... I think the mom can't go back to Disneyland and can't think about Disneyland because it makes her have to confront this thing that she clearly hasn't confronted. They clearly didn't deal with this after. No, because their logic is so fucking twisted.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
So they did leave it at Disneyland. I don't trust these people. They pulled up Vegas. They go, what happened at Disneyland stays at Disneyland, so we never go back. There is so much energy there that's been built up for 15 years that is now being blown up immediately at the daughters.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It's literally like, can they not watch Disney movies? What is that, Frozen? Get that off the TV!
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It always blows my mind, but it happens so often because I think then you have to deal with it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
You know what's wild about this, too, is the parents, both of them, are telling her this. They're telling her this as if she's in the wrong.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It's so funny. That makes sense though. Yeah, this is. That somehow makes more sense.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Man, that gets the award for the best story. I'm glad she still went. Oh, yeah.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
She might not talk to her parents again.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
What a bombshell of, like, oh, you guys are stupid and, like, really mean to each other and to me. Well, moving on. Okay.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. Yeah. It's unfortunately really funny. Like very dark, but very funny. Like the reveal of like, oh, you guys are both this stupid? Yeah.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
The cheating didn't even happen at the place. I know. No, there's so many layers of it not making sense.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Who was doing her a solid, by the way. Obsessed with her. No, the housekeeper is a legend. She was like, hey, by the way, I clocked this. I'm curious how she came across the other contact. I know, she was going through it. Because I'm like, what was the mom under, like, wife? Like, how would... Probably her name.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I think there's some offers he could probably put out there of like, hey, this is my nephew, and if he's saying he makes close to a million dollars a year, he could be like, can I set up a fund to pay for his college? Do some things.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
But how would the person know that that's... It's probably a scandalous text under a different name. Yeah, it had to have been pretty obvious. Yeah.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
You know what? Can I say something too? It actually makes sense that the evidence would be so obvious because it was probably obvious during it and the mom is just like not like acknowledging it. Because if after getting caught, she's not mad at him. Yeah. She's mad at everything else. He knows like he can get away with it. He's probably continued to have affairs since.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'm now imagining just other, if it wasn't a housekeeper, it was someone else, which is like, Gorsh, your husband's cheating on you.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
All right, we can pull on the seatbelts and who's that contact on your phone? Ooh, yikes, all right. Oops, okay. And you're off. Okay, moving on to our final story here. Wow, okay. This comes from Best of Redditor Updates. Just so you know. The title, Need a Fake Kid to Piss Off My Wife. That's awesome.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'm in. I'm in, man. I'm so in.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My wife and I are watching Elf together and we saw the part where Buddy's real dad tells his wife about Buddy and his wife gets excited about this surprise adult kid that pops into their life from a time before they knew each other. I point out to my wife that it's a little unbelievable that she would immediately be on board.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I then comment that she, my wife, would actually be mad at me in this situation, even if I genuinely did not know this kid existed and it was conceived before I had met her. She denies it, but I know my wife. We're in our early 40s and have been married for 10 years, together for 12. So I need a 20-ish kid to knock on the door and tell me they're my kid and that they just wanted to meet me.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Gotta be convincing and really talk about how your mom and I were once really happy before she died of something tragic.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Dealer's choice of death, he says. Throw me in. Job pays $100. Gender, race, et cetera, don't matter so long as you can pass for early 20s. Copy. Shouldn't take more than an hour of conversation. Then you get a call or something and have to leave. I want to do this soon after the new year. You come up with the backstory and I'll play along.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'll give you a little info up front after you take the job.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
This is awesome. I think the story already happened. There's some comments here. This sounds like a bad idea, but please post a follow-up once you go through with it. OP says, worst case scenario, okay, yeah, this could go badly, but sometimes being right in a marriage is worth it. Someone said, I don't think this is one of those topics. I don't think that's a quote.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
No, I don't think anyone's ever said that before. I don't think anyone's ever said that.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Sometimes being right is worth it. divorced the comedy special. Someone said, LMAO, this is a terrible idea, but I'll do it, mid-20s. Producer note, lots of similar comments to that one. This subreddit is rharrisonberg, so it is posted in a local subreddit. There's a subreddit for just about every city and town, right? So you can post there being like, hey,
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
People post on subreddits being like, oh, hey, I have a spare guitar I'm trying to sell. Anyone here want to buy it? You can do anything. Or like, I'm trying to organize a thing this weekend here. So this is what this guy's trying to do. He's trying to find someone in his town to be his child. Okay. Update. But first, do you think this is going to be good or bad? Uh... I don't know, Shane.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I think it's gonna be funny. Yeah. Okay. Like, I think no matter what, it's gonna be funny.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Like, I don't think it's gonna be too bad. Yeah. Yeah. So the very dramatic naysayers, one of which compared my prank to spousal abuse, several diagnosed me with a number of mental illnesses and at least as many said I was childish and cruel. To you I say, you're probably right. However, na na na boo boo, stick your head in doo doo. This guy's awesome.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Oh, my God. Oh, that's in the movie too. Unfortunately, interested and committed are two very different things. Multiple potential sons and daughters made it to the planning stage and found one reason or another to bail out. Let me be clear, I do not blame these folks at all.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I don't think I'd have the courage to send the first DM, let alone actually go through with the prank orchestrated by a complete stranger. But I did find a suitable actor with the courage to come through and I still think it was money well spent. So here's a synopsis of how it played out. No, there's not a video. Saturday afternoon, my doorbell rang.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My dog lost his mind, as he is one to do, and my wife answered the door since I had pretended to take a call moments earlier. My son, looking about 20 to 25, taller and better looking than I, asked if I was home. My wife motioned to me. I had conveniently just ended my fake phone call, and I came to the door.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My son, who even shared my first name, his idea, not mine, said he had something kind of strange to talk to me about. I asked if he wanted to come in, which literally almost blew the whole thing because I would sooner saw off my own foot than invite people in my house. But my wife didn't think much of it. We came to the living room. I offered him a drink. He declined.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My son is an excellent actor, by the way. He would later say it was the anxiety of the situation and not wanting to mess up that made his nervous demeanor so convincing. This is from memory, but it's pretty much everything. I'll let my son chime in with details should he feel like outing himself.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Do you remember old ex-girlfriend I mentioned at least once in my 10-year marriage in front of my wife? Yeah, that's my mother. It was my wife who reacted first with, oh, no way. So I looked at her, feigning ignorance, and then back at my son and said, is she okay? Yeah, she's fine. That's not why I'm here.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My wife was nearly busting out of her chair, totally engrossed and completely consumed with two strong theories. One, her husband had a long-lost son, and more importantly, two, her husband hasn't figured out yet that he has a long-lost son. So I say, out with it, kid, what's going on?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
He goes, I'm 22 years old, my wife's eyes essentially bugged out of her head, having now confirmed her theories in her mind. She looks at me, seemingly annoyed that I hadn't put these obvious puzzle pieces together, and interrupts my fake kid, nearly laughed, but I held it together. I think he's telling you that he thinks you're his father.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My acting is not so great, but I gave it a shot with, wait, what? My look of shock could use some work, but it played out for the audience. My son looked at me. She's right, and I'm not here to ask for anything. In fact, I don't have a lot of time to stay, but I just wanted to meet you and maybe exchange numbers. So I said, this is a lot to take in.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I knew your mother a long time ago, and she never said, I mean, I didn't know him. I'm paraphrasing, but this kid deserves an Oscar. She never told you. She only told me on Christmas morning. She didn't say anything bad about you, just that it was over, and she was already dating my dad when she found out she was pregnant with me. Wow. I say, wait, does your dad know?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
He goes, of course, and I've always known he wasn't my biological father. He's a great dad, but lately I've been wondering who my real father was, so I asked my mom and she told me.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I say, wow. I freely admit I had the easy part. My wife, not saying... This is crazy. And it turns out I was way wrong. My wife wasn't mad, miffed, or even slightly annoyed. She was full-on amazed, excited, and entertained by the whole thing.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I waited a few hours before I fessed up, but before I did, she kept saying how cool it was that I might have a son. When I told her it was all a bullshit lie I made up to prove a point, she laughed, a lot. I can't decide what amused her more, the effort I put into the ruse or the fact that I ended up proving her right in the process. Here are a couple gems from the wife after I told her the truth.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Where the hell did you find that guy? I'm glad your son wasn't a serial killer. I might have been mad if he came here looking for money. Next time you can save $100 and just assume you're wrong. You know I'm going to get you back, right? The last one has me a little worried. That is it. End of story.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
There's not another update.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I want the revenge.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Well, we might get a Reddit story eventually from this guy of like, my wife killed me.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
She's awesome, yeah.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
There is something sweet, there is something sweet about this of like putting this much effort and creativity into just like something in your relationship, right? I think there's something sweet about it. Of like, oh my gosh, I wanna pull this huge elaborate prank on just my wife. Like not for another audience, just my wife. I just wanna do this experiment.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, it's like, oh, you weren't trying to make money off of this? It's like, no, he just really wanted to go through a bunch. It sounds like they have a fun dynamic with each other in that way. It's very playful.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
We don't know how long it took. It might have been a month or so. And you're not going to think about that.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. He found someone off Reddit. So that means someone showed up with a fedora and a katana. And they're like, I'm thinking you're my father. Yeah, I'm about 22 years old.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Wow. Yeah. If you're in Harrisonburg, Virginia, there's acting opportunities.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, it's great stuff. Well, this has been a blast.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Thanks for being here.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Okay. Damn. Okay. Wow. All right.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I'm never going to Disneyland again.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Well, thank you both for being here. And I should say, keep an eye out on the Smosh socials. Check out the Smosh Instagram this week. Keep an eye on it. There might be some fun Reddit updates about our show. Just keep an eye on it. I don't know. Something special might be coming. But we'll see you next Saturday. Goodbye.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I don't think she wants that. He's just saying she's gonna refuse all forms of help. And that's okay, she doesn't have to take it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
do so apparently from other comments he has set up trusts so there are other ways it's short term that she's saying no i don't want i don't want your money um and it's also i guess from other comments she may have other subscribers i don't know how much money she's making per subscribers i'm not really sure how the income works on only fans um but i i I don't know.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I don't think this is a situation where someone's a horrible person. No, no, for sure. He's just so certain that she's so stubborn. Yeah. This is tough, and we've had stories kind of similar about people who are trying to get into Twitch streaming.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
And just like being so determined, but you know, the average, like the 99% of people on YouTube, Twitch, OnlyFans, are people with like zero subscribers who are just trying to break through. And it's really, really hard. Like it's a lot harder than people realize. So she's not alone in what she's doing. And she's probably just hoping, like, it's going to spark. It's going to work.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It's really tough.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. Time code on this is probably going to be, like, 15 minutes.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
We're good. Don't worry about it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. Most people I meet, I'm like, hey, what's your family like? And they're like, really good.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Give me my allowance. I am so curious about this friend who was like, yeah, I'll do that. Does he watch it? Does he watch it?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
You find out your whole family is the one who subscribed.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
We all talk. Yeah. We're all in communication.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Smosh about the Dynasty typewriter was just my family in the audience. I'm like, okay. Okay. Okay, let's move on to our next story. Am I the asshole for telling my family no more to monthly family dinners? Whoa. Whoa. No, I just already have a lot to say. This is fun for me, because this is not something I relate to.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
My family lives out of state, so I've never experienced having family where it's like, oh, we meet up regularly.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Wow. Oh shit. Okay. Ever since my dad was a kid, our family has done monthly family dinners, nicer ones than your average family dinner. It's something our family did when my siblings and I were kids too. We'd have grandparents over and we'd all have a nicer dinner together.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
When my siblings and I grew up, we still did it only instead of what happened before where branches broke off over time and did their own. They decided we should include partners slash spouses and our kids as a whole in one. By the time I was 19, the family had decided they would take turns hosting each month to lessen the burden. My wife was excited to be part of them at first.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
We started during our relationship. I did the cooking to start and then she took over after a while because she wanted to. My family had seemingly gotten along with my wife before this point, but they were overly harsh of her cooking with the exception of my two younger siblings. She tried to make them happy, but no dice. I told them they could be kinder.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
They said she should cook better or cook different things. Oh my God. My wife didn't make anything they don't normally eat, but nothing was right. She grew frustrated and I grew suspicious. So we hosted a couple of months ago and I told my wife we were going to pretend I did the cooking just to see. She told me she felt like they just weren't fond of her food.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Okay. Shall we get into these? Yeah. Our first story was posted less than 24 hours ago as of reading this.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I pointed out nobody had the same amount of complaints as them and they even criticized the steak and potatoes they all seemed to go crazy for. She went along with the plan and when my family thought I'd cooked it, they loved it. Oh my God. Said it was so good, my wife had decided to let a real talent take over.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
That it was so nice to have something a little different, curry, and all this very lovely stuff. My younger brother and sister weren't fooled, but they enjoyed watching the rest of the family dig a hole. When the rest of my family heard it was my wife's food and not mine, they tried so hard to backtrack on all the nice stuff.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
The rest of the dinner went into tense silence and my wife's eyes were opened. I told her I was done with these dinners and she was my priority. She felt a little bad. I told her, They said I was overreacting, making very relationship-harming choices, and treating them badly for simply having issues with my wife's food. They also said to think of future kids and how they'll miss out.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Some of it got to my wife a little, which I have tried to reassure her about. Am I the asshole?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah, yeah. But I think specifically the word overreacting is so bad. It's awful. How are you going to quantify my feelings and my emotions? Overreacting is just super ineffective and it's dumb when you think about it because it's just telling someone like, hey, don't feel what you're feeling right now. It's like, well, I'm already feeling it. Your feelings aren't justified, man.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
It's okay, I wonder if there's a version of it of, I mean, not in this situation. In this situation, they're not overreacting, because this is absolutely crazy. But, like... Saying like, hey, it's okay, like the situation's not as bad as you might think it is or something. I don't know. But that's besides the point. How do you even do that?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I can tell it's a Kiana pic. Kiana just finds, she lasers in on the craziest stories. She does. Okay, so as of reading this, this came out less than 24 hours ago.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
I think in this situation and in most situations when people are worried if they're overreacting, they're typically not. And what I'm blown away by and I think is a hard line rule is if you're ever having dinner at someone else's place, you just don't criticize the cooking. Yeah. Like you're at their place.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
If someone is cooking food for you, I just don't think complaining is really in place for it. If you don't like the food and you leave and you go, I didn't really like the food, that's fine. But to like say it to their face, I just can't believe it.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
This is from True Off My Chest. This is a confession someone made. I purchase all of my sister's OnlyFans content. Am I wrong?
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
That's what it's reading to me.
Smosh Reads Reddit Stories
You Can't Pick Your Family... | Reading Reddit Stories
Yeah. Sorry, I feel like I'm taking the energy out of them. I think tradition, it seems like a tradition they want to hold on to. This family's cooking.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Welcome to Reddit Stories. I'm Shane, and today's theme is all about friendship. We got friendships that are probably not gonna do so well. Joining me today are two friends.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, and blaming her for, like, how could you lead me on? Like, I'll lead you how? Point out two exact moments where this person has lead you on by being in the same room as you for extended periods of time?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Asking to hang out like a friend? I don't think there's any version of leading him on unless she said, I want to marry you. Like, if you propose, I will say yes. Otherwise, I'm like, no, and no point did you have this indication. Because yeah, some people don't have physical relationships. It's the physical side doesn't matter. But there's been zero discussions. They have been friends.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They have never claimed to be anything more.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They haven't even kissed or held hands. I'm just a little bit, I know everybody's different in their relationships, but I'm like, this guy thought straight to proposing.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah. What movies is this man watching?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
What movies is this man watching?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Comments, wow, this is the biggest misread I've ever heard of. I don't think your friendship will recover from this, at least for now. The best you can do is make it clear that you don't feel the same way at all. But yeah, this is a friendship killer. Someone else said, yo, he wanted to take the relationship to the next step and decided to propose to you?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Bro is either tone deaf or out of his mind. Y'all been best friends for two years. Have you actually dated anyone during this time? Don't see him alone. Someone else said, you can talk about this with whoever you want, it's your life. You thought he was your friend, but turns out that was a lie. You did nothing wrong. I mean, also two years and they're in college.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I mean like, that's fast by standard relationship. This is, yeah, I think his ideas of relationships are very skewed. Seems like, yeah. Unfortunate. Very unfortunate.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So they said they shared the same dorm. Were they in the same building that had different dorm rooms? Or did they share a dorm room?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, because I'm like, there's no way that they're sharing a bedroom.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They're probably not sharing a bedroom, but they're probably sharing a building. They're probably just friends.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It might be, yeah, because I know that dorms on some colleges can be on a smaller scale, like a house kind of thing. And they can be co-ed. So maybe it's something like that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Okay. Is the character artist there?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He quickly draws one of him going like. Jordan did in fact not come back to the hotel. I stayed up until 1 a.m. before falling asleep and he didn't return. When I woke up the next day, the hotel staff let me know he had checked himself out at about 6 a.m. I did end up responding to his big long text.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We always separate the bill and there are zero issues. However, Alex decides they want to invite a male friend, John, 18, which is fine with all of us. The food was good as usual. Then the server asked if we want to split the check. Then Charlie, who usually wants to split the check every time we go out and eat, says, all on one.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I took everyone's advice and told him that I was sorry it didn't go as he had expected, but that I wasn't sure where he'd got the impression we were together. I said I'd be happy to sit and have a discussion about it all so we could make sure we're on the same page. He was not happy about this at all, and he again went off with a bunch of the same type of things he'd said in his first message.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It didn't really seem to be going through his head at all. Even in these new texts, he kept referring to this all as me breaking up with him, despite me explicitly telling him we are not and never have been together. Again, all his messages were very clear and coherent, even if what he was saying was not based in reality at all.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He wasn't sending paragraphs, just sentences in really quick succession, which was blowing my phone up. He told me he didn't want to meet up with me to talk because I had ripped out his heart and crushed it in public. I did ask him for specific instances he could recall between us that made him think we were dating.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
but he completely ignored the question and just kept going on and on about how hurt he was that I was breaking up with him and how he felt his world was ending. He said he loved me more than anything and had felt so confident that I did too, which is why he felt so certain about proposing to move our relationship along.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Eventually, to be honest, I grew pretty tired of this conversation and stopped responding because it was just going around and around in circles. Me asking where he got this idea, him ignoring this and telling me how hurt he is, I'm breaking up with him over this, et cetera. He went on and on saying he thought it would be a ring I like because it was my favorite gem, a ruby, instead of a diamond.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's got me wondering how much he actually spent on this damn thing. I didn't look very clearly at the ring so I couldn't tell if it was something super expensive or not. He had been working up the courage to do so for a while and figured doing it when I was at home would make it more special. For a while, he was just talking to himself in my text because I wasn't responding anymore.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
When I checked back about 20 minutes later, I had something like 60 messages from him. Granted, they were all single sentences. At the very end he apologized and told me that it didn't matter anyway because I wouldn't see him around anymore. Obviously I was concerned so I asked for clarification.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He said that he was going to drop out of university and go back home because he couldn't deal with the shame. That's where our conversation ended. I didn't really know how to respond to that. As it stands now, I don't really know where Jordan is. I didn't ask him, which is my bad. Not sure if slash when we will talk again.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Unfortunately, I can't excite everyone with A, and then he turned up at my door, and then he sent me flowers or whatever. It feels a lot is unanswered. I still don't know where he got the idea we were together. He hasn't explained that, so I'm sorry I can't give everyone that answer.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
God, it is so frustrating how he refused to take any accountability for everything he was saying, everything that he did, refused to answer to anything and make it all her fault. Like, Literally about leaving school, refusing to answer her questions, just abandoning all responsibility and accountability. Like, hey, you're here too. You participated in this friendship too.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I thought it was just her feeling generous that day, but then they started giving John shit, eating grins. Charlie said, John, you're paying for us all, just to be clear. John said, what? With visible confusion on his face. Alex and Charlie giggle, get up, and they leave. They signaled me to go as well, but I was just as confused as John was. WTF just happened. Me and John sit there awkwardly.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah. I will never understand the type of mindset or the place that someone can be where they message someone like that many times or call someone over and over again. Because I hear about it all the time. Like so often that it's not an outlier, right? Of people being like, yeah, my ex called me like 10 times today.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And I'm just like, I can't fathom being in the place, because you know people see one phone call. You know people see one text. Or two phone calls.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Wow. That's crazy. Was there a question mark in there?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, that's okay, a couple are really trying to talk to somebody.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Sure, but I just mean in this type of situation where they are talking and then she starts ignoring him. I just wanna know, from someone who maybe was in that place and now they're out of it, what was going through their head? Maybe just there's no thought going on. It's probably that. It's just going. That's a clear sign.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
When someone's sending like a long text, it's a little bit more likely that they're thinking more about what they're saying as a whole. But when they're rattling off sentence by sentence, they are not thinking at all. They're just putting it all out there on you and like – this person continued to basically talk to themselves in her texts without her replying. This is concerning behavior.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I do wonder if maybe there was a lot more going on internally than.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
This seems very serious. This actually seems, and the fact that he's going to drop out of college and move because of this, it's like, this sounds like.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's concerning. I think it's concerning behavior.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Communication, like, misunderstandings happen all the time where people think that feelings are there when they're not. And people are trying to be respectful in terms of affection and things. But, like, if that happens, it's, like, so important to learn from it. And, like, this is obviously the most extreme version of that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But, like, to refuse to even, like, it didn't matter if she was texting him back or not. He was still gonna be saying all the things he was saying and not answer her or even hear what she's saying at all.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Do you think the character artist drew her responding to the proposal? Like her being like.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Him drawing so fast. I just made sure to draw it so fast. She's like eek!
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Oh, man. Wow. That sucks. Yeah, that's crazy.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And it sucks because, like, they were, to her knowledge, she thought she had a really good friend. Like, she thought she, because, like, that's what I love about Smosh is, like, we really show and normalize platonic friendships across all genders because I think it's super important to see for people to experience. And, like, she thought that's what she had, and it was completely a lie.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Okay. Our next story. It's from Am I the Asshole? Am I the asshole for explaining my pizza to joy ratio to a friend who is trying to justify buying a vintage car? Pizza to joy ratio.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Odd name, but I'll explain. A few years ago, I came up with a simple math formula I use whenever I'm going to make a dumb purchase. When you come home from work, making a filling meal from scratch will, on average, take about an hour. A takeout pizza costs around $20. So having that pizza instead of cooking and getting to relax instead means an hour of enjoyment costs you about $20.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So before I buy anything, I sit down and think if I'm going to get a number of hours of joy equal to the price divided by 20, Out of this item. This is only for non-necessity purchases, obviously, because applying it to hot dogs or something would create a number of serious questions I don't want answers to. Here's the argument I got pulled into and asked for my opinion.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The check comes to $125 and I tell the server to give us a moment to provide payment. I only had enough for me, $30, and John only had enough for him, $40. Charlie texted in our group chat asking if I was coming with them. I asked them, what the fuck are you doing? Then they went on to say that John should want to impress us and that it's a man's role to treat us like princesses or some BS. Oh!
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
My friend has been arguing with his wife about buying a vintage car, and he kept talking about how happy it will make him. They can, in fact, afford it, and I did seriously say that if he thought he would get that number of hours out of it, he should go for it. I actually think with how hard he works he deserves it and said that part out loud.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He tried to call me out as being a hypocrite because about a year ago I spent about $1200 on a Ghostbusters costume, proton pack, boots and all. I had to point out to him that I in fact throw that costume on frequently for a couple of hours at a time. It brings me great joy when I do and that proton pack is hanging across from my bed so I can look at it before I fall asleep.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was something I've wanted for nearly 40 years and I'm not going to stop getting joy from it even if I'm over the $20 an hour limit. But his wife now uses the pizza to joy ratio for everything and she says it has helped her cut down on spending money on things she might only use once or just things she thinks are neat like anime figurines or Oh. Oh.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Okay, so he's getting blamed for the fact that this relationship has a very different view of finances, I feel like.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, it sounds like they took his idea and ran with it, or at least one of the people who did it.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was just inspiring to her, but he's mad at his wife for wanting to spend less.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, and called him a hypocrite for saying you deserve the car.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, because what's crazy is, at the very least, OP is not the asshole, because OP was like, oh yeah, spend it on whatever. You're allowed to do whatever you want. He's not telling anyone to do anything.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, that must have been a point of resentment from this friend for a while for it to come up now.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I need to know this two hours at a time thing.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's what I'm hooked on right now. Every now and then I wear this costume for hours at a time.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Just one mirror, it's like broken.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He's like, I'm so full of joy. I love this. Hey, maybe. Maybe. You're allowed to do whatever you want. You're allowed to do whatever you want, man.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Maybe he's wearing it, like he's in a play, or a musical, or a drag show, or a costume party, or maybe he wears it to Ren Faire every year.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Every opportunity a costume would come up. He dresses as a Ghostbuster for Ren Faire.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I only bring it up because I've seen stormtroopers walking around Ren Faire.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's true, that's true. You'll see everything.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I spent way too much money on a pirate costume at Ren Faire, and I'm like, maybe I'll just wear this to every costume party to get my worth out of it. Haven't done that, but I've thought about it.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was just a funny, it was a funny example he then gave, and it's like, this brings up more questions.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I wear it for hours and hours and hours. I'm very joyful.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's definitely like, this is a big kind of conversation for a lot of people of like, what is worth buying and investing in that's fun, you know? Because there's obviously buying things that it's like, oh, there'll be a return on this, or this is practical, but there's like, full-on luxuries are theoretically a waste of money in every way besides the enjoyment they give you.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
You're trying to measure what that enjoyment's going to be. So I get that everyone's different with that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, everyone's kind of figuring out what they, like, trying to give themselves permission to splurge on themselves. Some people have it really hard. You tend to live really frugally and be like, I won't get this book. I won't. Okay. Even though I know you want it. There's things like that where maybe this gave the wife permission.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Like, ah, now I can give myself permission to buy all these things because now I can see how it equates to joy for me. But it's really up to that person that marriage and that relationship to figure out, okay, how are we operating with our finances together?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But. Yeah, it's tough, a vintage car is a tough one because, but he might really like vintage cars and he might, that's something you can invest in for a long time, like, on a joy level. I have my own rule, like, I have my own system, is, because I'm someone who can get very, like, inspired for a bit on something, I'll be like, Oh, man, I really love this thing.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then, like, 30 days pass, and I kind of, like, lose interest. So I, whenever I get into something, I'm like, I'm going to buy, like, the cheap version of this.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then, once I commit to it long enough, then I'll buy, like, if I'm like, oh, I'm really into drawing, I want to draw, I'm like, I'm going to buy a cheap set of pencils, cheap little thing, and then once after, like, you know, if I go 50 days to 100 days, and I'm really doing it a lot, I'm like, all right, now I can buy, like,
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Exactly. That's kind of my mindset. And that goes with kind of everything. When I recognize at a certain point in my life of like, oh, I really do like to sit down in front of my TV a lot. And I had had a really small TV that I had gotten for free for a long time. And it hit a point where I was like, all right, I'll buy a TV. I spend a lot of time here. I recognize that. But if this guy loves cars,
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And he spends a lot of time there and he has the money. And that's okay.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But this sounds like a struggle in the relationship. Yeah, this is not the OP's... OP is in a different orbit. Yeah, it's a non-issue. You said something that got picked up. That's not your fault. She would have probably heard something similar somewhere else.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, it had nothing to do with him.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Um... Comments, hmm, I need 750 hours to justify my vehicle. That's 1500 work days. I work around 250 days per year, so I need to get six years out of my vehicle minus whatever I spend on maintenance. Good ratio. Someone's OP responded, and honestly, I think he's going to get an immense amount of joy out of it. I'm just not a car guy, so I don't understand how that feels.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So I offered my ratio as an example of how I spend money. Oh, and he is getting the car because he has wanted one since he was young and his wife did agree she thought he would get that joy out of it. Okay, so there's no problem.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
A long time ago, that's just being brought up.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That really is a good ratio, though. Someone said, not the asshole. I like your formula, and I think that it makes sense. If somebody misuses it, it's their problem, not yours. Lastly, someone said, gotta say not the asshole on this one. You told him he should go for it and gave them a silly way to determine how much joy it'll bring someone.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was like a scene out of a movie. I was in complete disbelief. I explained the situation to the server who was super cool and told us if we couldn't pay now, I could just leave a number and they would charge me tomorrow. Out of one last ditch effort, I called my uncle for the money and he immediately understood and sent me the money. He even said he would be there to pick me and John up.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I also agree they're taking it too far, and it should be exclusively... recreational, but everyone has their niche. Also, did you make that up or find it somewhere? I swear I heard it somewhere else. They didn't respond.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I feel like I've heard similar things to it. I think it's just like responsibly thinking about your purchases. It's just a more conscious way, and he equated it to like a cute little pizza thing ratio.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Well, here's the deal. She's pregnant, which I guess I found out when he did. She's very nervous about finances since she grew up like he and I did, poor as dirt, but didn't want to tell anyone since it's still in the first two months and she's worried about things like a miscarriage.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The long and short of it is she was getting stressed by the idea of being out of work for months after giving birth and was worried that if he bought the car, it would eat into his savings, which they would be heavily reliant on for a bit. Instead of going, you should have told me, my friend and I got on the same page and he said, I'm very sorry for making you worry about that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I can always buy the car later on when we know it's okay to do it. For now, you take priority. I told her, I'm very sorry I put a brain worm in you that played into your fears while also doing something that exacerbated your anxiety. Pizza math goes directly out the window when a baby is involved.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Instead of trying to reinforce that she took it too seriously, since I really didn't feel like trying to defend myself was going to do anything but make her feel more anxious.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So I ordered us all Chinese, and we sat down and talked about what their finances look like, and even though right now they can afford a baby and the car without issue, they're both high earners, he agreed to wait five years and buy it as his mid-life crisis car. That's about all, she's feeling way better.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We had a small celebration since she's still nervous about getting too excited about it and I also apologize for putting her in a position where she had to admit before she was ready. All in all, everyone is in a better place, I think. They ordered Chinese and not a pizza. Adults.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Whoa, they ordered Chinese and not a pizza.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I'm so sorry. Yeah, and the Ghostbusters costume went, Will we get a picture?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then a ghost comes out. He says, ah! Okay, next story. This comes from Relationship Advice. It's a 26-year-old woman. My husband, who's 26, my husband's family keeps referring to me as his best friend. What does this mean?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I pay the tab, I apologize heavily to John about this entire situation, but he was actually really chill and super grateful for what I was doing. He explained he only had $40 from his birthday money and decided to spend it with his friends. I get a text from Alex in the group chat asking if John paid for the tab. I said, no, I did, and they got mad at me. Then my dad asked what happened.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
You know, anyways, next story. I think it's pretty clear. My husband Robbie, who's 26, and I got married earlier this year. It was a beautiful day and I felt so much love and support from both sides of our family.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Two months after. Didn't expect that. Two months after our wedding day, we celebrated my birthday at my in-law's house. It was nothing major, just a dinner and a night together with me, my husband, his mom, 50, dad, 50, and sister, who's 22. That was the first night I noticed them referring to me as Robbie's best friend. Thank you. to anyone refer to me as Robbie's best friend.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I am his wife and before that we were engaged for over two years. Hearing my sister-in-law refer to me like that confused me greatly. I always refer to her as my sister-in-law and I would expect her to do the same or maybe even as Robbie's wife but certainly not best friend. After my sister-in-law hung up her phone, I asked her why she referred to me the way she did.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
She did not seem at all abashed. She just said, well, you are best friends, and that's what mom and dad call you, referring to my mother-in-law and father-in-law. My sister-in-law and I are by no means very close, but we are nice to each other and have never had any fights. We just don't hang out outside of family functions because our personalities are pretty different.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
She's never made it seem like she was annoyed or mad at me. Okay. This week we had that happen and I had to pay a visit to my mother-in-law's office to help a client transition. My mother-in-law was in the office so I stopped by to say hello. While I was there she introduced me to her colleague and once again I was perplexed by how she did it. She said, this is my son's best friend.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
As I was shaking hands with the colleague, I paused and awkwardly said, I'm his wife. The colleague looked confused, but my mother-in-law continued to smile and didn't address it. Once we were alone, I asked my mother-in-law why she referred to me like that. Just like my sister-in-law, she didn't seem to act like it was weird at all and said the same thing. Well, you are best friends.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The only thing that I can think to explain this is that in my vows to Robbie, I promised to continue being his best friend. Nobody acted like that was odd or special, and I feel like it's a pretty common thing to put in vows. So I'm not sure why Robbie's family seems to have clung to it.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Unless it has nothing to do with everything, I've spoken to Robbie about this too, and he is also perplexed by it. He asked his parents privately about it, and they gave him the same answer they've been giving me. It all just feels like some sort of bullying behavior to me, but I've never felt a sense of this from them before.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Are they calling me his best friend because they don't like the fact I'm his wife, or is it some inside joke they've been on without me? I'm not sure what to do or to make of it, especially because the in-laws are acting like it's not an issue when I bring it up. Yes, I am Robbie's best friend, but I'm also his life partner and their daughter-in-law slash sister-in-law. I don't know what to do.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Any input and advice would be welcome."
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I told him the truth, that his brother paid for the tab, and he got mad at me. Do I live in the Twilight Zone? Am I crazy for not wanting to ruin a friend's life over chilis? Anyways, after Alex said I'm just not going to invite guys to our plans anymore, I left the group chat and blocked both Alex and Charlie.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And their responses, and they don't even seem, like, bothered. They're not giving, like, reactions.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Like I can see this being a sweet thing within the family of like, oh, that's so sweet that they consider each other best friends. So like it's fun to like consider them that to each other. But like having it like go anywhere outside the sphere of family and like introducing them as such is like really weird.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They were at the wedding. She said it all has seemed fine. I wonder how they referred to her before they got married. Not best friend.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Worst friend. You are not my friend.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
You are not my friend. But it seems like she's not saying, oh, they've always done this. So was she Robbie's girlfriend before? Robbie's fiance? She doesn't put that in, but she's saying that currently it's Robbie's best friend. That's so weird.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I'm trying to, like, literally understand, like, oh, maybe they're not trying to, like, reduce her to a wife role. But it's, like, I don't know. There's something about, like, ever since we've gotten legally married, like, certain things just get taken more seriously when I'm, like, my husband is picking my prescription up.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Like, if I were to say, like, my best friend is coming to get something or, like, it's just not. There's just some more, like, also when it's a mother-in-law introducing to a co-worker and stuff, like, this is my son's best friend. That's not giving the co-worker any context at all.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It definitely feels like a respect thing.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's a huge lack of context. That's a big difference to anybody outside of the context.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, because when you're introducing someone to a complete stranger, that context is kind of important. It's kind of like, oh, here's our dynamic. It's not just, because son's best friend could be like, oh, you don't know this person. This person doesn't mean anything to you. This is my son's wife. It's like, oh, that's your family.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And there's different contexts that can always be there, right? But it's just odd. It's odd.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It feels like a step back. Yeah, no, and it is like, because being considered family is very different than just being a family friend, you know?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But the sister, they were at dinner and the sister was saying that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And you did it at my birthday dinner.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I would understand if it's like, oh, she's worried about that being misread or something, but she's also not getting upset, none of them are getting upset when she corrects them. They're just going, oh, you are best friends. You are best friends. What's the problem?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
John also cut ties with them, and we have started talking more and more, and we sometimes play Fortnite together. Anyways, the moral of the story, you think you know someone.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Comments. How about just being straightforward? Yes, Robbie and I are best friends, but now that we are married, I would prefer that you refer to me as his wife as I treasure our relationship. Thank you. Someone else said, this seems passive aggressive. Have your husband shut it down.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Someone else said, I would just continue to correct them every time it happens, and I would also expect my husband to do the same. at the time it is happening, not in private or later. If he does not correct his parents or sister, you have a bigger issue. Yeah, I don't think it's on, it should be on her. The husband should be like, hey, can you please refer to her as my wife?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, or like, I love that, because it's like, that's his direct family, but also like, if it happens in front of her again, she'd be like, oh, you could just call me his wife. Like, that's very sweet, but like, you could just call me like, wife, like, that's fine.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then you set that boundary in a friendly, casual way, it shouldn't affect anything, unless they have a problem with it.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The most optimistic thought I have is that someone could be like, oh, it's really endearing and sweet. Like being best friends is more important than whatever. But I don't, I have a hard time believing that's what's going on here. Update? Update.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We might need to get the Ghostbusters costume on because unfortunately for my relationship with Robbie's family, shit has hit the fan.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Your paper towel's out. Okay. Yesterday afternoon, Robbie and I were invited over to his parents' house for dinner. I have a big project due this week at work, so I needed to stay home and wrap it up. I told Robbie to go catch up with his family while I ordered a pizza.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They're gonna fall in love now. That's so weird.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Apparently, this is when Robbie decided he was going to set things straight and figure out why his mom and sister keep referring to me as his best friend. Please keep in mind that I'm telling this story based on the details that my husband has given me. Robbie had a normal dinner with his folks, but they were all drinking a bit more than usual.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Robbie decided to bring over some scotch that one of his groomsmen gave him for a wedding gift, so he and his dad were especially loose. Robbie and his dad tend to have guy time together after dinners where they hang out in his dad's garage and talk about car stuff and projects at home slash work. This is where Robbie confronted his dad about the whole situation.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It feels like a bunch of young women learned the word chivalry for the first time and decided to test it out, like test out the old chivalry wheels.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
From what I can tell, it took some coaxing to get this information out of father-in-law, but eventually he admitted to Robbie that my mother-in-law and sister-in-law and him were all in on some sort of bet as to how long mine and Robbie's marriage was going to last.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Father-in-law bet that we would stay together, whereas mother-in-law bet less than one year, and sister-in-law bet less than six months. Apparently there was a cash prize involved. I don't really want to know how much it was. Father-in-law admitted that he believes the whole best friend moniker was a way to get under my skin and cause doubts about my relationship with Robbie and his family.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They think that if they acted like it was a non-issue for long enough, that it would drive me crazy and start making me angry at Robby for not intervening. Robby then says he stormed into the house to confront his mom about this all. It ended in a screaming match between Robby, mother-in-law, and father-in-law.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Robby eventually stormed out and walked to a nearby gas station, and from there he called me for a ride since he couldn't drive. This morning when I drove Robby back to get his car, we had a horribly awkward confrontation with his parents. Mother-in-law is apparently pissed at father-in-law for betraying the secret, and they were fighting about it all night.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Father-in-law will be staying with us in our extra bedroom for a couple days, or until they can calm down and talk to each other again. Robbie is now set on going no contact with his mom and sister. He is angry with his father, but is more willing to forgive him. Personally, I would prefer if we saw a family therapist before doing this, but we are still ironing out the details.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Hopefully we can get through this with both marriages intact. But if the father-in-law and mother-in-law break up, She's gonna get some cash. It's her bail.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And 20 years from then, the mother-in-law and father-in-law are gonna be like, We did it for you.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's crazy for the mother-in-law to be mad that they got caught in their horrible, that is horrible. It's one thing to, it is one thing in a safe space to talk about things. Talk about whatever you want in your safe space. But to put money on it and then to start affecting people outwardly is so, so messed up.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's unethical in general. It's a shitty move. Yeah, all of it is. But it's also unethical on a gambling level because if you're gonna gamble on something, you're not allowed to then go and affect it and try to weigh the odds.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So that's also an added layer, but it's obviously super messed up too. It's so dehumanizing. Especially for your own child. Yeah, that's what it's like. Damn, what kind of a parent are you? The only situation where betting on a relationship I think is not horrible is if you're watching reality TV. Yeah. And it's someone you literally don't know. They're out of your entire universe.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And even then it's still like weird. But this is insane to do it for your own child.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
You're gonna make other friends. I think I recall back when I was a teenager, shitty people love to find an excuse to be shitty. That's just what it seems like it is. It's just like, oh, well, he should wanna, it's like, you guys just wanted to screw someone over. You wanted to take advantage of someone. You wanted to get a free meal. You're blaming it on this.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's just like how negatively do they view OP to just play with their relationship like this? They either think she's a monster or they've never respected the husband. What's his name, Robbie?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, they have no respect for anyone. Let's be clear.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
You can't do that. It is really sad. It's deeply sad. The mom was only upset that the secret got revealed and was willing to kick the father-in-law out because of that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Hope that entire relationship and family dynamic was worth whatever money you bet on this marriage because you just threw a lot away.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Just about other people's well-being and happiness and betting against it. It's just, you're putting really bad energy and bad vibes out there. It's that slimer behavior.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That is slimer behavior. We need to get the Ghostbusters costumes on.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Do you want to know a really quick weird story since you said slime hit the fan?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So before slime was a really big thing, there was still a little bit of slime. And Disneyland had sold a little bit of slime. And I had a little slime and my sister, it was my slime. And my sister threw my slime at the ceiling fan when I was at home. And it went all over and she never cleaned it up and it was stuck to the carpet for years.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And I found out by finding slime on the floor that she, so slime hit the fan.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Whoa. I'm really sorry to hear that. Back when they only had a little bit of slime. There was only a little bit of slime.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was 2004, 2005, slime era. You know.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, slime was around, but it wasn't.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But yeah, she threw my slime at the ceiling fan and it exploded. So now I know what happens when slime hits the fan. Sorry, that's just the image that I got in my head when he said that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Hope you enjoyed my story just then. If you want more, there's two videos right there and there.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Comment down below about Courtney's slime story. That one's really sad. That's so sad.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's a bummer. I've never done that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
No, that's horrible to do. I also think that stuff always comes to light. When people try to be like, oh, yeah, no, we're going to have it be our little secret. I'm like, someone's going to find out. For sure. I'm like, or if you're trying to keep a secret like that, you can never drink again. Right. You can never drink again. It's going to come out. I do think, though, Tommy, you're right.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I think this is, it seems like this is going to bring them together. That's the only silver lining we got here.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
No, it said a lot about the partner and how he did go to his family and go to bat for her and not only was he like, they're being shitty, he wants to go no contact, this person stands on business and I really like that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They were playing Game of Thrones over there.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, they were fucking stonising. What's the fucking family?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Lannistering, big time Lannister behavior.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Okay, our next story. Would I be the asshole if I deleted my friend's engagement pictures? So I will be honest, I've read this story before.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's a good one. I got married last fall. Where I live, fall means the trees are changing colors, so the wedding pictures are to die for. We didn't have a huge budget, so a friend of mine asked her friend if she could do it for me. I had seen some of her work and she is really talented, plus she is a total sweetheart.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The only thing is, for what she charges, and since it's more of a hobby, you'll get your pictures when you'll get them. Well, I got them, and now I need to know if what I'm about to do falls in asshole territory. A few days after my wedding, my friend announced to me that she was engaged. I was ecstatic and wanted to know everything. Turns out she got engaged at my wedding.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
My brain gets out of its vegetative state and I remember her table being way too excited at some point, but I blamed the alcohol. I wasn't thrilled about it, realizing then that she had basically not only gotten engaged at my wedding, but instead of hiding it and announcing it later, she announced it to our friends during the party.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's so confusing. It felt like all the other friends knew what the plan was, except for OP. Right, why didn't the other two let her know?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was a tough pill to swallow, but I figured whatever, it's not like I even realized what was happening. We did have a discussion about it, and she didn't seem to understand why I was upset until I put it into perspective for her, asking her how she would feel if I made a big announcement at her wedding, taking the attention away from her big moment.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
In my friend's mind, it's no longer the day I got married, it's now also the day she got engaged.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
On my dime. We eventually turned the page and I thought it was over. Well, I've sort of been friends with my photographer since the wedding because of common interests. At some point, she point blank told me that now that we are closer, she feels comfortable asking me what to do with my friend's pictures because it makes her really uncomfortable.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
During the evening, the wedding party took a break to go change and during that time, my photographer was taking pictures of foliage at the venue. My friend apparently asked her to take pictures of her and her boyfriend. She didn't really see a problem since we weren't back yet and they were guests. That's until she realized they were engagement pictures.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Some poses just don't leave room for interpretation. So when she asked me what to do, that, you know, accidents happen, I told her to just put them in a separate folder. Ever since, I've been thinking, what am I going to do with that folder? My friend has been asking about my wedding pictures periodically, but hasn't asked about her pictures specifically.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was easy when I didn't have them, but now I do. I've had them since April and I know she will eventually come out of hiding now that COVID restrictions are loosened. I want to delete the folders since they are my property anyway, but I don't want to be a major asshole either. Before you say it, I do realize I haven't forgiven her at all like I initially thought.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I should point out this is in 2020. This is like summer of 2020. So to recap, the friend got engaged at her wedding. Announced it to a bunch of friends at the wedding. And then after getting engaged, found the wedding photographer and asked for photos and they got like.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
and just to try this on somebody feels so weird. Chevalry exists in terms of wanting to extend your hand or kindnesses or things as a form of politeness, but there's dynamics at play here. Not just any guy is gonna have the knowledge or the means to do these things at such a young age. This kid doesn't have a full-time job, but he's like, yeah. I got it, guys.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, there's a lot of issues I have with that. So like obviously some friend dynamics are fine when an engagement happens at a wedding. But like usually there's communication and just some kind of Some kind of understanding there. But also this photographer was hired for a service and this friend is taking them away from that service to do something else that is also very expensive.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Like getting engagement photos, that can be expensive. That's a whole other job. It's so tough though also because it's one thing that, it's just interesting, I'm playing devil's advocate in my own mind is like, if it didn't affect the bride's day on the day, that's a good thing. It didn't take away from her in her own mind until she knew what had happened.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But the fact that she wasn't told what happened and attention was taken from her day regardless is interesting.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's not tracking because she's trying to play it off like, oh yeah, I don't see what the big deal is, but she is not being fully out in the open with her. So it's like you are aware it's shitty. You are aware it's shitty and you're trying to pass it off and have your cake and eat it too in this situation.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I... No, yeah, you're right, because she's asked this photographer for these engagement photos and then has not talked to the bride about them. The photographer brought it up. Yeah. So, very interesting.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So, in my friend's mind, it's no longer the day I got married. It's now also the day she got engaged. That's such a shitty thing to say to someone about their wedding day.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's like, hey, the wedding day's about me, and your friend going like, well now, actually it's not. It's about you and me.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Actually, that wasn't your wedding day. You've lost your mind. That was the day I got engaged. So there's what happened, and her friend's shitty for what she did. She now has these engagement photos, and it's like, what do you do with them? Even the photographer was like, hey, accidents happen. The friend has not asked for the photos yet. I will say, after having had like,
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
kind of wedding day photos done, you don't get them all back.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
No, no, you actually specifically get like a few samples.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then you like weeks later get the dump.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So there would be plausible deniability that she never even got those photos because the wedding photographer I think very easily would have been like, oh well, these are just photos. I've sent my selects. Like these are my selects, you're not gonna, you don't need those, those are just two people randomly during a time of the day.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So it would have been possible for the wedding photographer to not even.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Do it, but now she has him. She has to decide what she wants to do.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, to me it feels like it's kind of continuing the sneaky cycle.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But I honestly, if I was in this person's shoes, I would have texted this friend and be like, hey, my photographer just told me that like you had ask them to go and take engagement photos. I feel like you aren't being transparent with me about how you handled this and I actually really don't appreciate that you did this.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I have these photos and I am hesitant to give them to you because now I really feel like you are being a bad friend. And then having the, because you're either gonna continue to be sneaky and not be friends anymore, that is a path to do. Or if you're clearly not forgiving this person, just talk about it. Uncomfortable conversations suck.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But. You know, I think that sums up a lot of like my perspective, my personal individual perspective on so many situations is not, I don't wanna just like get back at someone just to get back at them. What I want in a situation like this, if a friend did this to me, what I would want, all I would want is for them to recognize that it was wrong.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The kid is 18. He's the youngest of them all, it sounds like.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And to be like, oh, I want you to change as a person. And not do this again. And if I really could come to a place where I believed that and they were upfront and honest, I'd then be like, all right. I would personally be like, all right, here's the photos. But I want you to know you hurt me. I want you to know this sucks.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And I want you to know if you show this type of behavior ever again, I will have to then... Unless I look back and realize in that friendship that that pattern's been going back further. Right. Where I go, okay, no, you've shown this. But if this is a one-time deal, now that's me personally.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I think if I heard about this story from anyone, it's something where any of the options they choose, I'd be like, okay, and that's what you did. I wouldn't judge someone. I mean, I don't know how I would feel. It depends on the individual situations. If someone was like, and I deleted the photos, I'd be like, oh damn. Okay.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They were literally bullying this boy. They're 19 and 20, and he was younger than all of them. They're expecting this kid who's younger than all of them to pay for all of their meals at Chili's?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Or if they were like, and I gave her the photos and that's what happened, I'd be like, okay.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's really like, that's like the highest high road is giving her the photos.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then even one. But there's also protecting yourself from someone who is gonna take advantage of you.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And saying like, hey, this hurt my feelings. Hope it was worth it to you. Right.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The question I am always left with, because this happens so much, is I'm like, I don't understand the perspective of wanting to propose at a wedding.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Do you think the friend knew her partner was going to propose to her? Like maybe that part was out of her control and then she just kind of wanted to ride the wave, you know, the friend? What? Like this friend got proposed to at the wedding, right? Maybe she didn't know he was gonna do it that day.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Put some sauce on it. I'm here with Tommy and Courtney.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Oh, she's like, yeah, I'm proposed to. Oh my god, this is so great. Like, ah, don't wanna take away from the wedding day, but let's still ride this wave and still have our own joy here. And then trying to like, you know, damage control later.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I don't know, I'm just saying whoever proposed to her, I just don't understand wanting to propose at a wedding. I've never understood it. You're taking away from their day, but you're taking away from your day.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Exactly. There's no story to it. It's just always confused me, and I think that's, it's hard for me to think about the whole situation, because I'm always just so confused by that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Comments, not the asshole, she not only got engaged at your wedding, but also got the photographer you paid for wedding photos, not cheap, to do their photos. Yikes, I wouldn't blame you for just deleting those photos. You could get her to pay the photographer for those specific photos, but not the asshole either way in my opinion.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
There's another option as being like, hey, the photographer recognized those, I told the photographer that you guys just got engaged and those are technically engagement photos. She charges a lot for that. You might need to ask for payment for that. Not the asshole, she gets engaged and takes attention away from the newlyweds. She then has a full engagement shoot on your dime.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Delete them and tell her that you've deleted pictures that had nothing to do with you and your husband. Lastly, someone said, more and more I've been hearing of people getting engaged at others' weddings. It just reassures me that I would not want that shit at mine. The thought of it just pisses me off. Anyways, not the asshole.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I mean, I think, like, I would reserve the, like, getting engaged at weddings as, like, it depends on the dynamics of everybody involved, like, for sure.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, but, yeah, it's weird. It's the sneakiness, I like that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's the sneaky. It's disrespectful. Yeah. It's just ultimately disrespectful. Final story. Comes from best of Redditor updates.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Okay, so you're saying there's an update.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
No. It's a 24-year-old woman. My best friend, who's 23, a 23-year-old woman, did something horrible at a mutual family friend's wedding and blamed it on my younger sister, who's 19. I am considering cutting ties with her, but am having a hard time. Okay. Hi Reddit, this is a bit of an unusual situation but I'll try to explain it as best I can.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The story involves myself, 24 year old woman, my best friend Caroline, 23 year old woman, and my younger sister Nicola, 19 year old woman, and our mutual friend slash groomsman Daniel who's 28. Using real names because I know Caroline doesn't use Reddit and if anyone who witnessed this happens to see this I'd love for them to get the actual facts of the story.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So over the weekend, a very good family friend of both my family and Caroline's family was getting married. Caroline and I have been best friends for years. We met when we were toddlers. Our moms are best friends. Our sisters are friends, et cetera. You get the picture. We knew that both of our families would be invited to this wedding, and we were both looking forward to it for months.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, some people like to get a nice meal, and a date can be the way, but it's like, we're not about to have three people expect one person. That's crazy. When you're on a date, you wanna see how we give and take in an experience like that, but this is so, it's so weird. Spending $125 at Chili's, something is wrong.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's important to note that Caroline's family and my family have a ton of mutual friends, and this was going to be a very large wedding. Guest count was in the 500s.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's a carnival, not a wedding.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Oh my God. Everything was going fine and dandy until Caroline got completely wasted. She kept talking to me about how hot one of the groomsmen, Daniel, was and how she'd had a crush on him for years, but he showed no interest. This was probably because he was in a serious relationship and had been dating his current girlfriend for six years.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Sometimes I can't help but go, bah. The girlfriend decided not to attend this wedding because she didn't know the bride and groom very well and because Daniel would be a groomsman, she wouldn't see him very much anyway. Fast forward a couple hours and Caroline is hanging all over Daniel. She's constantly asking him to dance with her, get her drinks from the open bar, et cetera.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
She's point blank throwing herself at him and it was embarrassing and painful to watch. I tried intervening a couple times to get her off of him, but she snapped at me, and at that point, I decided that it wasn't my problem. Furthermore, Daniel wasn't completely pushing her away. He looked like he had a few drinks in him as well, and seemed somewhat interested in Caroline.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I decided that if he didn't care, I certainly wasn't going to. If he wanted to throw his relationship away, it was none of my concern. I tried. I didn't witness this next part, but by the end of the night, Caroline and Daniel were having sex in a different room of the hall. Yes, it escalated quickly.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
To their misfortune, someone, I'm not sure who, just that it was someone's mom who knew Daniel and his girlfriend, but didn't know Caroline, walked in on them, and for some reason, Caroline told this woman that she was Nicola, my sister. I don't know if she was embarrassed or drunk or what, but she purposely identified herself as Nicola, so Caroline herself would not be in trouble. What?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Hi. Hi. I would put you in my MySpace top eight.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Word quickly spread that Daniel and Nicola were caught having sex and Nicola was mortified. People were talking about how disrespectful, home wrecking, rude, slutty Nicola was. I honestly can't even blame them. Had I not known better, I would be thinking the same things. On top of that, Caroline had gone around actually telling other people that it was Nicola and confirming the rumor she started.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The bride and groom were pissed. Everyone was talking badly about my sister and Caroline seemed to not care. In fact, when I confronted her about the situation at the wedding, she straight up denied it. Had Daniel not confirmed that it was Caroline he was hooking up with and not Nicola, I might have even believed her.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
The next day, Caroline texted Nicola a half-hearted apology about the whole thing, saying she was so drunk and didn't know what she was doing. The text included lots of lols and ha-has, so I'm not sure how seriously Caroline is taking the situation. She doesn't seem to realize how mortified Nicola is. Nicola genuinely thinks that her life is ruined.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We live in a very tight-knit community, and a lot of people have heard the false version of what went down. I'm at odds with what to do. Up until this point, Caroline has been a very good friend to both I and Nicola. I'm just not sure if I can forgive her for this, especially considering her lack of consciousness about how bad the situation really is.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Should I dump her or should I give her another chance? Our friendship will be different regardless. My family sees Caroline in a completely different light now. So even if I forgave her, we wouldn't be able to do a lot of the same things we used to, hang out at my house, do things with my family, et cetera. What should I do, Reddit? Reddit, I need your help.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That is so messed up. Because you know what she did? She blamed it on Nicola. Nicola is 19. Mr. Daniel, whatever, is 28. That's a gap. And also, like, and throwing her into that situation and all of these people ganging up on her being a homewrecker. She's 19.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's also true. I mean, it's been a long time since I've eaten at Chili's. I don't know how expensive it is, but it just fully feels like, you're right, bullying. Like, this was an excuse to bully, excuse to take advantage of someone. I can't believe, I think the dad agreed just because he didn't want to deal with it. That's my theory, is he's just like, oh, God.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Bro, it's so hard to be under 21 at a wedding full of cults. And to have that thrown at you, this was like some Shakespearean type of shit. Literally, you're having sex, someone catches you and you go, it was Nicola! And everyone's like, oh! The way that everyone just believed it suddenly.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I mean, there's no reason not to believe what you're being told, right?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But also believed it, and then it just seemed like everything was just on Nicola and not on the 28-year-old guy who's in a six-year-old relationship. And that's on the system.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, that's the system, baby. That's the system. Be nicer to women.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Don't be her friend. That's fucking crazy.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
To throw Nicola under the bus? Like, that's so mean.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That puts her in a really dangerous position. Like, that was really dangerous. That was really unfair. That's going to have long-lasting effects. And the fact that her apology included, like, lols and ha-ha's.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
No, that's your calling up every single person at that wedding and telling them.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's why she got away with it, too. Because a person caught them and saw them. And then somehow this rumor fully succeeded. And she was running around saying it. That's... Well, it's 500 people.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's impossible to keep anything... 500 people drinking. I'm sure there was a carnival about. Maybe a Ferris wheel. Elephant? Hard to keep wrangling rumors.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I forgot there was 5,000 people at this one.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, we could have an atonement situation going on here.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Atonement, it's a book and a movie that's really good.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But it's kind of, it's an accusation book. A lie, a false accusation. A book and a movie. That has tragic consequences.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Okay. Comments, if Caroline wants to continue your friendship she needs to make this right and tell everyone that she lied. If she doesn't, then I would personally cut ties. Being drunk is no excuse for what she did. I think Nicola needs to stand up for herself as well. She should be very clear with people that she would never do something like that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Tell her not to let someone else ruin her reputation. If Caroline won't set the record straight, Nicola, you and your family can. OP responds, thanks for the suggestion. I haven't actually considered asking Caroline to go public and own up to this situation. I think I'll do this. I actually have no idea how she will react.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Caroline is usually a decently moral person, but she also hates confrontation. My family and I have been trying to set the record straight, but it's really hard to undo a rumor that is spread around to so many people, a lot of which we are not that close with, mostly because nobody actually wants to talk about it to us directly.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then the sweet uncle. Cool uncle alert. Hashtag cool uncle. Cool uncle DM. Cool uncle. Copyright Inc. dot co. Very cool uncle.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Most of the talk goes on behind our backs, but of course we know it's happening. Someone else said, Daniel's caught. Everyone knows he had sex. Can he just clear up which girl it is he fucked? Regardless, I think your friendship is probably over. I'd go ahead and show those texts and tell your story. This is so humiliating for your innocent sister.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Someone else said, people take a lot of pictures at weddings. Any chance there are pictures of Caroline hanging all over Daniel?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, like, that's the proof. Like, she herself had to pull Caroline off of this guy, and she snapped at her. Like, it's all there.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It probably was obvious to a lot of people, but there's 500 people. Yeah. So there's a lot of people who just weren't seeing things. It's just so damaging. This could only happen at a 500 person. Exactly. Only, only. Like, if you have under 100 people, everyone's going to be like, no, we... We all saw it.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We all know who's who here. And it's just that kind of a thing, being a rumor thrown on a girl can be life ruining. There are women who have had to change schools because of rumors like that that just get blown out of proportion. It's really damaging.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Being 19 sucks. Yeah. Like, it sucks. And to have that. And also at 19, you kind of like, I don't know, a lot of people just already are going through the struggle of like hating themselves. Yeah, who am I? And you have a bunch of people now going, I can't believe you did this horrible thing.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And even if you know you're innocent, there's a psychological aspect of enough people telling you you did something. Like, did I? You're going to feel like you did it, even if you didn't. Okay, update. Let's go, please. Please. Caroline has to get what's coming to her, right? But do we think it's photos? Do we think it's witness testimony? Stones thrown at her.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Do we think Daniel throws her under the bus?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
No, Daniel's gonna do anything. He hasn't done anything, he won't do anything. Daniel's gonna be a waste of time. I think we know that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I think someone saw the Reddit post and gave an honest account of the experience.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Because remember, she didn't change names or anything.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I hope, I hope. It's just something.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Okay. So about a week and a half ago, Caroline casually called me and asked to sleep over. She wanted to attend an event downtown, and my place was much closer to the event than hers. At this point, it became very clear that Caroline had no idea anybody was upset with her, despite the fact that Nicola and I hadn't spoken with her since the wedding.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, well, yeah, they invited him there and then expect him to pay the bill. The only time I think the expectation can be there is, I don't even know if there is a time, but unless I invited you guys, I was like, hey, come to Chili's. No, not even then.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I told Caroline that I didn't think her sleeping over was a good idea, and when she had asked why, I brought up what happened at the wedding. She laughed and said Nicola needed to grow up and get over it, and it really seemed like she expected me to agree and laugh along with her. Well, Reddit, I took your advice and let her have it.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I told her how selfish and inconsiderate she was, and if it truly was no big deal, then she should have no problem taking full responsibility for her actions and publicly acknowledging that she was the one who hooked up with Daniel and not Nicola. I told her she needed to make things right because Nicola was still mortified over something she didn't do.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
At the end of the phone call, I gave her an ultimatum. Post an apology on Facebook and spill the beans about what actually happened or our friendship was over, thanks to the Redditor who suggested this. To my complete and utter surprise, she did it.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I thought it would make me feel better, but people were actually commenting on her Facebook status, commending her bravery and the fact that she did the right thing. I was super annoyed because of course she would never have done this had I not forced her to, but at the end of the day, Nicola is happy and her name is in the clear. Oh, and an update on Daniel and his girlfriend.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
According to his Instagram, they are happily together. Whether or not she knows about Caroline, I don't know and I don't care, not my train wreck. How does she not know? It's public everywhere.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Oh, my God. There's 500 people there.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Hey man, really awesome that you're owning up. Thanks for coming clean about that. All right, let's move on.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Well, Nicola's name has been cleared though.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, that's not the end. That's not the update I was expecting.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's very straightforward and whatever. It is Facebook after all.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I guess Facebook is the way to do it. I was like, how do you publicly clear someone's name? I was like, is she going to go door to door campaigning like a congressperson? What do you do in a city like that?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's Facebook. You could post an AI image of whatever and people would be like, this is real.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
See, it was Nicola. Yeah, exactly.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's just the most awful AI image. Well... All right.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I still don't think I'd... That's hard to be friends with someone after they did that.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
These are some wild friends that people have out there.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I mean, because it's one thing to... do that, do the quote unquote, the home wrecking, but also like, OP was trying to get her out of that situation, trying to pull her away from it, and this friend snapped at her. Like, whoa! People's masks are slipping, you know? That's kind of when you can see real shit. Like, that's just on the smallest scale.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And then she goes on to do bigger and bigger things. Like, I just don't see any room to forgive someone like that, in my opinion.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And I'm gonna cover it. It has to be like, no. Then you expect it. But otherwise, putting it on one person is always kind of a douche move.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Good. We're not mad. We're just disappointed.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We're gonna put this all in the pizza to joy ratio.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So now do we have to eat a bunch of pizza to feel better about this episode?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I think that's what the takeaway was from that story. I think that is literally the takeaway.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Well, thank you both for being here. Thank you for having. And thank you all for watching. I hope you don't have any friends like this.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, and Shane, thanks for being my best friend.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Oh, you two are best friends. Thank you.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Let us know what other themes and subreddits you want to see on this show. Let us know your thoughts and opinions on these stories that we've read today. And we'll see you next Saturday. Bye! Bye!
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Sometimes if I want to hang out with somebody, I'll be like, I'll buy you a meal if you hang out with me.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's a trade offer, yeah. I have your quality time, you have a meal.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
There's a lot of comments. I'm a mom to both girls and a boy who are around your age. This is so wrong of your so-called friends and your dad. I'd be so angry if this happened to my son. At this age, everyone should pay their own way unless otherwise stated. Yeah, at that age, everyone's fucking broke. Nobody has money when they're 20.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Someone said, wow, I cannot believe your dad was fine with this situation. You did the right thing and your friends were classless. Yeah. Lastly, someone said, your friends and your dad are completely assholes. John was under no obligation to pay for anyone but himself. To assume he is going to pay for everyone is just beyond me. Glad you had the class to stay and help with the bill.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I would have told the waitress to split it four ways after those two girls walked out, then give the restaurant their information so they can be responsible for their own meals. Opie responded, I was considering many options, but my main thing was I didn't want to make a giant scene in front of someone I don't even know. Easier options first, then harder ones.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
In reality, this probably would have been the smarter option. Yeah, the fact that they got up and left too. Then I'm like, I'm really like, this is, you didn't assume that he was actually going to pay. You dine and dashed. I think they effectively dine and dashed and tried to pin it on someone else.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We can kind of gauge as we read these stories how much we think these friendships are going to last. Okay. How badly these friends have betrayed each other, perhaps. I don't know. We'll get a sense of it. It's Reddit. These friendships can't be doing too hot.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So sad that, I mean, those friends are fortunate that OP wasn't like, okay, well now you owe my uncle money.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Those are the types of people at that age, or at any age, but that you do need to cut off because they're gonna get you in trouble. Right, yeah. They're going to get you in trouble. Small update. Me and John still play Fortnite and have been dabbling in Overwatch as well. It's getting serious. He's actually a very funny guy who is open about his feelings.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
If we continue to connect this way, I may ask him to go on a proper date. Through some casual friends, I learned that Alex and Charlie think I'm overreacting and the same BS as before, that John should have wanted to impress us and that John should have had more money knowing he was going out to eat with three girls, shocker.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's to expect someone to want to impress you. There may have been a reality where if a guy wants to impress you, he will offer to do things. They will go out of their way to do it. This random guy gets invited to dinner.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It's sad because I wonder where young people are getting their information from. I know. Because I think that type of mindset is being spread around a lot. Well, glad she got away from them. And she's playing Overwatch. With her love of her life. With the love of her life.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I hope they get a victory royale in the game and with each other.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
All right, moving on. Our next story comes from Relationship Advice. This is a 25-year-old woman. My best friend, a 24-year-old man, proposed to me. I'm confused and mortified. Where can we go from here? So they're friends. To the altar?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Yeah, I was gonna say to the Vegas temple.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
They could get a victory way out. Oh no! In white. Frankly, I'm still in shock that this happened, so this might be all over the place. Bear with me, all fake names, et cetera. Jordan and I met in university two years ago. We both started at the same time, and because of our ages, we were both considered mature students.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So we quickly became firm friends as we shared a dorm, and we'd joke around together about us being old enough to be considered mature in our early 20s. We weren't on the same course, but given we lived together, we would hang out pretty much all the time whenever we didn't have a lecture. We joined a bunch of societies together, went drinking every weekend together, etc.,
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It was a pretty sweet gig because it meant we were at least never alone. Obviously, we made other friends, both alone and together, but we were always each other's number ones at the end of the day. And while we haven't hung out constantly, we decided to make plans to visit each other's hometowns because we're from very starkly different places. Today, we went to mine. Mine is a big central city.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Oh, yeah. On one to ten of how good their friendship is. Yeah. Yep. How good friend? How good friend is. How good friend. Our first story, this title, very fun. True off my chest, I broke off from a friend group I've known for seven years over a tab at Chili's. It's happened to us all. Chili's is the real test.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
This morning we went there and were wandering down the streets doing some sightseeing because he's never been. There's typically a lot of street sellers here trying to sell you everything from hot dogs to fluffy Pokemon hats. I decided I wanted to get a caricature done. I've never had one and I thought it would be funny to get and hang over my bed when we got back for term.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I asked Jordan if he wanted to get in and he refused. No worries, so I sat down to get it done. They don't take very long, five to 10-ish minutes, so I stayed looking straightforward at the artist the entire time. He finished the character and I loved it, so obviously I turned to show it properly to Jordan. When I turned though, I literally don't even know what to say.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He's down on one knee holding up a ring box. I don't even really know what he said, if he did the whole proposal speech thing because I was so confused, I was barely paying attention. Remember again, this is a super busy tourist city, so this has drawn a mini crowd now coming over to cheer us on. I couldn't help but burst into laughter.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
To be honest, I thought this was some kind of odd prank thing. We never have been prankster types or whatever, but I couldn't come up with a reasonable explanation. So I just laughed and laughed and laughed until I looked at Jordan and he looked genuinely heartbroken. So obviously I asked him something along the lines of, you're not being serious. This is the only thing I remember him saying.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He shut the box, stood up, shrugged, and said, I guess not anymore, and walked off. This left me standing pretty awkwardly in this gathered crowd of people, a lot of who were giving me dirty looks, which made me incredibly uncomfortable. The plan was to meet back up at a hotel where we had booked rooms next door to one another. So I figured that's where he's going and head back that way.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
But he's not there, so I wait and I wait, and he still doesn't return. I texted him out of concern. This was at 1.15 p.m. It's currently 6.20 p.m. as I'm writing this, just asking if he's okay.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
He responds with a long message back, which I would post because it's an odd read, but I won't out of respect for his privacy, in which he basically accuses me of leading him on, asking why I didn't break up with him sooner, saying I had publicly humiliated him and that he thought I loved him the same way and that he felt our relationship was strong enough to consider taking the next step.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I literally have got no idea where in the world he's got this idea from. The closest we've ever physically been is a hug, hello, and goodbye. I've never even jokingly flirted with him. For exactly this reason, I've had too many friendships collapse because they can't tell the difference between serious interest and joking banter in friendships, so I've been extra careful not to.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
We've never kissed, never been on a date, never had sex. I do not find him physically attractive, and I wouldn't wanna be in a relationship with him. I don't understand where on earth he's got this idea that we are. This isn't something he's ever brought up before and I'm genuinely bewildered. He hasn't returned to the hotel yet.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I periodically knock to check and I've been listening for him walking up the hallway or something. Nothing. I haven't responded to his long paragraph because honestly, I don't know how to. I'm just so stunned and taken aback that I genuinely have no idea where to go from here or what to do.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
I haven't told anyone I know in person yet, mostly because I don't want to bring this up to people who know Jordan. So here I am turning to strangers on Reddit instead. What in the world do I do?
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Some people love it, but if he had talked to her and known.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Every step of the way is an event.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
So many talks that have needed to happen first.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It always feels like such a silly conversation to be like, so are we boyfriend, girlfriend? But it is an important step to be like, hey, so are we exclusively dating? There's so many steps that they never discussed, but in his head, he thought they were.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
Chili's makes us or breaks us all.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
It reminds me of a story we read a while back where it was two people who were best friends for a very long time and suddenly this guy just started telling everybody that they were dating and then he just tried to like kiss her one day and she was so confused and he was like, yeah, so you're my girlfriend now. Like claiming her.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
That's what they always say. They stack up at Chili's. They do. I, a 20-year-old woman, have been friends with these two girls, Charlie, who's 20, and Alex, who's 19. We have been very close since middle school and get along and fangirl over the same anime, K-pop bands, artists, et cetera. One day we decided to go to our favorite spot, Chili's.
Smosh Reads Reddit Stories
Friend Or Foe? | Reading Reddit Stories
And it was like, this doesn't sound like the same situation but I just don't understand how Like, that is so far from a relationship if you've been operating this entire time in your own mind and not communicating anything with the other person. There is no relationship there. Yeah. In reality and in each other's minds. Like, at all.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yes, I would say we average about the same as before I discovered her cheating. Okay. It took a long time for us to start having sex again, though. Did you go to couples counseling? Two sessions. Done. Graduated. Two sessions. That dude didn't like me very much. Smiley face. She went to a therapist by herself for a while. Pretty much no one knows about all this, except you.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
So it's nice to write it out. Have a nice day. I'm shocked that I could hear a story that starts with, my partner cheated on me. And I could end the story by hating you more, I think. Like, holy shit, man.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I understand in after like infidelity of like, there's a lot to gain back trust. The start of this, I was all like, yes, correct. Like, oh, you're going to set up some rules, some boundaries.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Several of these had nothing to do really with, this is all about gaining back trust.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Right, right. I don't, the way they're going about this is all wrong, right? Absolutely. And I do think, I do think, Conquering it like if you're gonna try to move past infidelity, which is extremely hard, right? I do think you need a professional involved.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Absolutely I would think I would need one you know different than if you're writing out a post up like you need a lawyer involved if you're trying to set up boundaries for how your Relationship can heal from one of the most damaging things that can happen to it You need a relationship expert who is outside of your relationship.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I think this type of humor can be funny once in a while, and I understand that it's a part of the culture of people our age. However, her vocabulary is full of just straight up brain rot to the point where it doesn't feel like just a joke anymore. Everything was endearing during the honeymoon phase, so I used to frequently joke back to her.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, and both parties need to also, like, be fully honest and agree that this is going to work. This does not seem, like, this seems horrible.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I don't love so many aspects of this, right? I don't love, well, for one, it's open on my end. I've used it three times. I don't trust this person. This is a unreliable narrator. I don't love that he's like two sessions, in regards to the counselor, two sessions, that dude didn't like me very much, smiley face. I'm like, you're a villain.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And like, I fully understand. I understand the suspicion and when you're in a place of distrust, what you'll go to. He put a tracker on her car. There's just, the lengths this guy is immediately going to. Yes. is these are red flags.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And I think there are times in life when people get the excuse when someone does something wrong and they definitely did something wrong, but that doesn't give you permission to be a monster and be like, well, I'm allowed to because this person wronged me. It's like, okay, people can wrong you. You still need to be like, What's your end goal here? Is kind of where I'm thinking.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, like I understand how some people go like, well, this is how it'll equal out. It's like, but you're, just break up.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Break up, like it's done.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Comments, another question, do you really see yourself staying in this marriage? OP responded, well, I've stayed so far, smiling face.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, that has 246 down votes. So the audience does not like him. Good. Hard to do. Like, if you get cheated on, it's easy to write a post out where people would be like, on your side. Someone said, sounds miserable. I would 1000% rather be alone than this circus. You're cracked, man. Got all this figured out to what? Grow old with someone that doesn't love you and you have to police? Fuck that.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
OP responded, I don't really have to do anything, to be honest. It's not like I sit and watch her location all day. And I can always get a divorce if I feel like it. 159 down votes. Oh.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Someone said, 91 downvotes. Someone replied to that saying, We have a small edit slash update here. Yeah, yeah. I know our lives seem dark and depressing based on the above. I get it. I'm a horrible person. But we also go on dates, travel the world, buy each other flowers, cuddle, have friends, play sports, et cetera, et cetera. Without evil, there can be no good.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
But now it's hard to find Sigma or Hawk Tua attractive, you know? It has gotten to the point where I cannot have a single conversation with her, in person or over text, where this type of language is not involved. I know this sounds so idiotic, but it genuinely turns me off when I try to have a normal, mature conversation, but she responds with just brain rot.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
So it must be good to be evil sometimes. Satan.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
By the way, this is Satan from South Park.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I hope this is fake. I hope this is a guy who just loves to, like, rile people up. I hope it's rage bait. Yeah. It could be a person who was cheated on and is now living a fantasy online of all this stuff.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
But I also know, like... Unfortunately, in relationships, things get really unbalanced, really toxic stuff happens, and this is a very unique.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I'm so curious what's going on in this relationship before she was cheating and stuff. There, you know, there's not really, I'm not gonna say like there's an excuse for cheating, but like this could be a very bad relationship where she is scared and doesn't feel she can get out.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Our next story comes from Am I the Asshole? Am I the asshole for embarrassing my husband after he kept pretending not to hear me? Uh-oh. Uh-oh. My husband, who's 34, has this super annoying habit. If he's on his phone watching TV or just not in the mood to respond, he pretends he doesn't hear me.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I'll ask him something and he'll just sit there, completely ignoring me, even though I know he can hear me. I've called him out on it before and he always says, oh, I just didn't hear you. But it happens way too often to be accidental. So last weekend we were at a family gathering and it happened again.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I was trying to get his attention while he was scrolling on his phone and he completely ignored me. I even said his name three times, nothing. So instead of getting mad, I decided to test something. I casually said, hey babe, there's cake in the kitchen. Suddenly he snapped his head up and went, what kind of cake? I just looked at him and said, oh, so you can hear me.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
His mom laughed, his sister smirked, and my husband turned red and got all huffy, saying I was trying to embarrass him on purpose. Now he's annoyed and says I was being passive aggressive instead of just talking to him about it privately. I told him I've tried talking to him about it, and he always denies doing it. Am I the asshole for calling him out like that in front of his family?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
This is sitcom level. Man, yeah. She's not the asshole. No, not a chance. Come on.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
The thing is, she can be serious when needed, and occasionally we'll have a good conversation. These are the moments that I look forward to, where I don't feel like I'm talking to an immature high school boy stuck in the body of an attractive woman. It's beginning to affect our sex life, as I'm finding it hard to get turned on by her.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Okay. Look, I'm not gonna defend this guy, but I will say. But I will say. Sometimes chicks are annoying.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I was going to say, there are words no different than when you're near a dog and you say, treat or walk, and the dog's just like.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Like, there are some words. Like, yeah. Like, there are some words that someone, like, I have, like, in crowds, my hearing can kind of suck, but I could be in a crowd, and if I'll hear, like, a trigger word, like, out there, like, someone will mention a show I'm watching, or someone will just say something exciting, and I'll just be like, what? Like, oh, they're mentioning that thing I like.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I'm trying to think of an example, but I don't know.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
cross the room, someone will be like, yeah, Avenue Q. And you're like, what?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
It depends on how long they've been married and stuff. Like some people do really like when they're like invested on their phone, like they do kind of get in a trance.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
People get in an almost trance-like state. And so maybe their name, if he's used to her talking to him, he is unfortunately filtering it out. I don't think that's good. I think he should absolutely be more mindful of his partner. But I don't know. I don't know. I don't know this guy. I'd kind of have to see it happen.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Right after Big Bang Theory. Because I've definitely seen people get lost in a trance in their phone. And I've had it happen, where I'm talking to them and then I'm like, oh wait, they're not paying attention.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
She's beginning to notice my lack of enthusiasm and feels insecure about it. I feel guilty for feeling this way, as she shows me nothing but love and support. I love her so much, but this is the one thing that I cannot get over. I just don't know how to approach this subject with her because I don't want to hurt her feelings or make her feel self-conscious around me.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That's amazing. Brilliant. Yeah, I mean, it could be selective hearing. comments, you embarrassed me on purpose. No, I showed that you are purposely acting in a way that is detrimental to a relationship. That your family laughed at you shows that they all agree.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Someone else said, yep, the way the mom and sister reacted gave me the impression that they've been on the receiving end of this little habit of his too. So this was probably a case of catharsis by proxy for them. Someone said, do the same to him, especially when he's asking for sex. I think his hearing issues will get all cleared up.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Someone said, oh, my dear OP, do it again and again and again until he realizes that being dismissive and gaslighting you is not going to fly. OP said, I plan to do just that if he keeps this up. Has 1,000 upvotes. Yeah, I mean... sure, of this level. I think if she's really bothered by it and viewing it as a real disrespect, it's like, hey, you're not being present with me. I don't feel heard.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
This is one of those small issues that can grow into a bigger issue. Yeah, for real. You can play little games and make jokes and test him, or you can really be like, hey, this is a problem.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Because 60 minutes comes on after.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That's awesome.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Dateline, when she kills him.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Oh, yeah, for sure.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And then it gets late. You let it get later. You change channel. It's Nick at night. George Lopez comes on. Then it's funny again.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Oh, you get to Jerry Springer. Then it's fun again.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah. Then Sonic comes on. Yeah. Next story. Okay. Am I the asshole for charging my partner rent for living in the house I own? This is a marked WLW, woman loving woman. Fellow potential assholes, first, thanks for any honest advice you can provide. A bit of background, my girlfriend and I have been dating, not married, for three years.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
She's three years older than me and has two degrees, master's and bachelor's, from two prestigious universities, compared to my one bachelor's from a state college. We started dating at the tail end of our college careers, back when we both had mediocre jobs. When I began my first adult gig, I felt a shift in our relationship, as if she was envious about how quickly I was able to advance.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I always try to reassure her when she's insecure, so I feel terrible bringing this up to her for fear of making her more insecure. She's a genuinely sweet, funny person, but the brain rot has gotten to be just too much for an adult.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Needless to say, I ended up leveraging my contacts and helped her get a similar position with way better pay than what she was making before. As I continued advancing in my role, I was given significant salary bonuses. And when I brought in more money, she'd casually make remarks like, now you can be my sugar mama. Now you can pay for dinner. I can't wait to be a stay-at-home mom. And the kicker?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
You have to stop living in the mindset that what's yours is yours, and that includes finances. Every single time, I'd follow up with my own comments along the lines of, I'm not into that. Our relationship should be equal 50-50. Or maybe you can begin applying for promotions or positions that will pay more. Her classic answer? I like my job too much to do that.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Side note, in my opinion, that's a bullshit answer and shows me that she does not want to apply herself or put in her own work to get a better paying job. but you be the judge of that. Prior to the home purchase, we sat down and discussed where we both stood financially and how the home buying scenario would play out. We quickly realized a few things. One, she did not have a significant savings.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Two, she did not have the best credit. And three, she had overwhelming debt that I never knew about till this conversation. After moments of bickering, I made an executive decision to go in on the home by myself and mentioned that in doing so, she would have to pay me rent in exchange. She agreed. Fast forward to present day. The home was purchased and we moved in a week ago. It's in my name only.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Mortgage is $2,100 a month. I asked that she pay $900 in rent. Last night during our date, she expressed how frustrated she was at me, said that me asking her to pay rent caught her off guard, and that paying rent to live in our home irked her. I was shocked, felt instantly uncomfortable, then drew back on the conversation we had when she agreed to pay rent. In short, her rationale was this.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I don't believe in paying rent in a house I don't own. And we are partners. Maybe one day we will be life partners. It shouldn't have to be about money all the time. Ugh, help. I feel like she's manipulating the situation, but I also understand where she is coming from. Am I the asshole? Oh boy, that is complicated. That's so, okay, all right.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I should say the verdict is not the asshole, and I don't, I'm not immediately jumping to like, you're an asshole. Yeah. My take is kind of not like, you're the asshole or not the asshole, I'm like, that's one of those kind of decisions where I'm like, I understand where you're coming from, do you want this relationship to work out? Is this relationship gonna work out in this type?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
This is not a healthy environment.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Exactly. This is not, if you're in a situation where you don't trust your partner financially on that degree, you're not in a situation to be long-term partners.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yes, yes. She's paying her rent, and she's paying her close to half. If the mortgage payment is $2,100, she's paying damn near basically half of it. And yeah, over time, it's like, oh, thank you for buying, helping me buy this house.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
If the relationship doesn't work out, it's like, that's tough. All I'm seeing is that I'm like, I don't really care who's right and wrong. This is a situation where resentment is of course gonna get built up. Both ways. Both ways, absolutely. And so I'm just like, I don't think this is gonna work.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
OP's partner agreed to this situation, right? Of course they agreed. I think they're... I'm not sure how they are putting this, because it's like, OP is, this is buying her house. She is buying her house. The rent situation is, it's just a situation that's going to cause resentment.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Because over time, if she does, and then they break up, it's like, all right, I- It's my house, get out of your house. Now it is also rent, but it's like, I don't know, this is not a, this doesn't feel like a partnership. This feels like you're roommates now. And it's, I don't know, it's just, I don't know.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That way, like the girlfriend is saying the quiet part out loud. Like it's, there is a lot of like, Thank you.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I mean, there's been brain rot. You could argue there's been brain rot for a long time. Like as a millennial, it's like if back in the day after sex, you were like YOLO.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Right. And then you're like flanking everywhere.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah. Right. Sure.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
It's cringey. Yeah. And it's being, it sounds like she's being ironic.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
������此此此此此此此此此此此此此此此此此此此此此此此此此此此此此acacacacacac cle cle cle cle cle此此此此此此此此 Athlet此此此此此此此此此此此此此此此 Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac cle cleketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketaceniketacacacaceniacket
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
It's my sleep And now I'm starting to love a song so it's so much submissive and breathable, too I know our audience our audience has seen us joke about things ironically to a point where they are like, all right, we get it Yeah, we're done. Yeah, we're done here.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Thank you. Thank you. Also, I'm only admitting this because Reddit is anonymous, but I kind of want him to get his life together just a little bit before we get married. He doesn't have a stable job yet, and I don't want to be that naggy girlfriend, but I just want us to be financially stable before we tie the knot and possibly bring kids into the world.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
100%. And I understand it. And I think what he's really saying here is like, hey, I want you to be serious with me a little more. It sounds like she's joking all the time. And it's fun to joke. Like in a relationship, it's so great to be joking nonstop. But you need to have those moments where you genuinely connect. And it sounds like she handles being maybe uncomfortable with this.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
We could survive with my salary as a vet, but maybe it's selfish of me, but I would like to see him contribute a bit more to the pot as well so it doesn't feel like my money, but more our money.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That's incredible. You're also allowed to just be like, I'm just not ready yet. I don't feel ready to marry this person. But finances are an absolutely huge thing for people, and there's nothing wrong with that.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, that's completely fine.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
By being, yeah.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
For sure. She's doing the thing that happens a lot with these posts where she's like, I'm admitting this because this is an anonymous forum and I'm sharing all these honest thoughts. It's like, you need to share these honest thoughts with him. Like you do need to tell him like, these are my reasons why I'm not ready for marriage. Because if you don't share that, they might not change.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Exactly. Yeah, but it's an easy thing to just throw out there.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
You can't expect change if you're not talking about it. Well, I don't think it's horrible. No. But it's interesting. Yeah. Our next one, Am I the Asshole? My girlfriend got mad that I didn't defend her, but she was clearly in the wrong. These are stories where I'm like, dude. This is great.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Had dinner with my girlfriend and some friends last night, and it got awkward fast. One of my friends called her out on something pretty mild, basically just saying she was being kinda rude to the waiter. She had an attitude the whole night, rolling her eyes and being snappy. I wasn't about to jump in and defend that, so I just kinda sat there.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
After we left, she went off on me, saying I should have had her back no matter what. I told her I'm not gonna blindly defend someone when they're actually wrong, and now she's pissed, calling me disloyal. My take is, if you're being rude, you should own it, not expect people to cover for you. But she says partners should be a team no matter what. Am I the asshole for not backing her up?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Oh boy, I wasn't sure what being wrong was gonna mean, but being rude to a waiter is pretty rough.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
No, I can't stand someone being rude to a waiter, dude. That's like a, that's a... That's a red flag I can't get past.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That's fully what like a criminal in a movie says.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
They were.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
You're going to fight against two people. I hate that.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, so it's rough sometimes. I think this is extremely, not necessarily with brain rot, but just like the joking partner, right? I think it's a very common trope. I've heard about this a lot here in LA where there's a lot of entertainers, a lot of comedians who they use it as a crutch and even deep into the relationship, they just cannot be serious.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Most of the worst things that have ever happened in history come from a group of people who are like, well, we're not going to call each other out on anything that's wrong, and we're all going to stand in unison. Exactly. No, that is how bad things happen.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Also, she's talking about him being disloyal and not being a team member to him. It's like, you're not really being a team member when you're being an asshole in public, like next to your partner. You're being inconsiderate to the waiter. You're also being inconsiderate to just everyone. You're putting everyone in an awkward position.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
So fuck you.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Be on my boat. I'm going to sink it, but be on it. The verdict was not official, but majority says not the asshole. Okay. Yeah. Comments. Not the asshole. Supporting your partner doesn't mean blindly defending bad behavior. If she was being rude, it's reasonable not to take her side. A real partnership includes holding each other accountable, not just covering for each other no matter what.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
OP said, this is what I told her, but she doesn't seem to understand. Someone said, Yeah. I thought this situation was gonna be so different, but. Same. No, rude to a waiter is like stereotypical. It's instant. That's stereotypical asshole behavior, man. You can't do that.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Welcome to Smosh Reads Reddit Stories. I'm Shane, and today's theme, relationships. A classic one. And I'm joined with two people who love relationships. Angela and Tommy.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Well, damn.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I guess a debate now is, should he have called her out there at the table?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Or was he in the right to wait until they're in private?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I'm someone who's, I've said this, I'm afraid of confrontation, but I try to find ways of like, how can I like throw something out there without, like if I'm, I don't really think I've been in this situation before, but if I'm at a table with people and someone's being rude to a waiter, depends on how rude, right?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Like maybe just mild rudeness where I'm like, okay, they're just in a bad mood and they're treating everyone this way. But I might, I might try to throw something out of just like, oh man, it seems like they're understaffed today. Just throw something out there to be like, hey, let's consider other options here.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
They have to always be joking because that's how they handle anything.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, so I can't really fathom it. Right. If I was with someone who was, they'd be kind of a stranger to me.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And that's a little bit of a scarier situation.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Or an enjoyable experience. I've typically found that by just being chill and not doing what so many people do, things will work out. Yes. It's those little finger trap things, right? The more that you get upset, it's like, hey, things are not going to happen for you. It's the same with airports. When it's like, yeah, if you yell at them enough, maybe they'll get their spare airplane out.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
There's an old tweet that's like, oh, they keep their spare airplanes back there. If you yell at them, you yell at a low-level worker. You'll get a ticket for one of those. So one time, Courtney and I were at a restaurant, and we weren't being overtly nice. We were just chill. You were just being regular? When the waitress came by, we were just like, hey, yeah, for sure.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
She at one point was like, I'm so sorry. Things are taking so long. It's like, things were not taking long. But we were just like, oh yeah, it's no problem. We're just hanging out, like whatever. And I think there was a table clearly where they were being assholes. And maybe she was doing this as a means of, maybe, I don't know, in retrospect.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
But she kept coming by just being like, thank you guys so much for being so nice. And we kept being like, oh yeah, whatever, we're chilling. And then she, at one point, it was just like, what are you guys drinking? And we're just like, oh, we're drinking this. And then she literally just brings shots to us. And she's like, hey, let's do shots together.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And then later, and then she's like, you guys want dessert? And we're just like, oh, I think we're good. Like, whatever. And then she brings this huge fucking sundae to us. And we're just like, okay. Like, cool.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
What I'm saying is I wonder if the table that was being assholes was nearby enough that she was just like, hey! But we were just like, hey, we're just chilling. She kept thanking us. I'm like, we're not being nice. We're just treating you like a human. But that's rare. It's a bare minimum at this point.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, it's wild. Anyways, so our last story comes from Relationship Advice. This is written by, OP is a 21-year-old woman. That's RH. A little bit older. Drunkenly kissed a lifelong friend, 22-year-old man, at a party, and he told me he loved me. How do I approach this?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Drunkenly kissed. Drunkenly.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Okay, I mean the title is pretty much it. James and I have been friends since second grade. We have shared practically everything with each other. Been there for each other when no one else was. We tell each other I love you pretty often. He is my family. I don't drink much, ever, and James had begged me to come with him to his friend's apartment for drinks and games.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I decided to let loose, bad move on my part, and drank too much. He had a bit to drink as well, but not nearly as much. He saw I was warm and loopy, so he took me out for some fresh air. Honestly, this bit is pretty fuzzy. I just remember laughing and going to kiss his cheek like I would my mother, but it didn't end that way.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I missed and kind of hit the corner of his mouth, and he took that as an invitation to really kiss me. We kind of made out and... And then he told me he loved me and I told him I loved him too. Cause that's what we always say. But he responded with something like, no, like I am in love with you. And then I puked in a bush and he took me home. Still quite embarrassed. What a superstar!
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Still quite embarrassed about it. It has been a couple days and neither of us has brought it up. No! I am kind of confused about my feelings. I haven't really been in love before, but I do love him and have always considered him my person. Am I being obtuse? How can I bring the topic up with him because I do want to discuss it once I figure myself out? Okay.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Okay, so she's not like absolutely saying I'm not into him.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Don't do that, don't do that.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Man, these stories are just some real dilemmas.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah. So we don't have an update, but we do have an edit that they include. And they go, sorry for my overusage of brain rot, LOL. Make that nine times. I am referring to common terms frequently used on TikTok slash other social media platforms. Example, XYZ happened, her. You've got to be rizzing me. That's awful. I think he's dating Trevor.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And I think if I'm him, and I'm in the situation where you drink a little bit too much too, it sounds like, I would probably be like, yeah, don't take what I said. I drank way too much. That was a lot. I don't know what was coming over me, but let's take some time to think about this.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Because then you can kind of bring it back down to a grounded level and be like, would we want to hang out sometime? Do you want to go on a date sometime? Instead of being like, I'm in love with you, you can be like, hey, let's just see. Are we interested in what this is?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Comments. He took care of you when you were drunk. Maybe it could work. You're both young, but it could be the greatest thing for you both. Good luck. OP said, it feels like a lot to put on the line for maybe, so I'm struggling with that, but thanks for your support. Someone said, he almost guaranteed has had a crush on you for a long time, but sounds scared to say it.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
You sound unsure, but maybe open. What I can say from my own perspective is give it a try. The friendship likely won't last if there is a romance stewing and one of you will end up resenting the other or getting jealous when they start dating other people and the friendship will fizzle out or become a shell of what it is now.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
On the other hand, you may get a relationship with someone you already know and trust if you try to go for the romance. OP responded, I am slowly realizing that I am at the point of no return. This perspective is genuinely helpful. Makes me feel a little less dread. Someone said, I say you guys do a real kiss sober. You'll know if it's there or not. It most likely is for him.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I can tell you that by just being a dude and what you wrote. See if it is for you. If it is, good luck. If it isn't, be honest with him and hopefully you can make the friendship work and he can move on and stop wondering. And my advice is based on only if you've wondered about it yourself.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
If you 100%, without a shred of a doubt, know you are only into him as a friend and wouldn't want anything more, don't do what I said. If you've wondered but have been afraid to ruin the friendship, do what I said. Y'all gotta know or not, life's too fucking short. OP said, It affects people we love too. Our families are friends. Our mothers get brunch together every other week.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Maybe I'm just putting too much pressure on this, but it really feels like a big deal. Seriously, thank you for this advice, though. I do see now that something will inevitably change. Kind of stupid to try and hold off the inevitable.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
But things are gonna, variables are gonna come into your life that are gonna alter relationships.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
You gotta just like. And there's also the thing of like, hey, if you guys are really solid friends, like, It's okay to try something and see if you guys can still be friends afterwards. If he's a good person and you're a good person, it could be okay.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
They continue, I understand the humor, and I also use it from time to time, but I think it's hard not to get tired of something after excessive usage. I will have a conversation with her about it soon, and I realize my fault in this for not communicating clearly to her. Guess I was just concerned about making her feel less than and damaging her self-esteem. Thank you all for the advice.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
She's also saying like, oh, I'm afraid to dip my toes in the water. It's like, you guys have already jumped in. Like, it's already there.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Your pants are wet. You can't go back now.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Don't ask about the half.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
On ABC.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
It's a lot. I'm a line. We'll see. This will determine everything. Someone mentioned something about an update. I'm not sure if this is how it is meant to be done, so I don't know if anyone will ever see this, but this is how I am doing it. So we talked and I was honest. I have been way overthinking this and really just confusing myself more and more.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I came to terms with the fact that I was truly very into the kiss and enjoyed the thought of kissing him even more when I was sober. So I told him that. but I also told him how nervous I have been about our relationship because I have thought of him as someone who will be in my life forever since sixth grade and I have never been lucky in love.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
The thought of us parting ways because our relationship goes south makes me feel legitimately ill and I told him that too. I started off with the talking because he knew it was coming and I could tell he was incredibly nervous, but he seemed to loosen up as I continued. He actually smiled a little. After I finished my speech, he said, can I say something cheesy but true?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And I naturally replied with yes. He told me that he has loved me since middle school and that he never thought it would get this far. I am still utterly shocked by this. I seriously have never known. I was getting all flustered and shy because of a man I have literally shared everything with, which is bonkers.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
When I am with him, I am the most unapologetic version of myself, but he had me blushing. That pretty much solidified it for me. The only thing left to discuss was how to move forward, and he took the initiative and asked what it was that I wanted to do about this. I had been thinking about this for a day or so since unraveling how I felt about him.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I suggested that we go on a real date, not just a hangout, if he would be okay with that. I understand that at this point, he is much deeper into this than I am, so I don't want to do anything to hurt him. But committing super hard would be a lie on my end, and this feels necessary to explore. Honestly, it is a possibility that he could find out that I was better in his head or something."
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Anyway, he agreed and we are giving it a shot. I am very happy and he seems to be as well. He was absolutely grinning once I offered up the date idea. He was tickled that I asked him out. It was very cute. So thank you to everyone for your suggestions and support. It was surprisingly helpful.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
This post was more like a diary entry than anything else and reading it back is kind of cringe, but I am grateful nonetheless. If anyone is reading this, have a great day.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I will do better. There's a way to communicate things that isn't hurtful, because it's not about saying like, I don't like this thing. It's like, hey, like, I'd really like us to have more moments where we connect and talk.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And at the end she says, this is gonna be totally Sigma.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, very, very good.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, I'm glad we ended on that note. Yeah. They can deal with their finances later.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
This was one of the most interesting episodes I think we've ever had.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Yeah, I'm gonna be thinking about these a lot, and I'm really curious about the comments on this one. I'm so curious people's takes on so much of this, because these are really like, real like everyday issues that people face. These are human stories. These are human stories.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That's how the Godfather starts. Thank you both for being here. Thank you, this was awesome. This was really cool. And thank you for watching. Let us know what other themes and subreddits you want us to cover on this show. We'll see you next Saturday. Bye.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Ooh, waffles this time.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
A bunch of comments. For anyone who doesn't know the term brain rot after reading it nearly a dozen times, it's like walking around all day in the 90s saying, waza, baba booey, sha-wing. Oof. ETA.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
ETA because this is cracking me up, LOL. Here's some context. Hey, how's it going? Waza. Nice to meet you. I'm John. Baba booey. Oh, the dress that girl is wearing is so pretty.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I imagine this gets old pretty fast. I'm sorry, man, you shouldn't have left that comment. That was bad. No, it's very real, though. Yes. Someone else said, instead of a swear jar, make a skibbity jar. LOL. Just tell her brain rot makes you cringe. Be clear, it's the words themselves, not her. Someone else said, looks disappear over time, but conversations will go on forever.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
It's important to at least be on the same level, because that's where you guys are headed for the rest of your life.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And that's a relationship. Thank you both for being here.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That's crazy to think that there's... There's going to be a retirement home someday with a bunch of 80-year-olds being like, Skibbity. Skibbity.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Show it to me. Show it to me, Rachel, please. Oh, God. Awful. OP said in response to a deleted comment, when we talk, I'd ask her about her day and ask follow-up questions. However, when I talk about anything, she'd just respond with, that's so skibbity, or sigma, or something along those lines.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
It's funny and cute when we're having lighthearted conversations, but it feels a bit superficial when I want to have deeper conversations with her. I guess I'm just bothered by her lack of effort in our conversations. Someone said, tell her this specifically. I think that's the answer. How about that? How about that? You found it. Yep. You found it. There it is. Be honest.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Thank you. Wow.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I also am like, I get this with a 20-year-old. Like a 20-year-old who's still uncomfortable, who's still like, because a relationship is a scary thing. Especially if like, this might be one of her first like, long-term relationships. It's like she's just sitting there scared to go further, scared to be vulnerable. This is a way to block that.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And we're all 20 years old.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
What's tough now is that with the internet, trends move so much faster than they used to, right? Like, it's hard to explain to, like, younger people, but I'm like, Numa Numa was big for, like, a year. Right? Like, keyboard cat was a thing for a while. Long time. But nowadays, a thing is a thing for like a day. It literally is.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
And then it moves on, and if you're quoting that the day after, you're cringe. You're cringe. It moves too fast nowadays. It's kind of always. We're almost in the post-meme era where it's cringe from the beginning because of the speed of it all. Like, saying any of it, you look dumb. But it's also whatever. I mean, it's also fun because it's cringe, and it's fun because it doesn't matter.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
This episode of Reddit Stories is brought to you by Booking.com, the official accommodation partner of MLB. Booking.com, booking.yeah.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Well, Angela, I actually like to be outside during the springtime. Maybe do some traveling, see some sports games.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I know you were not thinking that. Wait, if you're reading something from our sponsors, I usually do that myself.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
How many of these stories do you think the solution is just going to be, oh, just talk to him?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Never sing on my show again. Was it...
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Take me out of my small home. All right, our next story. This comes from True Off My Chest. I'm that one who decided to stay with my cheating wife, with conditions. Okay.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
People familiar with relationship subreddits have probably seen posts where the cheating partner offers all kinds of shit in return for reconciling. Well, I'm one of those who ended up accepting those things. The quick backstory is that I became suspicious when going out with coworkers went from like five times a year to five times a month or more.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
It's break up or talk to them. And if you can't talk to them, if that's not the option, you've got to break up. Go home. It is kind of a, there you go. You have two options usually.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
One day when she texted me that she was going to an after work event, I went to the car park at her job and put the dog GPS collar in the trunk. She drove to an apartment building. I checked all the names on the door and then compared them to names on her LinkedIn, and sure enough, she had a coworker who lived there.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Won't bore you with all the details, but she ended up confessing after I confronted her that night when she got home. A lot of crying, screaming, pleading, it didn't mean anything, yada yada. Then she went and stayed with her parents. I was set on divorce at first, but every day she gave me the, we can fix this, I'll do anything speech, and that's how it started to grow on me.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
That was over three years ago. In exchange for not filing for divorce for the first 12 months, the following rules are in place.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Thank you.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
You have a helmet on this roller coaster? Got Darth Vader over here. Holy shit. Here are the following rules. Post Nup, if she filed or if I filed after the 12 months, I would get first dibs on the house. Still 50-50. There would be no alimony and we would keep any personal assets. Two, no kids. I didn't want kids before this. She was more back and forth.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Three, our old joint bank account is now my bank account. It's still being used in the same way, as in we both put money in and then use it for larger purchases, groceries, cash, insurance, et cetera, but falls to me in case of divorce as per the postnup. She can still use it with a spending limit. Four, she needs to find a new job and cut off any old coworkers.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Five, cut off one of her friends who knew about the affair. Six, open relationship on my end only used this a total of three times. The last time was over a year ago. Fucking hate dating. Seven, STD tests. One initial for both, every month for her. For me, only if I slept with someone else. However, we don't plan to do these anymore. It was just a pain. Eight, location on her phone.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Nine, no going out alone without my consent. Ten, no alcohol. She used to have a problem with day drinking. This wasn't really a factor in her affair. I just took the opportunity to be rid of it. Eleven, no complaining about the rules or postnup. Obviously, it's a bit more detailed than that, but those are the major points. Questions I can imagine getting. Are you happy? Yeah, I would say so.
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
Or excommunicated. Or you should be excommunicated. All right, let's hop into this first story. Ready to hop. This comes from Relationship Advice. How do I, a 20 year old man, tell my partner, a 20 year old woman, that her brain rot is making her less attractive?
Smosh Reads Reddit Stories
Relationship Dilemmas That Make You Think | Reading Reddit Stories
I still get pissed when I think about it sometimes, but it fades just as quick. It was much harder in the beginning. Is she happy? She says she is and that she doesn't regret it. Doesn't regret it? Doesn't regret getting back with him with the rules is what I'm assuming. Do you feel controlling? Yep. Do you still have sex?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
My brother-in-law, who was completely sober, thought it would be hilarious to fill my belly button with super glue.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
At some point, I must have touched it because when I woke up, I had glue partially dried in my belly button and on my finger. We tried to remove it, but it was stuck. The glue adhered to my skin, and when we attempted to peel it off, it caused some tearing around the edges. Unfortunately, my job's insurance has a $1,000 ER copay, but I had no choice. I had to go to the ER.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
They used a solvent and an ointment to remove the glue and after everything, I was left with a medical bill of $2,253. I asked my brother-in-law to cover the cost since he caused the situation. He refused. After trying to resolve it privately, I took him to small claims court and I won. However, he still hasn't paid. This has caused a major rift in my family.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
My wife is upset and her family thinks I overreacted. So am I the asshole for taking him to court over this? Bro, once again, so the prank is that you just tortured someone. What's the result? If you're gonna do a prank, you have to think forward on what the end result of the prank is. That's kind of like the whole thing with a prank, right, is it's a plan.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
But these people don't seem to have any sort of plan. They're just doing things in the moment.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh my god. That's not easy to do, right?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah, it's not even fun to think about. And this guy, you know, hey, I'm picturing a guy asleep on a hammock with no shirt on. There's got to be some hair involved there, too. It's not fun.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Also like super glues, that's not like some chill little thing you just get out. Like whenever I've had situations where it's like, oh, this thing broke. It's like, oh, super glue it. I'm like, oh, that's so much work though.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
This also has me questioning, it's very clear to me, I mean, maybe it's not clear. This is a brother-in-law, right? So it's just like, I'm like, what is the relationship here? How actually close are you guys and trust? Probably not that much. He was willing to take him to small claims court. So I don't know if they're necessarily super tight even before this.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It hurt, but it's also $2,000, right? Like, if someone, like... someone takes $2,000 from me, or they break a laptop, or they like, what happens if your brother-in-law hits your car with their car, right? It's like, okay.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I guess, okay, I see what you're both saying. Like, a prank is to almost make you feel one emotion, realize, oh, that's silly that you made me feel that other emotion.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
This is willful, but it's just like, hey man, you cost me $2,000.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
We're joking, that is some people's logic with the shit they pull. That's just stupid. The verdict was not the asshole. Comments, not the asshole. I can't believe your wife isn't with you on this. Pranks shouldn't involve the ER. Someone else said, the easiest way to phrase it to your wife and her family is this. He acted like an asshole and got taxed for it.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Maybe he will think twice about acting this way again. Also, for the record, any grown adult who does these kinds of pranks is too immature to be around adults. Put his ass at the kids' table from now on. Someone else said, not the asshole. I would definitely follow up with the court on nonpayment of a judgment. I don't know what they might do, but it's worth a try.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
What's troublesome is that your wife doesn't have your back on this. While the injury was minor, it doesn't make it okay. Someone else said, not the asshole. As a former dumbass with dumbass friends, we've done dumb and mean and not actually funny things to each other countless times. But even then, you ever actually fucked something up or hit someone's pockets immediately?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
you knew it was your ass to pay up whatever was fair. I'd call you an ass if you just ran to a lawyer and didn't try to work it out, but you did. He refused. So he's either a piece of shit or flat broke or both. Now really you have only one legal option left to get paid and you took it. Tell the family they can pay if they care about each other's financial well-being so much.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
They should care about yours too. Lastly, someone said, not the asshole. Drizzling sunscreen in the shape of a dick is a prank. Super gluing your belly button is a soul.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Pranks that hurt definitely don't make sense to me. Causing physical pain to someone is just not funny.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
The reason my wife was upset is because her brother was going through a divorce and between jobs. Everyone knew he did it, he even admitted it. He blames his ADHD. I don't want to garnish his pay. The reason I didn't try more to clean the glue off of me was because I have scars in my navel from gallbladder surgery about three years ago.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
My mother-in-law has offered to pay the bill, but she is on a fixed income and I would feel like an ass for taking her money. Of course, I'm the villain and only my sister-in-law is on speaking terms with me. My wife is only barely on my side. It was her that took me to the ER, not thinking it would cost that much. I figure blood is thicker than water. I didn't expect this thread to blow up.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
But I think, for me, the takeaway of a prank is if the person you're pranking isn't laughing, then the prank failed.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It's like, that doesn't make sense to me at all. There's so many people with ADHD, they're not going around doing that stuff.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
There is an unfortunate, like, I don't know how old this brother-in-law is, but like, People like dudes in my generation, we grew up with jackass and like, but it's like, hey man, those jackass guys are getting paid millions of dollars to do this to each other. They're on a full understanding with each other.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's my takeaway. A lot of people do pranks where the person that you're pranking, you're just kind of fucking them up.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's a show that they're doing. This is real life. These are people you don't know that well. Even your brother-in-law, you clearly don't know him that well. Don't do that to people. Don't mess with people's bodies.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So we have two not pranks so far. Yeah. I think zero pranks have happened.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yes. Okay, our next story. Let's see if a prank happens here. This comes from Am I the Asshole? Am I the asshole for calling the police on my coworker over a prank? I, a 25-year-old woman, just started this new job as a front desk clerk at a hotel. I work the overnight shift. I usually have a coworker, a 30-year-old man with me, but he never really talks to me.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
A few nights ago was my first night alone. At around 2 a.m., I noticed a person in the parking lot. You can see the parking lot from the front desk. The lighting in the lot is terrible, so you don't really see faces until they get close to the lobby door. The person was just standing there. not moving for about five to 10 minutes. I thought this was strange and of course it creeped me out.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
After about 10 minutes of them standing there, they moved, I guess to call the front desk because he moved his hand to his ear and the phone rang. I picked up and on the other end I just heard, five buried, none found, in a low voice and then they hung up. At this point, I was terrified, so I ran to the back room and called 911.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I explained to the operator about what had been going on, and they sent a couple cops to the hotel. When they arrived, one cop was talking to the person outside, and the other one was at the front desk talking to me, telling me that the person outside was claiming that he also worked here. I was confused, but I also admitted I hadn't seen the person's face, just the silhouette.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So you're just doing it for each other. You're not doing it for her at all.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
At this point, the other officer and the person from the lot come in and it turns out to be my coworker and he was upset saying he would have never pranked me if he knew I was going to call the police and try to get him arrested. I didn't go through with pressing charges, but I did tell my manager what happened the next morning.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It's been a few days now and I guess he had told other coworkers what happened and now no one is really speaking to me and giving me a bit of an attitude. I feel like I took it a bit too far with calling the police. Am I the asshole?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
This person who you've not talked to, you're gonna call them and say some weird, cryptid, freaky-ass shit.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Five buried, none found is like an extremely weird thing to say.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's, I'm kind of shocked that once the co-worker came in, she's like, oh, it's just my co-worker. Once he came in, I'd be like, yeah, he's the killer. My co-worker is Ted Bundy.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Verdict not the asshole. Comments, not the asshole, your coworker was trying to scare you on purpose and now he's angry that you did what any reasonable person would have done under the circumstances. OP responded saying, yeah, my boyfriend thinks that my coworker was trying to scare me so I would quit my job and because it backfired, everyone is annoyed with me, ha ha.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Someone else said, not the asshole. If I were you, I'd follow up with HR and make a formal complaint. It's hardly appropriate for a grown man to harass a younger woman who is alone at night, no less, and terrify her for his own enjoyment. Pranks are supposed to be funny, yeah?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Does your prank have a big reveal for your mom? Of like, oh, we tricked you.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I wonder what story he spun because if someone was like, yeah, so I went out to the parking lot so that I looked really creepy and then I called her and I said five buried, none found. Yeah. And I'd be like, hey man, I gotta be honest with you. I don't know if I'm with you on this one.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Us at the bar just being like, aw, dude, and she didn't think that was hilarious? Bro, women, I don't understand them.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah, I stood out there under the lamplight so that she could only see my silhouette and couldn't make out my face.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Barton like a loser. Okay, so hold on, hold on. She says, a few nights ago was my first night alone. At around 2 a.m. I noticed a person in the parking lot. That means he was off work.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
He went to work when he was off work just to scare her. Can you imagine?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Could you imagine? There's no prank in the world where I would show up to work on my day off.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Last comment. Agree with everyone here so far, not the asshole. First of all, it's his night off and this is his activity of choice?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Take up knitting or something, bro. Not menacing women in the middle of the night than being pissed about the consequences. What if a guest at the hotel had seen this? It doesn't matter if you did or didn't see his face. You did what you should have done in this situation, especially with the phone call. That's menacing, mean, and messed up.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I've stayed at many hotels alone on work travels, and one time, late at night, I was on my balcony, which faced a parking garage, and I noticed these two guys taking photos of me. I asked them to stop. They didn't. So I called the front desk, and the gentleman working that night took care of it by calling the cops and also standing outside facing the garage in the meantime.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I was so appreciative, even though I felt bad about the cops coming, which I shouldn't have, and neither should you. My point is, as the front desk clerk, you're responsible for guest safety, but you can't take care of your guests if your own safety is in jeopardy, and regardless of whether or not you have in-house security, you did the right
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
He's an idiot and an asshole, and so is anyone you work with who thinks you were in the wrong. Again, as a guest, I'd hope that the people I call for help would do exactly what you did. If there's no harm, then there's no foul, but better to be safe than sorry. I fear what your coworkers would have done in the situation I was in.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
You were saying, like, when people don't know how to be funny, they just go for mean. It's also, like, she said, like, he never really talks to me. This is a guy who clearly does not know how to interact with women. So this is his only instinct. He's like, I don't know how to say hi to her. So I'm just going to freak her the fuck out.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's what I'm saying. Like you're in elementary school and all you know is how to scare someone.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Right. All right, another not prank.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah, I actually think, I'm glad she called the cops, because I'm nervous about this guy. I'm like, no, who knows what he was doing. He did show up to work on your night alone when he wasn't supposed to be at work. That is odd behavior. I'm scared of this guy. If I were her friend, I'd be like, you should quit that job because I don't trust this guy.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
No, it goes back to what we were saying of like He did technically harass her. It's not a prank. You can't just say it's a prank and oh, and that didn't happen. No, you were in the parking lot being creepy, calling her, saying some weird shit about bodies. That is all just factual. You were doing that. It doesn't really matter what the intent was because you did it.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I don't know. I'm not gonna try to figure this guy out.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah. Okay, our next story. Am I the asshole for being furious with my pregnant wife over a prank? Whoa. It was a balloon.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Psyche, prank, guys. Okay, I'm a 31-year-old man. I've been with my wife, Lisa, since college and she's currently seven months pregnant with our first baby. My wife, Lisa, is witty and likes to play jokes on me. For example, she likes to pass off fake facts and stories as real and see if I'll believe them. Lisa was a theater kid and so she's great at acting and selling these stories.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I used to fall for her pranks all the time since I'm gullible and she's so convincing. However, now that I've been with her for so many years, I can typically tell when she's messing with me. She's upped the antics over the years so she can occasionally get me to believe one of her jokes.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Today, when I got home from work, Lisa had tears in her eyes and told me she needed to talk to me about something. Oh no. What? I got up, started pacing, and tried to gather my thoughts. After a few minutes, Lisa bursted into laughter and said she was just joking. I was furious. I said it wasn't funny in the slightest to make jokes about cheating and the child not being mine.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Lisa then said she was a bit offended that I believed that specific prank and not several others. She said she couldn't believe I actually thought she'd cheat on me. She then got teary and asked why I didn't trust her.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I asked why I would trust her after she pulled that prank on me, managed to cry telling me about it, and continued with the prank even though I was visibly upset. Lisa said it was harmless, and I was blowing things way out of proportion. She continued to ask why I didn't trust her, and I told her I needed some space. I ended up going to a speakeasy, a bar. Let's go.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I ended up going to a speakeasy and have been away from the house ever since, even though Lisa has called several times. I know it was a prank, but I think this joke went way too far, especially with the tears. I also was clearly upset, as anyone would be, and she should have stopped it as soon as she realized I was actually falling for it.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Usually Lisa's jokes are funny, but this one really got to me for some reason. Am I the asshole and am I overreacting? I feel bad because she's very pregnant with my child and I don't want to stress her out, but I need space right now.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
You can't twist it around and be like, I'm so mad you'd believe me.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Like, she did it, saw the response, and then kind of got cold, like, was like, oh, I can fix this immediately.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I don't love the setup of a prank of just like, I told you a lie.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Well, here's the thing. Here's the thing. What the hell is that?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah, I guess it's once again, it's thinking about the long term of it. And talk about harmless. Like, okay, we knew that Amanda didn't know what Five Nights at Freddy's was, which is such a gift. And so it's like, if we can convince her this is a true crime, like, real story, that'll be fun. It's also on camera. Like, this is us doing it. And you're also kind of being silly.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It's low stakes, but I'm also like, this is our job. We're technically at work where our job is to be silly. No, for sure. So I'm like, when it's real life... And when you cry.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Well, the stakes are so... There's trust. That's what I'm saying. What we're saying on a podcast, the stakes are so low. Yeah. Because it's just like, oh, yeah, well, this is... None of this really matters. Whereas in real life, in a relationship... Yeah, exactly.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Also, it's just like with this prank, and she was so desperate to make him feel this, it's like, hey, I want you to experience trauma. Like, hey, that's what I want. Like, it's funny, because I see what you're saying, and I agree. It's funny if it's just like, I'm going to make you believe this stupid thing. Something really silly. Like, it's silly, and it's just like a fun reveal.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Also, yeah, there's no way to actually prove definitively that you weren't lying. It's funny if it's like, oh, Five Nights at Freddy's is a true crime story. No, here it's not. It's a video game, and we're going to play it now so you can see it's a video game.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It says it right there on the statue. Whereas this, it's like... Just cheating allegations for fun?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Because I'm with you where I'd now be like...
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh, my God. Oh, my God. Verdict is not the asshole. Comments, not the asshole. The worst part about this, to me, isn't even the prank. It's that after the prank, she sees you're upset and instead of apologizing, she blames you for believing her and begins to question you. Also, just remember, she can make herself cry, so don't let tears fool you anymore. Someone else said, not the asshole.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
The reason cheating ends relationships is for the same reason lying does. It breaks the trust in the relationship. She may not have a pattern of cheating, but she does have a long pattern of lying. And that's why you didn't trust her enough to immediately reject the idea she cheated on you. She's the one who has deliberately eroded the trust in your relationship for laughs over the years.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
All right, well let's see if these pranks live up to those that you just talked about.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Of course you don't trust her. She's made an effort to convince you not to trust her. How do you even know which part she's lying about this time? Maybe it was just a prank. Or maybe she really did cheat, but then she pretended it was a prank when she started to doubt that you would forgive her.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I think at this point you might want to consider couples counseling to see if it's possible to rebuild the trust between you. You can't have a stable relationship without trust, and it's clear that you justifiably don't trust her enough for a stable relationship. Lastly, someone said, not the asshole. Sorry, but jokes are meant to be funny.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
And this, if a joke was just cruel, messing around with your unborn child's paternity, then gaslighting you for believing she wouldn't stoop that low to joke about it is a serious red flag. Whether you admit it to yourself or not, you will always have a doubt in the back of your mind about the baby's paternity.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So I would demand a DNA test to alleviate your doubts and if your wife is upset, remind her she created this situation by trying to be funny. She crossed so many boundaries and really needs to grow up and stop with her hysterically funny pranks.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
This first story comes from Am I Overreacting? Am I overreacting? Fiance told me he had a surprise for me and drove me to a house and said it was ours. Let me believe it and then said it was a prank. Okay. We were out looking at Christmas lights tonight when my fiance said he had a surprise for me. He usually isn't great with surprises, so I was intrigued.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It's kind of like the other pranks that we've read today where I'm like, what's the, oh, you wanted to make them feel horrible.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
And I think we all know with this lady as well with all the other pranks here is if he did something of this caliber to her, I don't think she'd forgive him. You know she would not be able to handle it. In fact, he should be like, I'm divorcing you. And they should get all the way to the process and then be like, pranked. He should show her the papers and it just says pranked on it.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
The doctors at the delivery room are like, there's no baby. I'm just kidding, here he is.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
In the middle of her giving birth, they do the clown thing where it's just a bunch of rope and stuff. They're like, whoa.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
There you go. This one comes from the Relationships subreddit. This is a 24-year-old man. He writes, my girlfriend, who's 24, went way too far pranking her male friend, who's also 24, and now I'm wondering if the pranks are flirtation after all. Oh. My girlfriend of two years has had this male friend for a while.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
His name is Declan, and I'm not his biggest fan, but I didn't want to impede on the friendship. She told me last week that Declan pranked her by calling her up and pretending to be Jack Nicholson with one of those sound boards, so she wants to get him back.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So as a joke, the next time we were over at his place, she used his landline to call a sex hotline that charged by the minute and then just left the phone there. Declan got charged like $200 for it. So Declan strikes back at her again. At this point, they're still just being goofy, and I don't really mind.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
He comes over to her place for a party she was throwing, then hides this creepy decapitated doll in her closet. She finds it, freaks out, but then laughs it off. Now she wants to prank Declan even harder. She knows he's scared of clowns, so she made a giant papier-mache clown statue that is hollow on the inside.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
She wanted to put it in his house, apparently his roommate will let her in or something, then hide in it all night and pop out of it as soon as he noticed. Oof. Now she's fine, although she is still wearing a splint, but she wants to continue pranking Declan. At this point, should I put my foot down?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
We drove a few miles and pulled up to this house. Mind you, it's nighttime. It's a gorgeous house with a sign in the yard. He asked, what do you think of this house? I've been dying to move out of my cramped one-bedroom apartment, so I'd literally move into a medium-sized shack if I had the chance. I told him it was very pretty. He said, what do you see in the yard?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
She is actually getting injured, and it makes me wonder if she just likes being around him so much that she is using the pranks as an excuse. We've read other pranks that have fallen under that same category.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Where it's a partner being uncomfortable with their partner... and their friend pranking each other, but it gets to the point where they're going into each other's apartments and leaving things and stuff. It's like, okay, this is really intense.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It's a lot of effort. These are also, you know, this is very specific stuff.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah. Or no, he left the decapitated doll in the closet. Then she did the clown. So he punched her.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
But she's just down for the prank battle to keep going.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah, yeah, this is this girl's boyfriend writing this story.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
And I'm not his biggest, his name is Declan. I'm not his biggest fan, but I didn't want to impede on the friendship. So it just, there's red flags around here.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
This clown one's intense too. It's like, hey, I'm gonna go over to this guy's house. I'm gonna hide in his room overnight.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh my God, okay, so I just thought of the funniest prank. What if I fuck? What if we fuck him? What if we fuck? That'd be so silly.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
But if we go and I'm like, hey, let's have sex, and he's like, all right, let's have sex, and we have consensual sex, and we both love it, and then what if we also date? All right, comments. Well, your girlfriend is an adult, so no, don't put your foot down. But you can say, hey, you got hurt. Maybe it's time to call it a truce. It does sound kind of flirty to me.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
And I told him I saw a for sale sign. He told me to look again and pulled back. The sign said under contract. It started to click in my head and I had started to get really excited. He let me sit in my excitement for a while before I asked, is this our house? And he started laughing and said, nope, and drove away. Am I overreacting? I haven't stopped crying.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Did she pay him for the sex line calls, by the way? Because she totally should have. OP said no. He told her it was fine and hilarious, and he didn't ask her to pay him back. He also paid for her hospital bills after he punched her in the face.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Can I also say the sex line thing is also interesting because these pranks are also like treading a line of like sexual things. It does feel like there's a lot of repressed feelings that they can't just say to each other.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Someone said, as someone who loves pranks, I have definitely started prank wars with guys I like as an excuse to flirt with them. I have also pranked male friends of mine with absolutely no desire to bang them. So I don't think anything in the post is evidence enough to prove that she wants to cheat.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
This sub is really suspicious of friendships outside of relationships, but I don't think that suspicion is always warranted. You can't put your foot down in that you can't tell her what to do, but you can at least ask for some insurance. She sounds competitive and like she doesn't want to get beat. So that may be why she wants to continue the pranks even after she got hurt.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Continuing shows she's tough and not scared in her mind. That prideful mindset can be hard to get over. but explain that you're worried about her and worried about how this is escalating. You can ask her what the hell she's getting out of this that's worth getting her nose broken. Maybe that will at least make her pause and think about her motivations.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Lastly, someone said her friendship with this guy seems inappropriately close, but I have to admit, that clown costume sounds impressive. If you do break up with her, ask her to teach you some paper mache skills first.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Didn't think I'd have to do an update so soon after posting my original post, but here goes. I talked to my girlfriend about Declan and I told her that the pranks are getting dangerous and she is unreasonably close to a guy she's only known for such a short amount of time. She refers to him as her brother and her BFF, but it's literally been five months.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Whoa. Five months is a very short amount.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I think I was under the assumption that maybe I must have missed it. I was under the assumption that.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Childhood friends. Yeah. Because she just says a male friend has had this male friend for a while. So she. Five months. So OP and this girl have been together for two years. She's only known this friend for five months. Oh. And she's already going into his house doing stuff. That changes things. That's important context.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh God, okay, so it's literally been five months. I thought she would react in a mature way, but instead she said, almost word for word, this is why I am always pranking Declan. At least Declan has a good sense of humor. I wouldn't even need to hang out with Declan if you weren't so uptight.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So at least now I have confirmation that she hangs out with Declan specifically because she thinks I am not good enough. I hate his name. We wound up having a screaming match and in the midst of our fight, the doorbell rang so she went to get it. It's a guy in a giant gorilla costume. Shut the who barges in and starts humping all our furniture.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That was one of the cruelest things I think I've ever had done to me by someone I love and trust.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Immediately I assume it's fucking Declan, so I, keep in mind I was already extremely angry, punch him in the face. He takes off the mask and it's Declan's roommate, Chad. Apparently Declan paid Chad $100 to scare us in the gorilla suit as a diversion because he was right behind Chad. While Chad was humping our furniture, Declan snuck into our bedroom and put ham underneath the mattress cover.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So I tell both of these dudes to get the fuck out and stop pranking us. I thought I was finally standing up to Declan when finally my girlfriend told me that the prank was hilarious and she's going to give me time to cool off. She leaves with Chad and Declan. Keep in mind, Chad's nose is still bleeding and he's wearing the gorilla suit.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I haven't heard from her yet today, but I saw her post a picture of a bagel on Instagram this morning, so I know she's awake. I still don't know where she slept last night or what happened with Declan. I want to break up because I'm so angry, but weirdly enough, I still really love her. I can't help it. And I don't want to waste two years. I gotta be real honest. Like,
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
maybe I'll sound like a total dude with this, but if your girlfriend just gets upset with you and leaves the house with two other guys, you're broken up.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I mean, I feel like anyone would feel a sensitive subject for most people. For lies. The verdict was not overreacting because what kind of prank is that?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I can't believe that's the first prank that we've read today where I'm like that one was actually a little funny.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Why does every prank involve, like, beds and sex and stuff? Like, the gorilla's humping. Like, no, this is very much, it's very clear what's going on here.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
You know what would have made this all really funny? Is if the gorilla's in there and it's like, oh, I know it's Declan, but then all of a sudden, Chad and Declan show up at the door and they're like, wait, who's in the gorilla costume? And it's just a real gorilla. And it's her parents.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
The night of my previous post, I broke up with my girlfriend. Good. I told her that I thought her behavior with Declan was already an emotional affair, if not a physical one. Not surprisingly, she flipped out at me and told me I was being emotionally abusive and controlling. She told me that every ex-boyfriend she's had has been emotionally abusive and I fall right into that category.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah, I don't understand what the goal. I think that's my issue with a lot of pranks is like pranks where it's like, hey, this really cool thing's happening. Actually, it's not happening.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Because she's only kind of living with me and technically not on the lease, she's just slowly been staying here more often and has a key, it was pretty easy to kick her out. I wasn't sure if she was going to return to her old roommate who has most of her stuff, her female friend, or if she'd start living with Declan and Chad.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
When I asked her if she was going to move in with Declan, she told me it was no longer my business. Anyway, that night I tried to relax. I was upset but pretty confident in my decision to dump her. I felt like I could start anew, meet someone else, etc. Then I got a bunch of random calls on my phone from a restricted number. But when I picked up, nobody was there.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So I turned my phone on silent, figuring this was one of her immature schemes. To be honest, I still don't know who did it. I'm just assuming her or Declan. And in the morning, I had 60 missed calls from restricted numbers.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
In the morning, I actually got a text from Declan asking to come over to pick up my girlfriend's stuff. So yes, she moved in with him. I tried to be civil because I really just wanted to get her stuff out of my apartment, but I also wanted closure. When he got here, I told him that his relationship with her directly influenced the breakup and that I know they're together now.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Now, this is where things get weird. Declan looks at me, surprised, and tells me that he doesn't think my girlfriend is into him and that he definitely isn't into her. I told him to cut the crap, that it doesn't matter anymore. He seemed to be getting anxious and panicky, so I told him to calm down. I wasn't going to hurt him. I just wanted to know the deal.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Then he tells me he knows he directly contributed to our breakup, but not in the way I think. Apparently it was Chad, not Declan, who wanted to bang my girlfriend. Chad was too shy and asked Declan to befriend my girlfriend and act as a wingman. Declan has tons of female friends, so Chad thought he would effectively gain her trust and be a good in.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Declan insisted the reason he kept pranking her and being goofy was because he was hoping it would paint their relationship as clearly non-romantic. Apparently Chad paid him back for all the times he had to lose money in a prank, and Chad was actually the one who paid for my girlfriend's broken nose.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I told him, well, that was a stupid plan because my girlfriend moved in with you specifically to be with you. So that sucks for all three of you. Declan got extremely upset and seemed to be practically shaking at the idea that my girlfriend had feelings for him. He was acting like he murdered someone.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So now my girlfriend, well, ex, is living with the guy she has a crush on who has no feelings for her and a guy who has a crush on her but was too creepy and weird to say it. I hope they all have fun together.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I was, you know, I had a moment where I really thought Declan was going to be like, oh, no, I'm gay.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It sounds wild, but I know people like this do exist.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh, yeah. All of them are. None of them are thinking.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Okay, so so far, we have one prank we like, and that's the gorilla.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
A joyful prank, I understand a joyful prank where it's like you're tricking someone into thinking like, uh-oh, something's gone wrong. It's like, psych, actually things are better than we all thought it was. That's cool. So you could do a thing where it's like, I don't know how you'd do it, where it's like, oh no, something's gone wrong. Oh, psych, we got a house.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I don't like the ham part of it, but the gorilla.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
The added context that he's in love with her. And so he just jumps in there and is humping stuff.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Actually, it makes it funnier for me.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Don't hump things in front of me. I do agree. I do agree. So. I think just that the idea of someone in a gorilla costume makes me laugh. Me too.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Okay, our last story. Am I the asshole for leaving my husband in the grocery store because he started acting like a toddler? We all go through phases and pick up annoying habits, and sometimes we just need our loved ones to gently tell us if we've picked up a particularly egregious habit. Sometime in the last year, my husband has picked up a habit where he talks like a baby.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
At first it was funny, but passed into embarrassing, cringe-worthy behavior quickly. Doggo, pupper, woofer slash subwoofer, pibble, Hootie boy, peepo, burb, meow meow, Sammy, sandwiches, Sammy whammy, chicken nuggies.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Chickie nuggies, chickie tendies, adding a toddler-esque lisp to words, and the ones that really get gross are childish euphemism for genitalia or sex.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I cannot emphasize this enough. It is not endearing or sexy to have my husband talk about my boobies and his wiener and weenie and wee-wee hoo-hahs and bajinjos.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Bajinjo. Nostalgia for scrubs be damned. We have not had sex for six months because he cannot stop talking about my boobies and it makes me sick. Just before the pandemic hit, we were out at a restaurant with some friends. He actually ordered a chicky sammy, like said that exact phrase, chicky sammy. Look, it's totally fine that he ordered the chicken sandwich. That's not the issue.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Even though, would you be pissed if your partner bought a house and didn't talk to you at all about it?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Our friends noticed the baby talk because he insisted on continuing the joke and even started talking with this God awful toddler accent. After that, I just couldn't stomach the idea of going out with him to adult places. I'd go out to the brewery with friends, but God forbid he'd join me and say, me want another beer or something. I don't know where it came from.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I don't know why he's doing this. I finally hit my limit when we were grocery shopping and everything seemed normal and fine until he gasped like a kid, ran to the ice cream section, and jumped up and down yelling, ice cream, ice cream, I want chocolate. Wait, wait, wait, wait, wait, I'm really worried.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
She turns around and he's just like this.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I blew all our money in Vegas last week.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I love FanDuel. My Paul Wei didn't hit.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So he says, ice cream, ice cream, I want chocolate. I was mortified. People were staring at him and me. He kept going and kept saying, can we get popsicles? And I just said either talk to me like an adult or I'm leaving. He started saying, oh, you must be fun at potties and lighten up, will you? And shit like that. I just said fuck it and left the store.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Leaving him to walk home, like a mile, it was fine. Because I couldn't even look at him. Since then, things have been very tense. He keeps telling me that he wants an apology for embarrassing him by leaving him in the store. I told him that people don't get to demand apologies.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's what he said. If someone wants to apologize, it's up to them. I'm absolutely not going to apologize for saving myself the embarrassment of a 35-year-old man with a mortgage and retirement account asking for chocolate ice cream.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
He got his fucking mom involved. No joke. She keeps telling me it's just a phase and that he's probably bored and I should be happy this is his midlife crisis rather than him fucking 19 year olds at a local bar.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Right. This prank is just weird because he drove several miles to a specific house, which makes me think he knew about this specific house. It had the right signage in the front yard. It was nighttime. And he did all of this just to tell her, no, we're not buying. I didn't buy a house.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
He's having a mental break. I'm going crazy. Am I the asshole? Do I really just need to let my husband continuously embarrass me like this? Edit. Edit. Sorry, there was only so much space. I have talked to him multiple times, especially about the sexual comments.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I've made it extremely abundantly clear that him using terms like boobies and wee-wee are absolutely repulsive to me, among other things he says. Does he have a job? Yes. And he acts completely normal as far as I know. He worked from home for a while during lockdown, and I never heard him talk like this to anyone he worked with.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
But imagine in the middle of a presentation at work, he's like, this mojo is gonna be really great.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Does he do it with friends? Sometimes, and it's generally meant to annoy them or gross them out, but he stops. He has friends where they think it's cute to embarrass each other. Is this a kink slash fetish? If so, I'm absolutely done. Has he seen a doctor? No, but I asked him if he needed to talk to someone because he was acting strange and he accused me of being stuck up and judgmental.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Given that he doesn't act like this with his coworkers or his family and only jokes around with his friends, I'm willing to bet that this is an indication that he's trying to force this fetish on me non-consensually. or trying to get me to leave. Does he have childhood trauma?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
As far as I know, and I'm relatively close to his family and would likely know, the most traumatic thing he had happen was a minor car accident when he was around 13 years old. No injuries, no death, etc. He hasn't been in a car accident in the past two years or anything like that, and I haven't, and as far as I know, no one else in his family has been, etc. I don't know if she under...
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That feels like a different type of trauma she's bringing up.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Why do you want that reaction out of your partner? Why do you want to annoy your partner?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's the biggest one. There's not a great resolution to this because either way, he's just not respecting her. She's saying, hey, this makes me really uncomfortable. And he just keeps doing it kind of because of that.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Some comments here. Man, by the title, I assumed he just threw a temper tantrum or something. This is so much worse and I have no idea how you put up with it for as long as you have. Not the asshole and your husband needs some professional interference ASAP. Someone else said, not the asshole. I have two kids.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
They have never talked like that because if you talk to children with big words, they will too. What the hell is he going on about? Tell him if he insists on acting like a child, you will find him a nanny to take care of him. Someone else said, not the asshole, what the actual fuck? My boyfriend and I are in our 30s and will admit that our speech can be fairly young.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
There are doggos, things with crunch, and our pet name for each other is a similar cutesy derivative. But that's, you know, at home. And we're both down for it. What boggles my mind is when people say, I can't believe you're making a big deal out of X, when the issue is actually, I have told you repeatedly that X action bothers me a lot, but you keep doing it.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Why aren't you respecting my boundaries? Legit, though, I feel like he needs some individual counseling.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Well, here I am with the update. I talked to my husband after doing some soul searching. There was no kink, no childhood trauma. I asked him first if he understands why I'm upset and to please clarify if he was doing this on purpose or if we needed to seek medical intervention. He didn't want to tell me at first and I got worried.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
He eventually caved when I suggested we look for a doctor because of how worried I am. It was a bet with one of his friends that started as them trying to embarrass each other in public. He bet my husband that he couldn't keep it up for the whole year. The only off limits part was at work because he couldn't jeopardize his career. No no, he decided to jeopardize his marriage instead.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
For what prize? What was he going to win? A signed baseball. A baseball. I thought he was still joking. No, he was dead serious. How is the friend verifying? My husband would share little videos he took here and there of him upsetting me with the baby talk, including times he tried to initiate sex by whispering this baby talk in my ear. I wasn't in any state of undress.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
And by seeing us in public, like at the brewery, he got cross with me in the grocery store because I interrupted the recording and almost blew the whole operation.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh. I told him the joke was over, it was time to stop for good, but that I was willing to move on with him. I could forgive him, no, he wanted to keep going. There are only two months left on the bet, so he's so close. He said, we can have sex if you want, we'll just pretend X, Y, Z. And I was just like, why does thinking about your friend even factor into this? What's wrong with you?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
You never had to do this and ruin our intimate moments. But he said I just didn't get it, and he had to be in character all the time. After a lot of arguing and tears, I left him. I'm heading up to Colorado to be with my family through Christmas, and then I'm going to move in with my sister for a little while to figure out next steps. I hope it was worth it.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
You were right on. I think the funniest thing out of all these stories we read today is her being like, we haven't had sex in six months. And he's just like, yeah. It's for a signed baseball.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
When he's like, okay, this will alleviate things. I've been recording you in secret.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's almost always the case with Reddit stories, right? It's like, oh, here's a thing that's happening. It's like, but there was a pattern that's been going on for a long time. Someone who's willing to do that probably has done a bunch of other bullshit before.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
So you think the gorilla was the only funny prank and you stand that there was no funny pranks?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Okay, to be completely, this is different. At Smosh, the rules are a little different because we could be in the middle of filming any video and if a gorilla ran in and started humping the furniture, I'd be laughing. If I'm here reading red stories and a gorilla runs in and starts humping this chair, I'd start laughing.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That was awesome. That was awesome. Damn. Well, thank you both for being here.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
We have done a prank. Well, we actually didn't prank anyone.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I mean, but we just told people the truth on April Fool's Day.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Maybe. I mean, because... The thing right now is, yeah, it's like, what did you want out of this? Like, what was the goal here, just to make her sad? That seems like that's all you wanted to see.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Okay, the prank was we did set up that Smosh Mouth was going to be like... That was the prank.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh. Yeah. No, that was epic, though.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It was epic because it wasn't a prank.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
The graduation was the only prank in my life where I was like, okay, that was awesome. Or like surprising you with a birthday. Because it was like, oh, this is...
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Because it's just like, oh, here's a sweet thing. Like, if the prank ends with everyone laughing, then it was great. That's a hit.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
But if someone's upset at the end, then you failed.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah. I view pranks the same way I view, like, whenever we've done roasting, where I'm like, if you roast someone and the person you're roasting doesn't laugh, then you just insulted them.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
That's all that was. Yeah. It's like, you gotta think about these things. It takes some thought. So, yeah. Yeah. Anyways, me on Amazon looking up gorilla costumes.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
And next week on Reddit Stories, it's going to be right there.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Thank you both for watching. Thank you guys for watching. Let us know what other subreddits and themes you'd like to see on the show. And we'll see you next Saturday. Bye.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Like it just sucks. Comments, we do not marry people who are mean to us. Please tell this person you were only kidding when you said yes to the proposal. Someone said that's cruel behavior I wouldn't have been able to cope. In this economy, you might wanna rethink that engagement. Tell him you were joking when you said yes.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Bad people are using the prank craze to indulge their previously banned cruelty. It was fun for him to upset you. That legitimately gave him joy. Let that sink in. The person that you're tying yourself to for the rest of your life got joy from seeing you hurt. You are underreacting. The trust it takes to make a marriage succeed is immense and your fiance is not trustworthy at all.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Lastly, someone said, not overreacting. If this was a one-off and it just really fell flat, then I think I could let it go. But if this is a pattern where he often pulls pranks that are cruel, not funny, then I couldn't be with someone like that. Opie responded, saying, first cruel prank other than an occasional jump scare here and there, and we both tried to spook each other.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
I can't even fathom how incredibly unkind it was. I feel like, because the last prank episode we did of this show, it was a lot of really cruel pranks.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
And it was like, it's like, what is your goal here? Like, what do you want to see out of this person? And pranks almost seem to be like a weird litmus test for, like, people, where it's like, oh, do you find joy out of people being sad or upset?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Like, is that what you enjoy out of the prank? Because pranks have a lot of elements to it, but I feel like the ultimate joy is what you're seeking is for everyone to be laughing at the end. But some people, it doesn't seem like that's the case.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Hello and welcome to Smosh Reads Reddit Stories. I'm Shane. And today the theme is pranks. And I'm joined by two pranksters, Angela and Courtney. Courtney, you just pranked Angela a second ago by screaming at her unprompted.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Oh, my God. You totally got me. Oh, my God. Oh, that's right. Everything sucks. I thought things were going to suck for a second. That's right. Everything's just fucking awful.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Mini update. I posted this back around Christmas time and you guys had a lot to say. I just wanted to come back and say that as of yesterday, the wedding is off. He started to show some very negative tendencies that lean towards abuse. Thank you guys for your support. This is not easy.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
The editor is just like, the editor is like, I love that word too. That's a great word, guys. Sorry. Okay, our next story. So first off, that first one was not really a prank. No, and it kind of- That didn't classify.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Yeah, YouTube has had a lot of prank phases. And there was the really famous one, this was like 10 years ago, where it culminated in one of the prank YouTubers just staging that he was about to murder someone. And his friend was like, oh my God, you're about to murder me.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
It's like, oh, okay, cool prank, man. You just thought, you made someone convinced they were about to die. Have you seen it?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
A good prank is also done with understanding the person you're pranking and understanding the boundaries beforehand. What we're seeing a lot on TikTok and what we've seen on YouTube, too, is pranks where it's like, oh, you're pranking this stranger by doing this insane thing to them in public. And oftentimes when things crash back on the prankster, they're like, it's just a prank, bro.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
But here's the thing. Whatever you're doing to them, you can't, like, call it a prank in court. So if you tackle someone as a prank or if you, you know, touch someone as a prank, you're doing it for real, right? Like, there's no prank element to it. But I think people seem to think like just because there's a prank at the end of this means I can do whatever I want.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Is that a prank? Damien posed the question a long time ago and I've been thinking about it ever since of like, what is a prank? And at this stage, I'm like, does it even exist?
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Today's Reddit Stories is brought to you by ZocDoc. Have you ever tried to meet with a therapist but they only have openings in the middle of your workday? Or drove over an hour and out of your way to see that one specialist in your insurance network? Well, I'm here to tell you that you don't have to settle anymore when it comes to finding the right doctor. With ZocDoc, you've got options.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
ZocDoc is a free app and website where you can search and compare high-quality in-network doctors and click to instantly book an appointment. We're talking about booking in-network appointments with more than 100,000 doctors across every specialty, from mental health to dental health, primary care to urgent care, and more.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Plus, appointments made through ZocDoc also happen fast, typically within just 24 to 72 hours of booking. You can even score same-day appointments.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
When I used ZocDoc, I was amazed at how easy it was to find doctors in network, which was always a struggle for me and why I'd often put off scheduling an appointment with the doctor because the process of finding someone that was covered was so agonizing. But with ZocDoc, it made it so simple.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
Stop putting off those doctor's appointments and go to ZocDoc.com slash pitreddit to find and instantly book a top-rated doctor today. That's Z-O-C-D-O-C dot com slash pitreddit. ZocDoc.com slash pitreddit. Back to the show. Oh, which brings us to our next story. This comes from Am I the Asshole? Am I the asshole for taking my brother-in-law to small claims court for a prank? Hell yeah, dude.
Smosh Reads Reddit Stories
Get PRANKED | Reading Reddit Stories
This is awesome. Get Judge Judy on this. I recently took my brother-in-law to small claims court over a prank he pulled on me and now my wife and her family are furious. I need to know if I'm in the wrong here. A few months ago, we were at a family barbecue. I had a few too many beers and fell asleep in a hammock with my shirt off.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He said he read through my LinkedIn message and swore my ex was flirting with me. I said he wasn't. My husband then made fun of my ex's looks and it was some of the cruelest things I've ever heard him say. I told him to stop and that we could talk when he wasn't acting this way. He asked if I would cheat on him if that guy became my coworker.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Then he scoffed and said, you're not attractive enough to cheat on me, not enough to keep me. I was speechless. He then slammed the door to our bedroom and locked me out for the night. I went to sleep on the sofa and woke up tucked into bed. Holy fuck. Okay.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
My immediate take was as insecure as she might come across in these first paragraphs that she writes, it's very clear to me by his reaction that he's far more insecure than she is. And it's an interesting thing that I've noticed, you know, being in LA where there's just the hottest people you've ever seen in your entire life, right?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And an interesting thing is that a lot of the most attractive people you know are the most insecure about their looks. And I had it explained once, and it was that, oh, because their entire life they're made to feel like their looks are kind of everything. Oh, you're so beautiful. You're so attractive. That if at any moment they feel they don't have that, then they have nothing.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Their entire worth is gone. Their entire worth is in their appearance. Whereas anyone who doesn't feel that's the case growing up, they then have worth in every other way. Exactly. But... It seems clear to me that this guy has gotten used to so much attention Absolutely that he's actually deeply insecure as a weird Reverse reaction to it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We have done episodes before on cheating, and it is, it's, man, I have to admit, whenever I come across a Reddit story that has to do with cheating, I'm glued to it. Even though I feel bad for the people. It's a shame. It is always high stakes. And it sucks how common it is.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
You'd think you hear compliments your whole life You're gonna think you're the best which is true, but it also creates this opposite aspect That is so fascinating because that that theory that you brought up like it seems to be the case here right because
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, it's true. And it's very much a control tactic to be like, to put her down so she doesn't think she's good enough.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Right. I mean, just a devastating, it almost doesn't matter to me when you say something like that and then don't apologize to it. It's like, who cares if he's cheating on you? Someone who says that to you and doesn't apologize, that's not worth sticking around for.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, and looks fade, but that piss-poor attitude will stay around, so. It is such a huge red flag for someone to, do something so horrible, say something so horrible, and then a moment, an hour, a day later, pretend like it never happened. That's a huge red flag.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It also, it denies what the relationship's supposed to be, which is like a teamwork thing. Where it's like, hey, if we have a disagreement, if we're upset at each other, that's our problem together. And I don't get to just move on and leave you there. We have to both be in it and figure it out together. And he knows it's his fault, but that's why he's trying to just bounce off.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I feel like almost everybody goes through some version of it at some point.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He's such a mattress baguette, dude.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We're gonna make it happen. This first comment is a doozy. As a therapist who has worked with some couples impacted by infidelity, I'm going to tell you two things. One, there is no pretty privilege when it comes to infidelity. Attractive people get cheated on every day. Unattractive people cheat every day too.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So your husband's stance that you're not attractive enough to cheat on him and that he's safe because he's attractive is nonsense. Two, your husband knows you. He knows your insecurities, and he knows what buttons to push. He knows you struggle with self-confidence, and he saw that opportunity to poke at your soft spot, and he went right on ahead and jabbed at it anyway.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Part of marriage is being vulnerable with your partner about our insecurities, and he took that and had zero hesitation to use that against you in an argument. To me, that says a lot about a partner. The wound he created with his careless words is twofold. Not only are you questioning the attraction between the two of you,
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
but you're also questioning the ability to be vulnerable with your own husband about your insecurities going forward.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
That 13-year-old really whipped that up. They're going to believe that.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's incredibly poignant. Someone else commented, mask slipped. Lastly, someone said, no man who truly loves and cares for you would say something like that to you, especially over something like that. He was jealous, which can be understandable, but took absolutely zero time to listen to your side or even let you give any further explanation.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I think, you know, it's so hard to admit, and it's a scary thing to admit, but I think there... in a relationship, especially if you're married, you just have to have that trust and comfortability. To be honest, if you're feeling any sort of insecurity or jealousy, that those feelings are fine. It's how you handle them that's the problem. And it's like, oh, should I go with this job?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And if he was just like, I feel weird because he was your ex and I know that it's fine. And then she would probably have responded with, oh dude, like don't worry about it. We can talk about this.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
But instead he went right to that. Right. So.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Right. It'd be interesting to see them in person, too, because this is her self-assessment. And yes, she's talking about examples with her husband, but it's just interesting, because there are plenty of people who just, their self-image is so different from reality that you don't really know what's going on.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Our next story comes from relationship advice. 28-year-old woman writes, my husband, who's 31, thinks I'm cheating because we went through a box of condoms. How do I bring it up without sounding defensive? My husband and I are both pretty low libido. We aim for intimacy maybe once or twice a week on average.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Because of that, we don't go through condoms very fast, or at least I thought that was the case. Recently, I initiated, and when I reached for an empty box, I told him we were out and would have to wait until tomorrow. He got all confused and said, how did we already go through a whole box? I kind of laughed it off at first, but then he seemed genuinely upset, saying the math doesn't add up.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He pretty much implied that I must be cheating because we couldn't have gone through them all with just the two of us. Now I'm the one upset. I have never cheated and would never do that, and it hurts that he'd even go there. I thought our pace was pretty normal, but apparently he's convinced something isn't right.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I even offered to go over the timing with him to show that we've just used them as expected, but it's clear he's still doubting me. I get that maybe he's feeling insecure or there's something else going on, but I don't even know how to start unpacking that with him when I feel like my loyalty is already on trial here. Has anyone else dealt with something this weird?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And then I cheated, and I got 100. There reaches a certain point when it comes to cheating on a test where it's actually more impressive... the manner in which you cheated than actually knowing the information that you're being tested on. Right, which is critical thinking. You made a new language.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
How do I talk to him without sounding like I'm projecting slash defensive slash affirming his doubts?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Blowing them up, making a balloon. He's putting it over his head and blowing it up.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
That makes me wonder if her husband is like stating that to her. Like, oh, we just never have sex. We're low libido because we only have it twice a week. Um, Yeah.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
His mattress baguette, you know?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, unfortunately, what if he's dumb?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
What if he's dumb, which is fine.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
But you can't respond like this.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's also disrespectful to her to think like if she's cheating on him that she's just gonna like use the same condom. Right, the house condoms? Yeah.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I don't know if this applies necessarily here, but I actually think sometimes the most suspicious thing is when someone jumps to cheating as an assumption right away. And I'm like, why is that your first assumption?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And I do think it's a common thing you know, with cheaters to be suspicious of it. And I don't know, that's interesting. I don't know if this just happened like last night and she's writing about it or if this has been an ongoing thing. It depends on how long he doesn't let this go.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I... Yeah, I... I'm gonna be a little bit of a conspiracy theorist here. A little bit of a Reddit conspiracy theorist. I don't love how confidently she was like, yeah, we're low libido, we only have sex once or twice a week, followed by his immediate suspicion has me wondering if he's like, yeah, we barely have sex. We only have sex once or twice a week. And he's also suspicious this quickly.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I'm not gonna say this, because I only have this story, but this is kind of cheater behavior in some way. Comments, once or twice a week sure doesn't sound like low libido. If you hit twice a week frequently, you are easily above the average. He needs to explain himself as to why he is doubting your loyalty, and I would tell him that straight up.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Less worrying about how you come across, he insulted you, put a big mark on your marriage, he needs to answer for it, not you. Someone else said, instead of defending yourself, refocus on the fact that if your husband believes you are cheating on him, then there is something deeply wrong with your marriage.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's not about trying to convince him that you're faithful, it's about him making the accusation. Lastly, someone said, the one who is accusing the other of cheating is usually the cheater themselves, at least usually on these Reddit stories. Careful, OP, he might be projecting.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
In fact, if he persists in accusing you, consider turning it around onto him, especially since he refused to go over the timelines with you. Yeah, there's no update on this, but I'm highly suspicious of this guy.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Based on this info. Okay, the OP responded to a comment, and I think this gives me all the context I was looking for. She wrote, I'm going to start marking the calendar on the days that we do have sex. I hate to have to track it, but he does have a tendency to pester me after three days and tell me it's been a while, and I have to remind him that it really hasn't been. I knew it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Right. Well, we'll be talking mostly about romantic cheating.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
No, he has convinced her that they're low libido. Yeah.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I hope I'm wrong, but I guarantee you, if she does find out that he's cheating on her, he'd be like, well, you never have sex with me. Absolutely. Absolutely.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
That's what I think is going on. All right.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yes. Wow. Apparently a lot. Disgusting.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Next story. This comes from Relationship Advice. What was that? A 40-year-old man wrote this. I started to cheat on my wife, who's 38, but stopped halfway through. Do I still tell her? What? No!
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I stopped halfway through. I only did a little cheating. My wife and I have a great relationship. My wife and I have a great relationship. I can't say I have any real complaints. We have been together for five years, married for two of those, and up until now, I would have said I would never stray.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I was away for work last week, and while I was in the hotel, a young woman, 21, sat next to me and began to flirt with me. I was extremely flattered by the attention. I have to admit, it was a real ego boost to be flirted with by someone so young as I've started to get that middle-aged dad bod and have been feeling like I'm losing my looks a bit.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Are we ready for our first story?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
After a bit of talking, the woman invited herself back up to my hotel room where we began to have sex. For me, it was all about the thrill of being desired by someone other than my wife, especially by a very young woman. I was slightly drunk and I figured I'll probably never get the opportunity to sleep with a 21-year-old again. Ew.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
But the thrill wore off very quickly as I realized that I wasn't enjoying myself. Wow. When I'm with my wife, she's all over me, talking to me and telling me how hot I am, grabbing me, touching me, getting on top and so on. I feel like the hottest guy in the world when I'm in bed with my wife. With this girl, I felt like I could leave the room and she might not even notice, let alone care.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Here we go. Am I the asshole for being very upset that my wife is helping her friend cheat on her husband?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
She seemed like she just wanted the ego boost of a guy finding her attractive. I couldn't stay aroused and I stopped about 10 minutes into it and asked her to leave, which she did. I took a shower and then called my wife to hear her voice. Now I'm back home, and so far I haven't told my wife about any of it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
There's a guilty part of me that says I should because she deserves to know, but another part of me says why should I torpedo our happy marriage and cause her pain for something that I didn't even enjoy and will never do again? All it did was prove to me that I want my wife more than anyone else. I want to do the right thing, but I genuinely don't know what the right thing to do is here."
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I know that I will never, ever stray again. Should I tell her or keep it to myself?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I'm going up to your hotel room. Hmm, I don't know how I'm gonna feel about this. Right. Right. Uh-oh. I hope I say okay to that.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
OP is saying that their wife is helping her friend cheat on her husband.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Unbelievable. Halfway through, he's there. He's just like, I understand now.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So the person, the guy writing this in, he's like, my wife is helping her friend cheat on her husband.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
There's no halfway. Yeah, the second he's engaging with her in any sort of real way, but especially the second that they are walking to the hotel room is for me, it almost doesn't matter
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
That's the decision that you made. And he could have stopped it there. And it still is like, you need to absolutely have a massive conversation with your wife. And it probably is gonna be severe and suck. He's talking about it like, oh, why be honest with her? That'll torpedo. It's like, you torpedoed it. You already torpedoed it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's going to be... I think it's going to be... There is less of a chance if you don't talk to her. I can't say it would be for this situation, but in the limited knowledge that I have on the research and stuff is that what tends to happen when someone cheats, and especially with affairs, but it's like... it actually weirdly causes resentment in the cheater.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Because their partner doesn't know, and it creates this disconnect for them. And it's this rift that's going to grow between the two of you. It's impossible to really move on from and be in any sort of real relationship. It's so disrespectful to her. How he's even contemplating not telling her is a whole other thing. This is awful.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Or the lack, or it will be that issue where, and it's this weird thing, I'm gonna butcher this, but in psychology, doing a bad thing can actually make you worse, because your brain then has to justify it. So then your brain morphs to, that was okay for me to do, and now that's where you're at. And it's like, these things grow in ourselves.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's why you kind of have to, you do have to acknowledge and treat things in your own head to mend it, almost like it is a wound that's inside of your own self, like a moral wound, and you kind of have to be like, wait, that's wrong, I have to acknowledge that and work on that.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
A while ago, my wife and her friend went on a weekend trip, which seemed fine. Turns out the friend didn't really want to go on the trip. She was meeting a guy, her best friend, her soulmate. Apparently these two have been messaging each other for years. My wife didn't know this, but obviously found out about it and told me, but she just ignored it because it wasn't our business.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I think it's clear to say that this guy is only thinking about himself, not just in the cheating on his wife, but that he considers sex incomplete or not full the way because he didn't finish. It's entirely an act for himself. A lot of bad signs. Let's see what these comments. Oh, I'm excited.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It sounds like you only regret having sex with this other woman because she was bad in bed. If this 21-year-old was incredible in bed and better than your wife in bed, would you have stopped in the middle? Someone else said, you didn't start to cheat. You cheated. Hard stop. You worded it this way to make yourself not sound bad. Let me say it again, you cheated.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Don't forget that you said you didn't enjoy it because you felt she wasn't that into it. Would you have felt bad and still stopped if you thought she was great in bed? Again, you cheated. Lastly, someone said you didn't stop because you felt bad for cheating on your wife. You stopped because you were disappointed in the sex. I think that says a lot.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
If she had been good in bed, you likely would have done it with no second thought. You didn't start to cheat on your wife, you cheated on your wife. She deserves to know, don't act like you're doing her a favor by not causing her pain. Tell her you're delusional.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Oh my god. Here we go. I really took a beating from Reddit when I made my first post, so maybe some of you will be happy to read this update, maybe not. I was still not sure whether to tell my wife what happened or not after making the post.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
This is not because I'm selfish, like some of you said, but because I was struggling to find the logic in telling her something that would hurt her when she didn't need to know because it was never going to happen again. But I did also take on board what others said about how if it was them, they would want to know and to some point I agreed with them about that.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It didn't end up mattering because my wife realized something was up a few days after I got back from my work trip. as it happens.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
The people who believe that they're gonna get away with shit, you are either being able to get away with it, I think is worse. Then you're even more. What does it say about you? Or two, you're not gonna get away with it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
My wife realized something was up after a few days after I got back from my work trip. She brought up how I'd been very quiet and seemed off ever since getting back, and she looked and sounded so worried about me that I decided in the moment to tell her. I didn't want us to have any secrets from each other. I loved you so much. loved, past tense.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I asked if she could really just fall out of love so quickly, and she said yes. In the space of a few minutes, I had gone from the love of her life and the man she wanted to grow old with to just another sad man having a midlife crisis. We talked for most of the night, but she wouldn't budge. She turned down my offer
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We didn't tell the husband. It was a weird WTF kind of thing. Oof. Oh, puppy poopy. Am I the asshole for being outraged, feeling betrayed, feeling that our marriage is a fucking joke, and frankly wanting to end it? If her and the girls make such a farce of marriage and help each other out and cover for each other cheating, what the fuck is our marriage?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
marriage counseling or counseling for just myself i suggested we take a short week's break so she can think about things but her mind is made up we are filing for divorce and in the meantime i am sleeping in our spare room so she can remain in our marital bed this is not how i wanted any of this to go she is without a doubt the woman i love and the woman i will always love and if i could go back in time i would lock myself in my hotel room for the entire work trip
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
and only come out for the conference. I hold hope that she might one day change her mind all the same. Our connection is too strong to be destroyed by 30 minutes of poor decision making.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's a little more than that.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And she's like, you're on Reddit?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Which doesn't help in his promise that he's never gonna do this again.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I hear what you're saying, and the tough thing is that this is a post written by him, and it's tough to know because he's in the after phase of having done this. In the phase where I think he is trying to justify it to us as much as he is his wife. So it makes me question the legitimacy of all these things. What actually did happen between him and this woman and then the hotel room.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's hard to know. And the problem is his wife is now in a situation of like, I thought I knew you and I don't.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And that's really tough. And some people, I think, immediately know, like, oh, I know myself enough that this is done. She thought she was married to someone who would never do this to her, and she found out, oh, I actually don't know you because that's who I thought you were, and now it's not the case.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, it's one of those areas where like cheating is such a weird sphere where it's like you're not a murderer. Right. But as far as a relationship goes, like... You've murdered the relationship. Like it's as bad as it can get before becoming full-on crime territory. Yeah. I...
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
To me, it's one of those situations where I'm like, this is the commitment part of it, where, you know, yeah, in our life we fluctuate, we do all sorts of things, we make mistakes, whatever, but I think it's a situation to me where I'm like, this is an easy promise to make to someone and to hold them, just like, look, man, this is a hard line thing, just don't do this.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And I think the problem is they're 40, I wonder how long they've been married. It could be many years, it could be they've been married for 15 years. So they made that promise 15 years ago and they go, yeah, for sure, we're never going to.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
They've been married for five years. And I don't know how long they've been together, but, you know, I think some people, they get into some situations where they go, well, I'm in a situation where I've been feeling bad about myself and we haven't been talking or whatever. And they justify it. And to me, I'm just like, it's one of those where it's like, it's just make it a rule for yourself.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Absolutely. Because it will destroy it. No matter what, it's going to be a bad outcome. Just... no matter how right it might feel in the moment, just say no.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, yeah. To have someone tell you that they cheated on you and try to follow it up with any sort of excuse or justification, I think it would have been either way, but it makes me wonder had he not followed it up with all the excuses and justification, if it would have been different at all, probably not, but it's certainly not what you wanna hear. This is such an unreliable narrator right now.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
My inclination based on the wife's reaction, I think this is all, many degrees worse than what we're getting. Absolutely. All right, it's time for our final story, and I've been hearing about this one all day from our producers. No!
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Here we go. Did he cheat, or did I catch an STD from a koala?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
This is what we're about. This is a 27 year old woman. My husband who's 28 and I have been together for five years after being friends for most of my teenage years. We have two sons and this took place in March of 2020 when I was three months pregnant with my second child. I had gone to my 13 week scan follow up after the ultrasound alerted something wasn't right.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I fully expected the worst, but my GP just said they could see something on the scans with my fallopian tubes. Nothing was wrong with the baby and wanted to get bloods and swabs done. When the results came back, my GP called me to come in urgently. That's when she showed me that my tests had returned positive for chlamydia. I was shocked and my GP knew I had been with my husband for years.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
She was my doctor all the way back when my first son was born. She knew all of our history. She straight up asked me if our relationship was monogamous and I of course said yes. She gave me the rundown of treatments and scripts telling me that my husband would need to come be tested as well to confirm before he too would likely need treatment. All with a look of pity.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
She was thinking it, I was thinking it. My partner had cheated on me and given me an STD. I'm furious and heartbroken, but I go home and take a hot shower scrubbing myself clean. Then I sit down in our home, our family photo hung on the wall mocking me, and call him.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I am seriously considering telling my wife that she can make her own decisions, but they have consequences. And when she returns for the fuck fest cheating weekend, the locks will be changed and the divorce papers will be pinned to the front door. Oh. Yai.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He is at work and I'm crying on the phone explaining that I've just been to the doctors and gotten results that I'm positive for chlamydia. And how could you do this, you bastard? All the works. I hang up and he is calling me over and over, but I'm trying to calm down as I have to collect our son from daycare and still be put together as a mother somehow.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I ignore his calls and go about my day utterly crushed. I'm giving our son dinner when he comes home. He comes into the house and sets his stuff down loudly and throws his keys at the wall. He sees that I've got our son so he just walks into the bedroom and slams the door and I hear the shower run. I'm confused and even more hurt because I don't know what I was expecting but this wasn't it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I finish feeding our son and bed routine then settle him to sleep. It's about 8 p.m. by now and I'm exhausted but I go to the room to talk to my husband and he is sitting on the bed holding his head in his hands crying. I walk over to him and say, I don't know how you could do this to me and our family, but you've given me an STD and you also need to get tested and take this medication.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He looks at me, eyes red raw, yelling that I am a sick and twisted person for cheating on him, getting an STD and then blaming him for it. I have never cheated and I hate cheating. It's a disgusting act to do to someone you love. But he is adamant that he has also never strayed and our argument ends with us waking up our son so I go to settle him.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
When I came out, he had packed a bag and was leaving. He said he was going to stay with his parents for a bit. He left, I cried all night. The next few weeks were hell. He tested positive, obviously, both of us accusing each other. It got to the point that I asked if he wanted to separate because I didn't see how this could be resolved since neither of us would own up.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He said he would tell me the answer if the pregnancy I was carrying truly was his after a paternity test. We went and got the tests and of course it was his child. We went to therapy, which never really solved anything. He eventually moved back in,
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
All of our history combined with knowing that at the end of the day, I love this man and didn't want a broken family was a big part of why I eventually decided to just accept that he cheated and wouldn't own up to it. We just moved on with life. I loved him and a part of me thought him admitting it would be worse. I'd want to know names, faces, details, and ugh.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
As more time went by, I became okay with leaving it. So it's more than two and a half years later now, and Adam is scrolling through TikTok when this reel with Robert Irwin comes on. He was talking about how the biggest threat to koala populations is chlamydia. I swear if a light bulb appeared in his head, it would have shown out of his ears because I saw him start to piece things together.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He now has come to the conclusion that he thinks he did give me chlamydia, but not through cheating. Back in mid-late 2019, there were huge bushfires in Queensland. OP lives in Australia. In September, Adam and I attended the Bohemian Beat Freaks Festival, and along our drive into camp, we came across so many koalas that had been displaced.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
The event was nearly canceled due to fires burning near the site in the weeks prior, so these koalas were just by the side of the road, exhausted. At one point, we pulled over, and Adam grabbed some water for these poor guys. One little fellow was so thirsty and exhausted, he was holding onto my partner's arm as he drank. And yes, Adam picked this koala up and gave him a cuddle.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And yes, the koala proceeded to pee all over his shirt and arm. We laughed it off, moved him off the road track, and continued on. Now, being a festival in the middle of the bush, there are only showers that you pay for. We were not planning on using it to shower until the last day. He had taken off the shirt and washed his hands with bottled water.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We arrived and set up camp and then went to a party and forgot about the koala completely. Over those days, we had sex a lot. Yeah, writing this now, I realize how gross it all sounds, but that's the culture of Aussie Bush doofs. And we were young parents who had a rare break from having our son. So we go down a rabbit hole of research and find out that, yes, you can catch it from koalas. Fuck me.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Adam is so fast to make an appointment at our GP's office. We show up and explain everything. And even she agreed with him that, yes, it is possible that is where the STD could have originated from. We were completely asymptomatic so we could have had it from then and then it was only detected during my pregnancy. So now we have an explanation and my husband is all for it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He says it all makes sense and I can see how he has changed since then. He is more relaxed with me, more trusting, but a part of me having thought it was from him being unfaithful has stuck. Our relationship has still been okay these last few years, but I'll admit it's been strained. Our sex life dwindled a lot and we both became almost toxic with each other in terms of who the other was talking to
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
or texting, always feeling on edge when the other was out alone, et cetera. He would randomly come out with, you can tell me the truth and I'll still love you, so many times that it would spark an argument. And our friends who knew the story had ditched us long ago thinking that one of us was a cheater and the other was stupid for staying.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We learned to keep this part of our lives private to avoid all the bull crap. Since finding this out, it's like my husband has changed again. He is back to the loving, affectionate, caring man he was before this started. He has accepted this explanation so easily. But now, how do I wrap my head around that my husband did in fact give me chlamydia, but from a fucking koala?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Right, right. Right, because it's one reaction to go, oh, she's cheating on him, that's her business. It's another to be like, I will go with you on this trip so I can be your alibi so you can lie to your husband. That is a whole new beast.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And how do we undo all the toxic crap that has been between us and move into a healthier, trusting relationship? I still in some ways feel as if he cheated on me, and I'm not able to completely let this go because truly, Unless he says something different, I'll never really know, and this seems too convenient to the whole situation to put me at ease. I just don't know.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It sounds crazy, but this has been my life for nearly three years, with this new information stressing me out again these last six odd months.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, let's sit in that for a second, guys. Let's hold space for koalas.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
That's good. Ooh. Wow. Wow. Okay. Wow. So. Yeah. I'm a little curious. I've been to Australia, but I don't know Australia too well. Is this not something that a doctor would be like, hey, we do also have koalas around. Right. And they've all got chlamydia.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
How could I have gotten chlamydia?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I mean, I guess, to be fair, besides koalas, there really is only one way.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I think I knew that koalas carry chlamydia. Now, to be fair, a koala did pee all over him. And he didn't bathe. And he didn't bathe.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah. Huge. Thank you. So, I mean, that's a lot that happened. Right. I'm also of the... I mean, man, like, you handle a wild animal. A wild animal pees on you. You might want to go to the doctor and make sure that you... Didn't catch anything from that. Right, right. So. Yeah, yeah. Wow.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It really is peculiar. What is, this is a fascinating story in that They likely didn't cheat on each other, but they lived through three years of thinking that they cheated on each other. Yeah. And does that not do the same damage as... And that is damaging. It might as well have happened. Right. And they did also see what they would do if they cheated on one another and just moving on from it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
They desperately need couples therapy because what they've now gone through is pretty rough.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
The koala seems more believable to me right now. Yeah. There's one comment here. All right, so I searched it up because I was curious to see if it was true. And well, yeah, it is. This is what came up for those who don't feel like searching it up yourself. Yes, koalas can give chlamydia to humans.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Chlamydia is a common sexually transmitted disease in humans and a different strain of the bacteria can infect koalas. This strain can be spread through contact with an infected koala's urine or feces. Now, different strain. Will it still pop up on the tests in the doctors as chlamydia? What does that mean? Like, does that mean it is the same chlamydia or is that going to be a different chlamydia?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We have one other comment. A comment above says it's a different strain in koalas. Could the lab tell which if they still have the results? Would that strain even show up on a human STD panel? I'll say more therapy is needed now though and it seems like time is needed too as this is a newer adjustment to your reality.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
The trauma you both felt for years is real and your body can't tell that it was based on something that may not be true. OP responded, I don't know, but this is something I'm going to ask my GP next now. If there are different strains, surely they can tell on a test. I might have just found the actual concrete answer I've been looking for. Thank you. Wow. Update.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
She's getting paid 3K to do this? That she will pay probably about $3,000 for the sole purpose of cheating on her husband again. Oh, so the vacation costs $3,000. The vacation's free.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So if... Sorry, I haven't read anything. If it's not koala chlamydia, if it's not koala midia. Koala midia, then it's cheating. If it's not koala midia, then it's not only cheating, it's like now we're at nuclear levels. That three years later, he found an excuse on TikTok and was like. Got it. And that means he put his face down and cried lying to her.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Ladies and gentlemen, bring out the koala. Koala walks out.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
All right. What are your bets? Koala chlamydia? Regular chlamydia?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It is not great options to choose from.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
No, they're not. Okay. I sat my husband down last evening and spoke about how I'm feeling now that we know the truth. I talked about how much pain I've been put through with him accusing me and vice versa, and I apologized for my part in things, told him how much I loved him and how happy I was to finally put this to rest now that we both know there is nothing between us.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And then he starts fidgeting and getting upset, and he tells me that he cheated. Whimsy is dead. Yep, I know, but he still didn't give me the STD, he says. In the months, oh, fuck. No. In the months after finding out, yes, our relationship was in a really bad place, when he wasn't living at home at that time, he went out and had a one-night stand with a girl from a pub in the town over.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And the wife isn't getting paid. The wife is not getting paid. So it's not for 3K.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He explained that he genuinely believed that I cheated, and after a few drinks, he decided he was going to end things with me. so he went ahead with sleeping with this girl. It was his way of getting back at me. Plus, he was convinced that our baby wasn't his, so he was really in a broken place.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
But the next day we met up and this was the day I brought up separating and he said that instantly he had a regret and felt as if things were even now. He decided he would stay if I did a paternity test and the baby was his, which he was. He thought that if I was never going to tell him I cheated, He would never tell me either.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He only told me now because he realized how stupid he was and wishes he could take it back, but he can't. Now this koala knowledge has left him feeling guilty. I asked about the girl and he says he only knows her first name, hasn't had contact with her since, and she means nothing. But my God, this blows.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
But you're just getting a $3,000 vacation for free. Right, right, right. To go with this friend.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Remember how I said in my post that since finding out my husband is back to his caring affectionate self? Well, now I know why. He was trying to make up for his mess up and people were mad at me for not instantly accepting that my STD could have come from a koala, but I swear there was a part of me that instinctively knew this. Maybe that's why I was holding on.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It all feels hollow, I feel numb, I'm sitting on a park bench right now while our sons play and I just don't know what to do. Cheating is a deal breaker for me and I never slept with anyone. I never considered a payback tit for tat move against him. So why did he do it to me? I'm heartbroken and a part of me wishes we could go back to before all of this happened. I can't break up my family.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We have two kids, two dogs, two cats, two cars, and a house together. It would be a mess, but I don't know how to take this on now. He could have told me this six months ago when we first found out about this new possibility, but he didn't. He waited until I poured my heart out to him in an apology to dump on me this confession. I can't look at him right now and he knows it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I guess I'll take a few days to process and then decide things, but I'll probably stay. I love him so much even though this has broken a little part of me I just found again. Oh, well. I get that a lot of people are now convinced my husband is some sick sadist, but I genuinely do not believe that is true. I don't think he manipulated me for years.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I don't think he gave me the STD or cheated before all of that crap happened. I do believe the STD came from the koala. Why admit to things now if not? Before, yeah, he felt justified, but now he just thinks he is an idiot for doing what he did. I believe him when he says it was the only time it's ever happened. And if people think I'm a fool, that's okay.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I'm processing this all in my own time regardless. But the way I see it, we had a really unfortunate thing happen and the STD planted doubt. And he fucked up. But the way it came out shows me that my husband is dedicated. Man, I really skipped over writing about our actual conversation when he confessed, but it wasn't manipulative at all. It was raw and ugly and in no way did he blame me.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
He only kept repeating, I really thought you cheated and I'm a fucking idiot and I'm so sorry. I'm going to take the advice of a few people who have said I should take a break. I've asked him to go stay at his parents whilst I think things through and take time. And yes, I did say that cheating was a deal breaker for me, but my actions have shown otherwise.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So that's something I've learned about myself. Maybe that was just an ideal that a younger me that viewed the world in black and white held on to. But now I've experienced how life has much more to it, and I guess now that it's not the case anymore. Another person said that the stages of grief aren't linear, and it seems as if I've started at acceptance. Maybe that's true too.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Either way, a break, some hard conversations with the therapist, and my own choice will be the determining factor in the fate of my marriage.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So it was the one we didn't consider.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Where it was both. So we did find out that the koala did give? The koala did give him chlamydia.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So technically, if we're talking about the situation before the chlamydia, no, they never cheated on each other before then. He got chlamydia from a koala, gave it to her, they had chlamydia, they both assumed each other was cheating on each other. He then took that as, well, she's cheating on me, this relationship's over, my son's not even mine, I'm gonna get drunk and sleep with someone.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Then they... kind of just go back to being together, moving past it for three years. Then he finds out, oh, she never did cheat on me. And now I cheated on her.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Giving koala. This is Australian Shakespeare.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
She's... she is allowed to do what she wants to do, right?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
This is, yeah, I mean, this is that classic friend situation, you know, where it's like, it's the Joey that we were on a break thing.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Oh, Ross and Rachel. I thought it was Joey.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
You know, it's like when George. But like, this is such a unique, I think everybody would have a completely different strategy. Absolutely.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's, yeah. This is truly tragedy, tragedy level insane story. I am so curious what people, in the comments would say they would do. Because I just think it's all over the place.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah. When they go to a couples therapist, that therapist's head is going to, like, spin around.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So... I don't think a koala did that to you.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
That's all I got to say. That's my takeaway. This is a huge wow.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
These have been some stories.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Well, thank you both for being here. Thank you. Thank you. Talking through your stories with me. Guys, March 8th, we'll be doing Smosh Reads Reddit Stories live at the Dynasty Typewriter Theater. You can watch the live stream by going to live.smosh.com and getting tickets. It is going to be so much fun. We hope to have you there watching us online.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And also, we'll be back, as always, next Saturday. So we'll see you then. Goodbye.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I think it's hard for me to picture because I have a hard time imagining any of my friends cheating on their partners. I think it would be a situation, too, where if a close friend of mine, which it would be shocking to me, if they were like, I'm cheating on my partner, I think it would be a situation of like, As their friend, I would feel it's important for me to be like, you need to tell them.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
That's my advice to you as your friend. And I don't think she's doing that, obviously, in this case.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
It's like, hey, as your friend, that's part of my job as your friend to be like, you need to do this.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And it is a situation of if they're like, no, I don't care, whatever. I'd be like, this changes how I view you.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah. You're not who I thought you were.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Now, this obviously, we're not talking about that. We're talking about far, far past that.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
And also, the dynamic between the wife and her friend is one thing. It's how the husband feels about it. And he's nervous now. What does this mean?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I think, what I do think is this is jumping pretty far past what he needs to do first, which is talk to her. Right. And go, hey, I... have a massive problem with you doing this. If you do this, like, who are you?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Exactly. I could see the wife and friend justifying it by being like, this friend's husband is shitty or has been ignoring her. That's a situation where I understand where we don't know what's going on with certain dynamics. I still think this is not how you go about it.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
There's a better solution. There's always the better solution, even if that is divorce. And this is just full-on dishonesty here. And I mean, I think certainly if I was in this husband's position, I would be feeling the same way. I'd be terrified. Verdict was not the asshole. Comments, not the asshole. Ask your wife if you were cheating, would she want people to tell her?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Fair, and the answer's always yes. Another comment, my friend, you know your wife is happy to facilitate cheating and that says a lot about her and none of it is good. If you continue to trust your wife would never cheat on you, then you are thicker than a mattress baguette. Mattress baguette?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, show us. Show us the mattress baguette.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Lastly, not the asshole, divorce her. If she would assist someone else cheating, you can bet she would have no problem asking her friend to do the same for her. I think my question is, what if he talks to her, he goes, I have a massive problem with this, don't do this, this makes me uncomfortable. She goes, you're right, I'm not gonna do it, I'm gonna stop. Is that enough?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Because at this point, you're already like, oh man, you were so willing and had no problem doing this. Now that you know that I have a problem with it and you dial it back, is my trust still there?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I wish the rest of the comments were just like, mattress baguette?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Right. So our producers have Googled mattress baguette and we've gotten zero hits.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Our next episode is called Mattress Baguette Stories.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Yeah, I mean, for me, with every Reddit story, unless it's something really extreme and dangerous, I'm always like, talk to them.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
You know, you gave us less than a page of information, and there's always going to be a ton of comments saying, divorce her. It's like, well... you're married, talk, unless everything leading up to this was completely empty and worthless, have the conversation if you actually trust each other and decide if you still trust her.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Is it more of a mattress or more of a baguette?
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Is it edible? The problem is baguette was the last word which infers that the mattress is the adjective.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
So it must be a baguette. Baguette. That is mattress. That is mattress.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
No, there isn't. Our next story comes from relationship advice.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
Hello and welcome to Smosh Reads Reddit Stories. I'm Shane, and today it's a genre that we love to hate, cheating. And I am joined by two people who also hate cheating.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
This is a 34 year old woman. My husband who's 30 said I wasn't attractive enough to cheat on him. Question mark. My husband said I wasn't attractive enough to cheat on him. My husband is gorgeous, everybody says so. I consider myself pretty, but unremarkable. My features aren't exactly supermodel material, but I do the best I can with what God gave me.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I have nice skin thanks to skincare, a decent body thanks to the gym, and so on. But compared to my husband, I might as well be a troll. Even my own mom thought my husband must be gay and in the closet or hiding sketchy things because of how much more attractive he is than me. It's the first thing people notice when we're out.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
I've had women flirt with him right in front of me and have had two girls I know try to get with him behind my back. I even question why he's with me sometimes. I'm insecure about it, but my husband has always said that he loved me and thought I was beautiful and did not listen to other people. Yesterday changed everything. I bumped into an old boyfriend from college.
Smosh Reads Reddit Stories
Cheaters Never Prosper | Reading Reddit Stories
We parted on good terms, and it turns out he's doing very well for himself in his career. I'm looking to change jobs, and I'm pretty decent at what I do. We exchanged LinkedIns. There was nothing inappropriate about our conversation, and I would have no problem if my husband was there to hear it. My husband started an argument the minute I came home.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Welcome to Reddit Stories. I'm Shane, and today's theme is all about revenge. And I'm joined by two people who I plan on getting revenge on. Wait. Chance and Courtney.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
This is some, and he's that hung up on it. I'm like, it honestly makes me, look, I'm just vamping a little bit here. Okay, go off, Keith. He's talking about how he's had so much luck with women since then. I'm like, I'm questioning that. Like, if you're really, if you were actually out and having success in the dating scene, but you were still so hung up on this person, I'm like, come on, move.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And anyone who says I've had so much luck with women, it's like, Luck with women sounds like you sleep with a lot of people, not you're dating a lot of people. You're in a lot of healthy relationships with a lot of people. It sounds like maybe he's done some work on himself. He's gotten into some shape. Maybe he's, I don't know, some things, but there's some work that needs to be done.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Okay, next story. This comes from Petty Revenge. Mock me for not going to a strip club? Wait until your wife finds out. Okay. Let's go. This sounds like revenge. This sounds like revenge. I'm gonna say early, snitches get stitches. Okay, let's go. Okay. A bit of a backstory, but it makes the revenge even better. I've worked in software sales for the bulk of my career.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
About 10 years ago, my company was hosting its annual user conference in Las Vegas. As a sales guy, I pretty much had carte blanche on expenses as long as it involved clients. Expensive dinners, drinks, tables at clubs, et cetera. The only unbreakable rule was we couldn't pay for strippers. Having been in the industry long enough, I realized what guys would do to get around this.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It was common for them to explain to a manager at a strip club and then they would have the girls tips added to the bottle service. Even with that in place, I never thought it was a good idea to play that game, nor did I think it was a good idea to go to a strip club with clients. It was never a good look in my mind.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I was roughly 27 or 28 at the time, and one of the older guys, late 40s, Jim, was the typical sleazy sales guy. He would tell half-truths to prospects, overcharge them, oversell, etc., the type that creates a hassle for the services and implementation teams. But he still got paid, so he didn't care. And when he got to Vegas, Jim would go crazy entertaining clients and himself.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Sometimes he would go to dinner by himself, but say some senior VP was with him, and he also abused the stripper loophole. One of the reasons he tried to get a group to the strip club each night was that he had a very conservative wife. She made the kids go to a local Christian school and the family went to church every Sunday.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
She hated the annual trips to Vegas to the point he would tell stories that he wasn't allowed to bring his suitcase in the house. He had to leave it in the garage where the laundry room was and she would wash his clothes and then sanitize the washing machine. On the last night of the conference, he organized a shuttle from one of the big strip clubs to pick up a group.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
There were some open seats he was trying to fill to meet the minimum commitment for free entry to the club. Jim saw me speaking to a client and invited us, but I declined. He started mocking me about being scared of pretty ladies, or that I would probably nut the first time one of them touched me, et cetera. This would have normally not bothered me, but he did it in front of my client.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I stated, I don't wanna go because I don't think it's professional. He left, I bought my client another round, and we joked about the douchebag. Then I was on my own and decided to walk the strip a bit and head to bed early due to an early morning flight. If you've ever been to Vegas, there are people on the sidewalk handing out cards that are essentially ads for escorts.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
They legally can't speak to you, so they slap the cards on their hands to get your attention. All right, here we go. When he was out of sight, I added those escort cards in his bag. When his wife went to do her laundry routine when he got home, she was not happy.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Oh yeah, let's see. All right, our first story comes from Petty Revenge. Cab driver rips me to shreds thinking I can't understand him, but I can. Oh, see. Classic, classic. Obligatory, this happened several years ago. A few months after I moved to Chicago, I had moved there from Romania where I'd been living and going to school.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
She didn't believe in divorce, but they were suddenly going to church three times a week and at a weekly counseling session with their pastor. This also led to Jim dropping out of his weekly golf league. He was telling us all the story at the office looking for sympathy, and he swore he never took those cards, but couldn't remember since he was so drunk.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Whoa. This is interesting, because Jim is an asshole. I hate him. Jim sounds pretty awful. So this is... It seems like the story is inferring that the wife is already well aware that Jim is a piece of shit and is doing all sorts of stuff. That she's like, leave the bag out in the garage and we're gonna wash all your clothes and then I'm gonna sanitize the washing machine.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It seems like the context clues say that she's like, I know you're messing around and don't bring that sin into the house. It's also like, I know you're going to the strip club. It's not, I know you're going home with an escort. That. which is where the line gets a little tricky, because I'm like, oh, he kind of framed him for something that he didn't do. Right.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Which I'm like, oh, that's kind of weird, too. You probably should, also, it's not your, get out of his business. Like, you might not like Jim, but it's not, you're not an arbiter of justice here. You're not fucking Batman. Like...
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
You did it, dude. Yeah, he doesn't know him well.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And it does sound like she knows things are going on. The story makes me think that. Yeah, at least she knows that he's going to the strip club and she's like, if you're going to the strip club, I'm gonna wash your clothes outside and then sanitize everything. Yeah. If you're sleeping with someone, that's something different that she might, apparently is not okay with.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Based on even just reading the story though, Jim has cheated on her for sure. Come on. Jim is like, he's like a play from the 1940s. He's just like, dude.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It could also be heavily exaggerated. He was telling you this story at work looking for something. He was saying that Jim is spouting all this stuff at work and that seems very possible. A lot of these types of dudes are, it's so funny, 50 to like 60 year old dudes we'll just tell you fucking everything. They'll tell dudes everything. They'll just start spouting off.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
So I actually believe that he is telling them all this. It also sounds like this is a little pent up and that he's hated Jim for a long time. So he's finally got a chance to just kind of fuck over Jim. Jim's probably disrespecting him on a daily basis.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah, sales, software sales.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Actually, yeah, I think they do.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
love romania people are great drop what you're doing and visit anyway while i was there due to my living situation i had to learn the language fast and thoroughly not many people around me spoke english outside of the uni i was at so fast forward to the few months after i arrived in chicago Imagine my surprise when the driver of the Uber I had ordered appeared to have a Romanian name.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I do feel, this is the thing that's tough, though, is like, he's getting revenge on Jim, but he's also kind of, he's affecting Jim's wife. Yes. Like... That's what sucks here is you're actually, probably who you hurt the most is Jim's wife. Because Jim doesn't seem like he gives a shit. Well, yeah, well Jim hurt Jim's wife the most. That's also fair, yes.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Jim is hurting Jim's wife, but it's like, what are you really doing here as an exterior force? It feels like there's a lot of behavior here that should just actually be brought up to the boss.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
That makes more sense. You are at this job with this coworker and that's like an HR type of thing. That's something that can be solved. You're not involved with the wife at all or you shouldn't be. Comments here. Someone said, beautiful. Did it occur to Jim to be more respectful of his wife and employers? Of course not. Someone said, not so sure it's petty revenge, but it sure as hell is revenge.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah, this is a little bit more of like, that's a little more nuclear. You're impacting a marriage. That's not petty.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
You know what this makes me think of? When I was a kid, my family would go to Vegas. And you went to the strip club. was a kid, I've never been to a strip club. I've never been to a strip club either. Oh my god, should we go to a strip club, you guys?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Bring them in. I'm trying to think of what age I was. I know I was definitely a kid, but they would hand me those cards. And I was stoked.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
You were stoked? I love trading cards. And also, Naked Lady. Escort trading cards? Oh, boo!
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I think it'd be epic to make a game out of it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Attack plus three, yeah.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Sparkle! That's incredible. They were epic looking.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
They're like censored too. I've never seen them. They're crazy. They never hand them to me, why not? Fun fact, you have to be on the right side of the strip too. They can't pass them out on the side with the Bellagio and stuff. And I'm on the left side, am I right? Anyways, moving on. I don't even know if they still do it. They do. They do?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
We were in Vegas not that long ago. I was just in Vegas a couple weeks ago.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
We were on the left side. Because we're family. We're on the family side. Family.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I feel like if you and I really went to Vegas for a couple days, we'd end the trip and your bag would be filled with them. Am I wrong? And my bag would be filled with those big grenade drinks. Still full. I did not. I did not. All melted. Can I tell you that I've never gotten one of those? And every time we've gone to Vegas, I'm always like, it'd be so funny to walk around with one. You have to.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
The area had a lot of Eastern Europeans, so I guess it shouldn't have been so surprising. I was really excited to talk to him and make sure I wasn't getting rusty. Maybe make a friend. Up pulls the guy, I get in, he greets me, but he appears to be on the phone with a buddy slash family member, so I just sit quietly in the back, listening in a bit.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Chance, I cannot believe, you would, oh wait, no, you said never been to a strip club. You've been to Vegas. I've been to Vegas, yeah. I don't like Vegas. See, I don't love Vegas either. It's kind of crusty. I'm not a gambler.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
You've seen me roll dice. Awful. Yeah. Terrible. Anyways.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And you have not denied it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Okay, okay. Next. Am I the asshole for hitting on my girlfriend's friend after she insisted on not telling them I'm her boyfriend?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Wait. So her girlfriend's not telling them he's her boyfriend. So he's like, oh well I'll hit on your friend then. It's one of those things where I'm like, what do you want to happen, dude? Like, what are you hoping for here? Okay, let's see what happens. Let's see what the story is.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I'm like, claim me, bitch, want me, love me, choose me. I see that, also fair. My girlfriend and I have been official for a few weeks now. She hasn't introduced me to her friend group yet, which I didn't think much of at first. We were all set to hang out, but before that, my girlfriend said to me not to mention we were together. I asked why and she said because she wasn't ready for it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
For that night, I was okay with it. Afterwards, I told my girlfriend that I felt like crap and that I wanted to be seen as her boyfriend. She said not to worry and that she will be ready soon. But the second time she asked me to not mention it again, I was annoyed, but I agreed not to say anything.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
During that second time, I overheard one of her friends ask her if there was anything going on between us. She said, I was just a friend. I was hurt, to be honest. I knew what I agreed to, but it hurt to hear her say that. Later that night, one of her friends approached me and started hitting on me and asked me if I was into my girlfriend. I lied and said we were just friends.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
We spent the next two hours talking and lightly flirting. I didn't kiss her or anything like that, but did playfully shove her. I wasn't planning some revenge on my girlfriend or anything, but it felt nice to have someone flirt with me. My girlfriend was pissed. She said that I crossed a line with her friend. I told her we were just having fun and nothing happened.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
We got into a fight and I'm feeling confused now if I should apologize or not.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
The person on the other end asks if the driver is getting off work soon. He responded with something like the following. Yeah. was used to it, but I was a bit shocked that this guy was going off like that. Anyway, I'm just kinda sitting bemused in the backseat as we near my destination.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
This, in gay world, this happens all the time, where you're like, this is my friend, and they're like, okay, and you're at a party, and then people start flirting with your friend, and you just have to be, I have learned to just be okay with it. Like, if you're not going to claim it, other people are going to flirt, that is what happens.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Hell yeah. Okay, well there's now why I need to get revenge, because you just did that. Welcome to Reddit Stories. Okay, you guys are giving me the reasons. Welcome to Reddit Stories.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah, I mean, he didn't... I mean, we'd have to... You'd have to see it to be like, what was this level? But, like, the friend also doesn't know, so she's doing that.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And it's the second time, this is not the first time. She's introducing him to her friends. That was the first time, this is the second time.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
This is interesting. I kind of feel like he has the right to ask her, why are we hiding it?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Give me a reason, because I can't think of a good one. Why are you, I personally, I talk to my friends about any boy that I ever, I'm like, there was a boy in Costco today. Like, I'm communicating, and so, like, my friends would know that already.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Exactly. This is, and she's not telling her friends anything. Sounds like it. Because her friends are flirting with him, so she's keeping this fully open.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
This is kind of the consequence of.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And it feels like a little bit, she's kind of friend zoning him. It's like she's prepping two friend zoned him. She's like, I don't want anyone to think that there was anything between us, so when I do friend zone you, it's gonna be fine.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
What if he was just like, I was just pushing her away because I wasn't trying to be with her. And I love that he's communicating what he wants and how he feels, and he's like, you don't want that, I'm ready to compromise. And he's hearing his girlfriend say, oh, we're just friends, which is hurtful. And so now someone's there flirting with him, it makes him feel like, oh, I feel wanted here now.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
The verdict was not the asshole comments, Bro, go for the girl who will flirt with you in public. That means she'll hold your hand in public, kiss you in public, be with you in public, treat you like you deserve to be treated.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I don't know. That means... Yeah. That means she'll hold your hand in public, kiss you in public, be with you in public, suck your dick in public, treat you like you deserve to be treated. They wrote, no, I'm just kidding. Leave the girl who thinks that you are somebody who has to stay in the closet. Respect yourself.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Someone else said, I can think of a few reasons why your girlfriend would hide the relationship. None of them are good for you. One, she's embarrassed of you. Two, she's not serious about the relationship. Three, she wants to be able to meet guys while hanging out with her friends and no one will question her on it. Dump her and get with her friend, not the asshole.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Well, there's also the possibility that she hasn't fully wrapped up something else or something. That she also hasn't told her friends about. Yeah. And her friends aren't even questioning it, unless the friend is flirting with him as a means of getting her to finally admit something. Ooh.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Last comment, not the asshole. Honestly, I would date the friend and stay friends with your girlfriend. Jokes aside, get away from this mess ASAP. Yeah. I think it's, I think what's just fair is like, okay, until we can publicly tell your friends that we're a couple, we're not officially together.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Like, we're dating until then. Like don't lock yourself down if this person's, this person does sound like they're not trying to lock it down.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
A few weeks of being boyfriend and girlfriend. They have been, yeah, official for a few weeks. Official for a few weeks, which means they were talking before.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It's weird. Poor guy.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
There's also like, I guess you don't owe it to anyone to tell them you're official. But if they're your friends, why would you not? It's also, it's interesting that she's, like her relationship with her friends is interesting to me. Where I'm like, okay.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah, what's real here?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
We're all just friends. That's probably what's going on. Okay, our next story.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
No update. Our next story, Petty Revenge. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Then I tell him, in Romanian, with all my might trying to pull off the distinct accent of the region I'd been living in, can you just pull over there on the right? I swear this guy's head did the exorcist girl's head move. And he turned a shade of red I have seen nowhere else in nature. He didn't say anything, just pulled over.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
When I got out, I said thanks and added, you're not attractive and you're also fat, so maybe you shouldn't make comments like that. I have never again reached such levels of self-pride. That, I changed my mind about revenge. That's not even revenge. I was gonna say, that's not revenge. That's the situation that he put himself in. She informed him of the reality of the situation.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
She was in full, yeah, she was right all the way.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Thank you. Thank you. Thank you.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah, it's such a power that people who speak multiple languages have, is you probably end up hearing people talk shit when they don't know.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
No, no, no. She's just poking the back of his seat.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I've told this story before, but one time I was on a flight and I was watching District 9 and I had headphones in and there was this guy sitting next to me and I could tell he was watching my screen for a long time and District 9 is shot like documentary news style and he taps me like 30 minutes in and he goes, he's like, and I take my earphones out and he's like, is this happening right now?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And they also said it in English. They really wanted us to know. Ugly bitches. Have you seen those headphones that they have now? That automatically translate? I want to try them. Challenge Pit, we tried the headphones.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And you go, you go. No, it's a, I'm like, yeah, I should have fucked with it. I was like, yeah, you're not hearing it. You should turn it on. Can you believe this? Here. When we land, shit's gonna be weird.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Imagine. Oh, it was because I was, I was, it was from South Africa. I was on a flight from South Africa. Whoa. And the movie takes place in Johannesburg. That's crazy. Have you seen the photo? There's this incredible photo. So you know how, like, a lot of those games, you can play them online, like, you can play them against people in the plane? Uh-huh. Oh, yes.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
So there's a great photo of a guy playing Battleship, and he's like, does the guy, does my opponent know that I can see his screen? So he's just killing him in Battleship. Cheating. Yeah. Thank you. But it's funny. Yeah. Okay, comments. I have seen people on a plane applaud a couple times.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Once when some jerk got thrown off the plane before we ever got off the ground, and once after the pilot landed us safely after a particularly bad storm situation. Someone else said, The executive tells the VP his name and title and then fires him on the spot, stating that they expect better behavior out of their executives.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Lastly, someone said, this may be the best petty revenge I've ever heard. Thank you, OP, on behalf of all of us. I might add, I don't think it's petty. It's just correct. Yeah. Yeah. I mean, she, she, I think she was going to get fired if this somehow miraculously didn't fire her. She was going to get fired. Rotting fruit. I'm also confused. Are, are they allowed, do they have to keep serving you?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Right. Can't they cut you off? And why did they cut off the whole cabin? Like, I'm just like, I didn't know that. I thought, I did think that there was a two drink limit on planes. No, there's definitely not a two drink limit. I, I. I guess I don't drink on flights just because flights already make me feel like shit and I worry that if I drink I'm gonna feel like more shit after.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Challenge Pit, we tried the headphones. I'm just someone who assumes a lot of things about people. I assume people understand. I would, if I was in another country or when I've been in other countries, I'm not talking trash because I'm like any, to be fair also with English, like it's just such a widely spoken language. I assume people know it a lot of times.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
The only time I drank on flights was actually when we used to fly to Sacramento to film sketches.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Not on the way there. Well, I mean. Well, sometimes on the way there. Sometimes on the way there because we'd land there and then we would go to bed and then film the next day. The next day, yeah, you're right. But we would get drink tickets because we were A-plus preferred because we were flying so much. But it's a 45-minute flight.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
So they literally will come by, get your drink order, they will bring you your drink, and then literally less than 10 minutes later they'll come to get the trash. So I will order a beer and quite literally chug it. That's what I was doing. I was like, can I get a Modelo?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And they're like, they hand it to me, and I'm just like, and they'll literally, they will tell you, they're like, you need to drink that fast, because we're going to be right back.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
No. We would all sit by her. I would sit by myself. Keith and Noah would sit next to each other. And fight the whole time. They would fight the whole time. Yeah. And then maybe you and Olivia.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And then I would just be like, I'm going to go sit by myself. And I'd sit there and I'd chug a beer. That was me back then, baby.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Oh, yeah. Bloody Mary on a flight. That sounds like it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
But Bloody Marys don't count. What? I'm just kidding.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Bloody Marys don't count. You can just have those whenever.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
All right. I liked it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Okay, our next story. Am I the asshole for struggling to forgive my husband for his petty revenge on me? I feel crazy. So the husband got revenge on her and she can't forgive him for it. But that means she did something first. He got revenge. And now she can't handle it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Now that years later. And I will also say, she could have done something and not meant it to be bad, but it still hurts. And then he gets revenge. Right, exactly. And it's the intent for me. So I wouldn't be able to get over the intent either. So let's see. Let's see. My husband, who's 34, and I, 32, 32-year-old woman, have been married for six years.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Two months ago, I stopped him from going on a bachelor's trip with his long-term school friends. I was okay and was kinda looking forward to him having fun until I learned he hid the fact that they would be doing a lot of adult-themed activities, think strippers and happy-end massages, as a part of their itinerary.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It caused a huge fight, as we've always maintained that this is a deal breaker for me, and the fact that he hid it from me made it worse. He argued that he only did it because of my tendency to overreact. And of course he wouldn't engage in those activities, but that didn't mean he couldn't go.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I would have been fine with him going if he told me about their itinerary and trusted the fact that he would keep away. What he did broke my trust and the only way I could see him earning it back is if he voluntarily told his friends that he couldn't come, which he did. At the time he looked really apologetic and we made up. He took me shopping and it was all good. Thank you for watching.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I'm confused. I just tried them on in the store and I'm a size 14, as the label on the dress said. So no, I didn't get the wrong size from the store. Then another dress was tight, same with the pants and other tops. I start feeling absolutely crazy. Had I just put on so much weight in a matter of a few weeks that my new dresses didn't even fit? I thought he must have noticed if I'd put on weight.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I was a wreck. I was feeling crazy for a few weeks now. Even the clothes that I had before felt tighter. I don't know if it was a placebo or real, but it didn't help. My husband a few days ago during dinner said he wanted to confess something. He was snickering while saying this, and what he said absolutely crushed me.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Wow. I'm not offended. You heard it here. Shane Top assumes everyone knows English. Just kidding.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
He said that while I was gone to see my sister, who had just had a baby, for a week, he had secretly taken all my outfits that he knows I routinely wear and gave them to the local tailor to make them a size or two smaller. I'm sorry. It's been some time since he confessed and offered to get them stitched back to original size. I'm struggling with what he just did. I want to forgive him.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I never knew how resentful he was of me about that trip. Maybe it's my fault. I should have been more trusting. I knew he would never cheat. In my heart, I knew he would keep away. And from his POV, his petty revenge on me probably feels deserved. I would be mad too if he stopped me from doing something I was looking forward to doing. But still, if you were me, how would you feel?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Has anyone had their spouse do petty revenge on them?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
That's like some Joker shit. Also, first off, you stitch things to be a smaller size. I don't feel like you can stitch them to be a bigger size. I don't think that's how shit works.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
No, he ruined all her outfits. That's crazy. Which is also expensive. Why is he expensive? What?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Like when I was in Japan, it's just like, oh, a lot of people just spoke English. Like more than you realize do. So this guy being Romanian probably just thought, what are the chances?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Her swearing up and down that he would never cheat, but I'm like, but he wasn't telling you about all this stuff. Also, there's some activities, like happy end massages. I'm like, what the fuck are you talking about here? Definitely suspicious activity. Like, talk about that normal bachelor trip behavior. That's crazy. Like, go play pool. Hell yeah, man. And his reaction is really bad.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
He was keeping it a secret and then he's like, oh, I wasn't telling you because you overreact. I just can't wrap up my mind, wrap up my mind around someone that would put so much effort into something so unfunny.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It's not funny at all. It's not, like, it makes her go crazy. Oh my God, yeah. It is also establishing, like, establishing you're getting revenge on her I don't know. It implies that, oh, I was doing, there was nothing wrong with my situation. But it's like, you kept something secret. Like, you actually really hurt her first. I don't know. This does not sound good. No, no, no, no.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And you fucking know that if she was going on some trip where there was gonna be, like, some hot dancing dudes or situations similar to this, the flip, this guy would not be cool with it. Just know that, based on his behavior here. Yeah. Um... The verdict was not the asshole, which is not surprising. Comments, not the asshole. To recap, your husband is a liar and cruel.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
There she was. Comments, I live for this brand of revenge. People shouldn't assume they're safe to talk shit just because it's not in English. Or people should just not talk shit. Don't talk shit.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I don't understand how you can watch someone you love suffer and think that's funny. Someone else said, that was a calculated, time consuming, and expensive act meant to hurt you where he knew you were the most vulnerable Oof. Oof. Yeah, this guy's a piece of work.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
That is so crazy. That is crazy town. It also costs money. Amelie's a little crazy. But what if they deserve it?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
In like a cute way. Oh, Amelie, what?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah, he's like, I'm fucking ripped. He loves it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
He's like, aw, man, my little ass.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Um, okay. Anyways. All right, our last story from Am I the Asshole. Am I the asshole for sending an explicit video my ex sent to me to hurt me, to her family? Oh no, you don't do that. Okay. Hi. Hi, am I the asshole? I'm going to try to make this as brief as possible so I don't ramble. I dated my ex, Em, for a year and a half.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Don't talk shit, man.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I took it too far. It's okay. I do sound like that. It's time for some revenge. How do we feel about revenge in general? I think it's very entertaining to listen to stories of revenge. I do not like revenge. I'm not someone who seeks revenge.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
During this time, I confided in her some personal secrets which I don't feel comfortable sharing even anonymously. Because of these, she knows that there are certain things, related to sex mostly, that I am very sensitive towards. We did not part on friendly terms after our breakup and we don't talk anymore. Aww. Aww. Aww. Am I the asshole? Whoa. Okay. Whoa. Okay. Okay.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I don't think it's revenge of any sort. No. Yeah. Someone else said, this hits home for me. I'm a middle-aged white American who looks very much like my Irish ancestors, but I'm also fluent in Spanish and Haitian Creole. I'm a social worker, so I interview families nearly every day, and one thing I look for is a form of domestic violence called coercive control.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Wait, why did they, they broke up because why? She cheated on him. She cheated on him and she freaked out.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Once again, this revenge is not...
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It is not helpful. Yeah. It's not going to make you feel better. It's not going to bring you the peace that you're looking for.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It's so, this ex sounds like a nightmare. Yeah. This ex is a horrible person. And now it's in the workplace too? Also horrible.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
She's being a nightmare to him. She's doing everything she can to hurt him. I totally understand that that's so painful and so awful. The thing is, sending unsolicited messages. sexual video or imagery to someone is illegal and horrible to do. And then in return, he did that to a bunch of people who did not ask for those images or those videos.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
He could have said like, she's sending me explicit videos If he went to them and said, I want you to know, to her friends and going, she is harassing me. She is sending me footage of her, she is sending unsolicited videos to me. It is so painful for me. That is within his right. But him just blasting this out there is...
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It's too much. It's a shitty thing to do to those people. Yeah. And that's why I'm not surprised the verdict is everyone sucks here. Yeah. Which is a rare verdict to get on Am I the Asshole? Mm-hmm. comments here, everyone sucks here. This is a pretty clear-cut case. Your ex is a terrible person who is acting despicably, but you crossed a line in sending that to her family.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
They did nothing to deserve being dragged into this situation. Someone else said, everyone sucks here. She was an asshole, which is legal, but revenge porn is not. If she wants to bring the cops into this, you're absolutely fucked. And she sounds like someone who's waiting for that opportunity.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Everyone sucks here. This girl sent you an unsolicited explicit video, so to get back at her, you sent a bunch of people an unsolicited explicit video. You did to her friends and family exactly what she did to you. Yeah, look, there are so many situations in life where someone is being horrible. And it sucks that the best thing you can do is to block them and to do your best to move on.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Sometimes you'll have one partner who is fluent in English and uses that to control the other partner and when I suspect that, I'll only speak in English and listen to what the couple says to each other while I look on pretending I don't understand. Then just a few minutes before I leave, I'll start speaking their language and watch their faces as they realize I understood them.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And they will make it hard for you. They will, but like...
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
On a standalone thing, he has a legal case there of being sent unsolicited videos to him but he's blowing that by doing this. I mean, I don't know legal jargon as well. I don't know what the case is there. All I know is that this is not gonna be good for him.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It's not fixing the situation at all.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah, it's just not the right move. Well, that's rough. That's brutal.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I do feel bad for OP and his ex sounds like the worst person on the planet.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
But this is less, it's more a matter of like you can't, you're doing this to other people though. You're almost getting revenge on other people. Yeah. I'm trying to punish her. That's kind of my take on it.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Yeah. Well, this has been an episode full of revenge.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
None of them. I don't believe in revenge. Nice.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
What's the difference between avenge and revenge?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Avengers, if someone's been wronged, you will avenge them. For them.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Is you. You're directly at the person. Reflect.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
This makes future visits much more productive. Someone said, aunt-in-law worked in a place for years and the Japanese women there talked shit about her behind her back slash in Japanese for years. At her retirement, she gave her farewell address in very fluent Japanese. One might imagine there was some loss of face with compound interest. Yeah, that's awesome.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Avenge me! Avengers!
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I think that's a thing. Thank you both for being here.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And thank you all for watching. Let us know in the comments down below if you've ever gotten revenge and what that looks like. And also let us know what other themes and subreddits you'd like to see on this show. And we'll see you next Saturday.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
To let that go on for years, that goes into revenge. It's like, okay, you're withholding it for a long time on purpose, but it's also delicious. Delicious. Like The Prestige. The Prestige. You guys know that movie with Christopher Nolan and Christian Bale. Christian Bale. You just call him Amanda. Christian Nolan?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Oh, yes. All right, our next revenge. This comes from Am I the Asshole? Am I the asshole for rejecting a girl as revenge?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Interesting. So to start off maybe, it was a bit petty of me to be honest. Anyway. I asked this girl Clara out on a date about a year ago. I was a completely different person then, and she turned me down. It stung like hell, but it did encourage me to better myself. Since then, I've gotten in better shape, became more confident, and generally I've had more luck with girls.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I still never forgot what made me improve though, and that will always be a shitty memory. Me and a few friends I've made since last year went out to a gathering. I'm still fairly new in their circle, and surprise, Clara was there. I think she recognized me, but I wasn't sure. Me and her hit it off, and at the end of the night, we had a date planned.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
The date went pretty well, and we went on our second one last Friday. Oh. What does Reddit think? huh, this is complicated.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It's also, like, But he didn't say that. I think he would say that if she was like, and turning you down wouldn't be the shitty thing. It'd be like, she made this comment. But he doesn't reference anything. He just says, yeah, she turned me down and it stung. He didn't turn down stings, but that's a situation where you get hurt, but the person didn't do anything wrong.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
They didn't do anything wrong. And then he goes and improves himself, quote unquote, like he improves himself is what he said. And then she's like, well, now I'm interested. Which is a fair thing because he's a different person now. But also, she might have turned him down because she didn't know him that well. And now that here they are talking, they hit it off.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
It's an entertaining trope. Here's what I like is karmic justice.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
My thought is, okay, you're also like, who is this revenge on? Is it on yourself? You're saying you're hitting it off. You're on a third date. It's actually going well. And you're going, nah. It'll be better to just make you feel bad. Yeah. That's the thing.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Couldn't get over it. I don't think this counts as... This doesn't count as revenge to me because she didn't purposefully hurt him, but he's purposefully hurting her. So actually, you're the bad guy here. I think he is the asshole because you're the asshole because you are purposefully making an action to make someone feel bad. That is an asshole move. Like, that's almost all revenge, though.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I like when you're not putting the intention into the revenge, the revenge just kind of happens. And there's a lot of times, though, where I think people go, oh, that was karma. And I was like, no, that's just the natural progression of events from making a bad choice to that. But I agree.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Right, but it's... Revenge is... It's you make me feel bad. It's quote-unquote fine if someone truly, like, went out of their way to wrong you. Yeah. That's why I also don't think revenge is... I'm a revenge person. I'm a person of what will make that person realize the wrongs of their ways, right? If you can do something and they go, oh, my God, I now see how I was being shitty...
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
then okay, but if you're just doing something to hurt someone, what's it gonna do besides schadenfreude?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I think it's weird. I'm just like, okay man, you went on three dates. It's also not equivalent. It's like, if you really wanted action. But what did he do back, he just? But he went on two dates with her and then in talking about the third date, he ghosts her. And I'm like, what you're doing is not equivalent to what she did.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
She turned you down, but you are making, you're doing this elaborate thing.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I don't think he was doing it on purpose, right? He says he realized.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Does he owe her that? No, he didn't have to go out with her. He could decide, oh I'm actually, but I also think he's an asshole for his wording of things. Forgive her. She didn't wrong you. I don't like this rhetoric that he's giving of a woman turning me down means she's a bad person. No, that's within her rights. And you don't know why she turned you down.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
You're not giving us that context, so we have to assume it could have been for any reason. She maybe just wasn't in the zone to date at the time, maybe for whatever. But you're talking about it like, she's a piece of shit for turning me down. It's like... She doesn't owe you anything. I don't like that, man. I don't like that.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
But maybe now that he, in his head, which is fucked up too, he's like, now I'm hotter, now she wants me. Yeah. That's his mindset. That's his mindset. That's the reality he's living in. Yes. That's not the reality that might be happening. The verdict was asshole, which I think is completely fair. Comments, you're the asshole. Revenge for what?
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Do you think she had some obligation to go on a date with you just because you asked? Not only that, but you organized a date, then flaked and ghosted her? Damn, man. That isn't just an asshole. That's like a post very hot curry level of being a raging asshole. Oh, curry. Damn.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Wow. Wow. I've never heard that.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
You were like, mm, yummy. Mm, hot. Mm, delicious. Someone else said, you're the asshole. She wasn't attracted to you then. You've changed. She is attracted to you now, or has learned to see beyond looks and is attracted to you as a person. Nobody is obliged to go out with someone just because they have a good personality. Looks matter, and first impressions are often made with looks.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
Someone else said, I think, you know what I think would have been fair? Is if he was hung up on, you know, she turned me down then, I did this, I look different now, and now she's dating me. Is this just a looks thing? Like, I don't know how I feel about this. You could talk to her about that. You know what, there's something I'm a little hung up on.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
You turned me down a year ago, now we're hanging out, it's our third date. what is different? Yeah. Like, what is different? And that, if someone said they were gonna do that, I'd be like, you're within your rights to do that. That doesn't make you a bad person. But ghosting someone for this, I'm like, what are you getting out of this? Yeah.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
And it would also have been fine if he just was like, I'm hung up on this, I can't get over this. But the way he's wording it, I'm like, no, you're coming from a weird place. I think it's clear she dodged a bullet. His viewpoint on their dynamic. Oh, absolutely.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I think that's a take I have on revenge, which is I, especially if someone wrongs you and you spend a lot of energy and effort in getting revenge on them, I'm like, all I think it signals is that you are still hyper-focused on them. Yeah. On someone who doesn't care about you and is disrespected. I'm like, the best thing you can do is just focus on yourself. Yeah. But we'll see.
Smosh Reads Reddit Stories
What Goes Around Comes Around | Reading Reddit Stories
I think it is a lot that he is so hung up on it when this isn't someone he knows really well. He has clarified like, oh, they're hitting it off now, this is their third date, but this is not someone he, it's not like, oh, we were friends for a long time, or we're really close, so the heartbreak might hit more. He's like, I asked this girl Clara out on a date about a year ago.