Menu
Sign In Pricing Add Podcast

Grace

πŸ‘€ Person
726 appearances

Podcast Appearances

CreepCast
Best of Creep Cast 2024

Yo, Kimber's dad, you shouldn't have got that shitty ass sandwich shop to cater. This shit sucks. Yo, your wife looks mad funny in that box, dude. You didn't pay for that, did you?

CreepCast
Best of Creep Cast 2024

Jesus, Lynn! You, uh, played hide-and-seek?

CreepCast
Best of Creep Cast 2024

All right. This is a four-part series here.

CreepCast
Best of Creep Cast 2024

Every time, dude.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So we're on the same page. Now, my one note for Anora was that – I think I was being a little like, I'm from Brooklyn. I'll tell you how to talk if you're from Brooklyn. And part of her accent, I'd be like, I don't know if that hit. Because something like water, she'd be like, water. Yeah.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

You could just tell that she was a girl from LA doing a very good Brooklyn accent. She's a phenomenal actress. Phenomenal. But I was also like-

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

like for her to go from hi i'm mikey madison i'm so excited to be a part of this film to talking like this yeah you motherfucker yeah i mean honestly it was so good it was low-key a dream rule for me and i think i was jealous okay i was like that was for me and it's so big of you to admit that and that's how i feel about ariana grande and just maybe jealous of her

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

No, but people are saying that she's dressing like Aubrey Hepburn. Audrey, did I just call her Aubrey? That's okay. That would have been, I'm so sorry. It's okay. It's not my mom or anything. Wait, Aubrey would have changed her whole brand. Whole brand. Yeah, but she's dressing like with the little bang and stuff. Yeah, which I did first at the CFDA Awards, but. No, we're not comparing.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

We're not keeping score. No, we're not. We, for anyone in a relationship, not you, for anyone in a relationship.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

how like I never, I'm gonna say it, how no one asks me when I'm gonna have kids and that me and you will be getting interviewed and they'll be like, Paige, when are you gonna move to Charleston? And then the crowd like kind of groans and I was like, oh, like rest in peace. And everyone was like, ah!

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And I'm like, but then they'll look at me and then go back and be like, Paige, when are you gonna move to Charleston? I'm like, I'm fully married.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

But also I do have to say, It is so hard to be in a public relationship. Doesn't that thrive by people not asking us questions about us? Right now. Imagine having your worst friends commenting on what they think your relationship's about. That's what the internet is.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I'm like, wait a moment. Imagine your shittiest friends hanging out with you and you not telling them anything about what's going on with you, but they saw you. And then they go in the cab and talk to their friend gossiping about you, what they think's going on. and you can hear it, that's the internet.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

But like based off of no information.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Okay, guys, I just learned that my skin is really dry and oily, not to brag, because I don't exfoliate enough. So it's like all this buildup is happening. So when I try to moisturize, I'm just putting it over like dry, gross skin. And that's why I'm obsessed with First Aid Beauty's facial radiance pads.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

If you struggle with patchy or dull skin, cakey makeup application, these daily use facial radiance pads are so convenient. And it's good because I could just like put it in my routine where sometimes I'll buy like an exfoliator and I literally forget I have it. And I love pads because I feel like there's no way I'm going to miss any part of my face. It's pre-soaked.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So all you have to do is swipe and go one step makeup prep. They brighten and help refine the pores. It's actually really important. If you have similar skin to me, I would definitely use these. See the difference First Aid Beauty's facial radiance pads make for your complexion? I know you'll love them as much as I do, and right now I have a special offer just for my listeners.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Get 20% off when you visit with my exclusive URL, firstaidbeauty.com slash giggly, and use my promo code giggly. That's firstaidbeauty.com slash giggly. Don't wait. Get 20% off with promo code giggly at firstaidbeauty.com slash giggly.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Like, if there's one thing- You were never out here saying, I represent New York sports.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

If the color matches my shoes, I'm wearing it.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And I'm not trying to turn it on people, but do you not support women in the arts and small businesses, actually huge businesses, but do you not support women entrepreneurship?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Wow, I just got like.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Can you Google titillated? I feel like that was the wrong word too.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

No, but it got me so excited because she's so fucking talented and she's being, what does it mean, Chris?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Yeah. And that was right.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Wait, Kristen, I will buy it. Can I buy a Knicks or a Mets or a? No, she only does NFL.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

She's expanding as we speak. No, as we speak, she's taking over the world. What I was going to say about relationships... that you wouldn't know about is that my latest thing is yeah, the concept of keeping score. Like I was talking to my friend who was like, you ever feel like he accuses you of this and then you didn't do that.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So my new line is, are you keeping score? Because I'm not keeping score.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I'm illiterate, and I don't know numbers.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

We try so hard not to get in trouble. It's actually a miracle.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

We will listen to pause.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Wait, I saw your face. You look, because with me, you never feel like you're in trouble.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

You literally were like, what did I do?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

But we did have fun with our dads at the Knicks game. It was like a full circle moment. Mm-hmm. To like, we took, we got those tickets. We took our dad to those games.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Yeah, and Paige the whole time was making fun of our brothers, being like, where are they now? And your dad loved it.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Do you feel like when you're hanging out with my dad, it was kind of like hanging out with me at all? Exactly.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So Paige's dad and Paige are sitting and, like, so calm, collected, look great. Wait, I have another story.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

What's up, my golden gigglers? Wait, Grace said we have to do something professional. Okay. Oh, yeah. She said we have to promote our upcoming shows. Nashville, New Orleans, St. Augustine, Hollywood, Florida, Tacoma, Portland, Las Vegas, Salt Lake City.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And he likes a one-on-one. When I'm one-on-one with him, he's chatty, shy, chatty. But if we're in a group, he plays security guard. He stands by the door. He makes sure everyone is okay. He's looking at the exits.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

The funniest moment was he turns to my dad and he's like, so you guys eat a lot of Italian food? Yeah. And my dad was like, I mean, yeah. And he goes, but like every night is your wife making Italian food? And my dad's like, not every night. I mean, we have like Chinese sometimes. And he goes, yeah, Kim likes Chinese, but I just want to eat her Italian food.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And I was like, this is the sweetest conversation.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It was so U-coded as we all went up. My dad and I ran to the buffet because we were like, we're getting our money's worth.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

These people are going to lose money on us at the buffet. And I look at your dad and he was like, I'll just sit here. I'm a little, you know, I'm not in the mood to eat right now.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

He didn't even like walk over to the buffet.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And our dads are so opposite. We were sitting next to two actors and my dad never stopped to think like, oh, maybe these are famous actors. Yeah. He's shooting the shit with them.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Which I hadn't seen, but I recognized him.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I have to. Yeah. But my dad, the ball goes into Skylar's hands, and you have to give it back. So he gives it back, and my dad's like- what, you're not going to let me touch it?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Next time the ball bounces again, Skylar gives it to my dad. My dad's spinning it on his finger, having the best time. The time of his life. Time of his life. Me and my dad had one beer. We were drunk and we're like trying to get the players to look at us. We were like, Jalen, you're doing great. He noticed me. Like that's what we did the whole time. It was so much fun.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It was like super. Oh, can I make a PSA? There was a video going around of someone filming us and it got to me and I gave him the finger. Yeah. Not that everyone thought it was a giggler, but that was not a giggler. I would never give the finger to a giggler unless that was an inside joke. Right. That was Chris DiStefano who deserved the finger. Of course.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

He's another comedian and he was infringing on my personal space.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And he wanted the finger.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So I gave him what he wanted. Mm-hmm. And... No, I love a Knicks game. We love a Knicks game. We did wave to Chris and Trey Songz that we were waving at him. So now we're in a band with Trey Songz. And the neighbors know my name.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

We're people's inside joke. Like they don't talk about it on the internet. It's just like we're in their head.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

You have to get a, I have to be honest, I haven't voted yet because it was like, you have to sign up for iHeart. No, the admin, I was like, guys, no gigglers are doing this. Give it to someone else. This is our, if we've ever brought you joy, this, and I will do it right after this. There's a link.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Press it. Put a username password for iHeart. Vote for Giggly Squad as your favorite podcast.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And then we'll party till dawn.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Do you listen to any podcasts? I do. When I used to like walk to work and have a nine to five, I needed a podcast or music in my ear. I feel like with our job now, it's hard.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I do one-offs. I'm also like kind of nerdy. Like I like entrepreneurial pods, like how they built this and like, That kind of stuff. Or like girls who started a brand. Like a couple months ago, I listened to like Mariana Hewitt on a podcast. And I was like, I'm obsessed with you. I love that stuff. Or I like comics talking about like how they made a joke.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I listen to our pod every week. And that's where you're, like, sick in the head. That's where, like, your brain needs to be studied because... I listen to it every week. I can't listen to my own voice. And, like, kudos to all of you who, like, listen to me every week. Thank you.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I like – it sucks, but I realize that like life is just about not thinking about what you're doing because the second you're aware of what you're doing – you fuck it up. But you want to be able to think about what you're doing when you're doing it, but it turns out... No, you want to live, but people don't let you. Look, everyone just get a lobotomy. Things will work out. That's the newest thing.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Yeah, and you'd be like... Beep. Just kidding. Like, people would do the most insane voicemails.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Record, I'm ready. I remember that I had one that was literally me giggling, which is so obviously us coded. It was me being like, this is how to leave your resume. And I did that like in college. And then I started to like apply for jobs. And I remember my mom being like, hey, you have like professional people calling you and you're just giggling in your voicemail. Can you have more professional?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I think I still, I haven't redone it for like 20 years.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Now that you're single, are you going to go to bars and pretend you have a different accent and name? Have you ever done that? Yes. What is with, like, girls loving to do that? Being like, I'm British, my name is Annie tonight.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

100%.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And it's for, like, it's stressful to be yourself. It's almost like when you act as a character, you're completely, like, do whatever you want because you're like, that's not me. He didn't reject me. Right. He rejected Annie, who's honestly kind of stuck up.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Speaking of surgeries, rest in peace to Denise Richards' breast augmentations. Did she get a boob job? Two of her breast implants... Exploded? Wait, ruptured. That was the word they used, which is... Ruptured. Scary as fuck.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I remember when I was on dating apps when I first started Summer House, guys were already like referencing things or like quoting stuff. And it was like kind of weird because you felt like, oh, they already like think they know me. And I don't love that I have to like battle whatever image they think they have of me.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And you're going to have to deal with that like a hundred times worse. Can I? Yeah, I don't want to. If any of these magazine people are listening, can I make a statement? Yeah, I would love it. I love how like I want to make statements.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

before we started the pod Hannah goes okay now look alive don't say anything bad and you're like actually I forgot two things no I just want to talk about breakups and I don't like look at the comments or anything but like can we normalize not being completely destroyed after a breakup like I feel like

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Everyone thinks that like when girls get broken up with or they have a breakup, that's like the saddest thing ever. Like it's actually so empowering. And I've been joking how like when girls go through a breakup, they're glowing the fuck up. They suddenly become like Pilates instructors. They're going to Harvard. Like they change everything. They've read a hundred books.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

When I was at a tennis academy, I had this, like, huge muscle trainer. And he walks up to me one day and he's like, whatever you do... don't get breast implants. And I was like, I'm 14.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

They're asking their friends.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

No, but there's rarely one person that's the devil and one's great. Then why would you be together for so long? But I do have to say, I feel like also in terms of reflecting, I feel like girls after breakups will talk to their friends and be like, how did I end up in this? How can I do better? What's the thing?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And then guys will sit together and be like, who would win in a fight, a bear or a tiger? I do have to say for anyone going through a breakup right now, breakups to me are like corporate jobs. You're not actually going to get a raise unless you leave and get another job. You guys, I was 29, single during COVID, living with my mom, dad, and four cats. She looked at me.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

She looked at me and she had that honest mom moment where she was like, do we want to, like, is there anything you could have done differently? And I looked her right in the eye and I said, nobody got away. Yeah, I feel like that too. Nobody got away.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

The only times I've been broken up with have been like messy situationships. You know, the like two month there that like- Oh, a situationship. Oh, a situationship will fuck me up. Yeah, those are all, I've never, like someone said to me like, oh, are your exes reaching out now that you like got a Netflix special or whatever?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

All my real relationships that have been like over a year have been like two people who know each other that I've gotten out of, thank God.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

those are the ones because you don't actually know them yeah so I made up a whole scenario about this man I don't think anyone's been upset about a breakup once you know the person because you're like yeah I'll miss that but also that I've had guys who I fully have been so into that my mom was like can you break up with them and I would be like okay and then you find someone else but I've definitely in the wise words of Kimberly Noel Kardashian I didn't come this far to come this far and not be happy

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It was like so weird.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

No, I just think there's such a media perspective of girls sobbing in the shower and being like, I'm nothing without him.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I feel like in your 20s when your friends turn on you, you go, oh no, what can I do to get them back?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I need to be cooler. I need to be funnier. What's wrong with me? When you're 30s, when people show you who they really are, you go, oh, thank God. I almost had them in my inner circle.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And I do have to say, sometimes those people will come knocking back But when you love yourself, you go, oh, I will never forget when I was down being like kicked down a dead horse. You kicked me.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It's honestly like so freeing.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Whatever.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I loved it. This was like, you know, was it scary? I was like, I've never felt more protected. Relaxed. I was watching the Jerry Springer documentary. I watched Sex and the City. They put Netflix on.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I am... I did fall asleep the last 10 minutes and it was the most peaceful sleep I've had in a while. So the thing with these body scans is like, when do you scan your whole body? Unless you're like, even when you're getting an MRI, it's normally like just a specific part. So this is like a full body, just checking to see if there's anything going on.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

How many findings? Two. I had four. Okay. Click on it. Wait, are we going to find out something crazy right now?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

See, I got spondyliarthropy of the cervical spine. Mild degenerative changes in your – like there are bulges at C3, 4, C5, 6, and C6, 7 with a mild central canal stenosis. These mild do not need a follow-up if you have no symptoms. But I mean – I think it's okay. You know what I'm going to do? I'm going to check it with Des's.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Because we'll see what Des has.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Oh, like back in Rome, sinaitis was... What is it?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Oh, so you have like a little sinus infection. I have a deviated septum, which is crazy because I only did coke once and I immediately got a nosebleed.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It looks like a head.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Yeah, so it's not that crazy, but... What's the thickness of your endometrial thickness? Where do you see that? I have it in my reproductive system because I just got an informational finding. It says... My endometrial thickness is measured at five millimeters. I just want to know if that's tiny or big. I don't have measurements. Okay, so maybe it wasn't important. I have one musculoskeletal.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Wow, I love that people at Prenuvo are probably like, these girls are too dumb, too expensive.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

They were so nice. Oh, yeah, so they're giving us $300 off for the Gigglers. Okay, amazing. And we're going to put it in the newsletter, but I think it's Giggly Squad. No, it's Pernuvo.com slash Giggly Squad. I have a musculoskeletal thing. We detected a region of bursitis. There is a region of bursitis located in the subcoracoid bursa of your right shoulder. This is a benign condition.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It's probably from serving really hard work. from being a fucking beast on the court.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And weed and melatonin. I took a lemmy gummy.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

If you guys have never seen the Key and Peele sketch. Chris! If you guys have never seen the Key and Peele sketch of football last names, it's the funniest shit you'll ever see on the internet. Wait, Chris was so cute earlier.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Wait, so we're doing a Chris reveal.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I don't know if we have space for him to bring a friend. It's sold out. We'll have to talk to our people. Who's your friend? Who's your friend?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Yes, of course you can bring a friend, but preferably not like bad energy.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And I'm like, is that just Chris's friend that we told him he shouldn't bring? We're doing a Chris reveal for Radio City. Also, my Nana is coming. She already has her dress. She's so funny. I'm obsessed. She bought, she was like, can you get me these boots? Because I wanted to get her shoes for it. And she was like, make sure they're pointed toe or I won't wear them. I was like, you are Paige.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

But like same Zs. Imagine being 83 and being like, I'm not wearing your not pointed toe boots.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Oh, yeah, because she had a stroke. She broke her hip. Like, she's had breast cancer, and she refuses to wear flats.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Wears a choker and has a matching choker for every outfit. They don't make them like her anymore. No. She's stunning. But also, it's the day that she doesn't want to wear stilettos, that's when I know there's a problem. So, like, Nana... Wear your stilettos even though you literally don't have a hip. And that's called athleticism. No, it's not.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I realize like if you just look at me, I look up like a pothead. Like I haven't brushed my hair. I'm giggling and constantly snacking. Like everything about me says pothead. Everything about you says she's hot.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I said that's never happened to me before in my life. Are you going to do Y7 with me one of these days?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Yeah. I also – I sent you – there's a YouTube. I'll put it in the newsletter – This girl does like a 30-minute Pilates that you could just do at home. You just need a yoga mat and like maybe weights.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It was so good.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I was dying.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So if you're gay and looking, so am I. Wait, should there be an app for straight girls to connect with gay boys? Yep. Now that's a dating app I'd immediately go on.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Would you rather a straight guy not like you or a gay guy not like you?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

How do you think I feel every gangly squad live when a gay guy takes a microphone and goes, Hi, Hannah. Hi, Paige. Paige, I'm obsessed with you. Hi, Hannah.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Gay men loved my special. I think gay men who didn't see my Netflix special don't understand me is what I'm telling myself. But I do have a gay male following. It's just I think different kind of male gaze than yours. Yeah. Yeah. I don't know what it is. Oh, also the lesbians messaged me and someone said like that. They said that me and you are a lesbian couple.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Just not sexually. Not sexually. But like we are a lesbian couple and that you're like a femme icon. Like 100% in the lesbian community. And they were just like, we all just talk about you guys. You're like the Ruby Rose of our relationship.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

That's why when everyone's like, who's Paige going to date? I'm like, she's good. She's in a happy relationship. She's been in a happy relationship and supported and cares for her. So, yeah. No, I'm obsessed. We're obsessed with MRIs and the gays. And if Us Weekly says Paige Osorbo and Hannah Burner are dating, see you in court. See you in motherfucking court. Put that on the record, motherfuckers.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Oh, my God. Anyway, yeah. Thank you so much for giggling with us. I added a show in Irvine. Hopefully, we'll be able to do it in Alabama. Catch us outside. In Connecticut. How about that? Catch us outside, and we can't wait for Radio City. Yes. Bye. Bye.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

They were like in for a bit, but they were never- They were in for like a second.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I wore, I think I wore them. This is my thing. I love Crocs so much and I love my- heeled wedge Crocs. So I don't know. If the right sneaker wedge comes across my desk, I will. I'm into the sneaker loafers that are New Balance. Everyone's been sending me and I was like, give me 17 of them right now. Wait, I don't know if I've seen the sneaker loafer.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I've been trying their white noise and sleep sounds, which helps me fall asleep faster and sleep better because it quiets all the chaotic voices in my head.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It's like a silver New Balance, but as a loafer. Wow, we have such different algorithms because this is the only thing on my algorithm right now.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Everyone's posting the funniest stuff of, like, me saying bye to my Chinese spy.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Like... I always... What I do like about TikTok is... it understands me more than anyone. But also what I hate about it is it understands me more than anyone. Yeah, it's intrusive. Yeah, it's super intrusive. I like that it tells me what to buy. Like I don't want to have to search for what I need. Like it tells me like you're going to like this. And I'm like, thank you.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Give me 17 of them right now. But also with the mental health stuff, Not to age ourselves, but we were the WebMD generation. Like, you got a sniffle, you went on WebMD, it told you you were going to die, and that was your fate. Yeah. And before it had to search to be diagnosed with something, where now it just, like, comes at you all day. It's like, do you hate?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Then with all the information, like, It's been crazy to see what size of TikTok I'll be on, where I'll be like, once you see three videos of people saying the same thing, you believe it.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So like the misinformation that's spread is crazy from beauty stuff to politics to current events. And like no one is above like if three of your friends say something, it's a thing. Right. That's just a fact. And TikTok for every all the information that we've been able to like spread that's been great has equally been like amazing. The bullying and the lying.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Have I saved 4,000 workouts and recipes that I've never once gone back on?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I do feel bad for the people who blew up because they are so talented and Hollywood would have never given them a time of day. Right. But the people chose them and they were able to grow that.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

But sometimes TikTok, the algorithm's bad. Like I saw a video of a girl like with a mustache and she's like, would you date the male version of yourself? So I watched it and it was funny, but then it showed me like 30 more videos of that. And I'm like, I don't I'm not that interested in that. That's like my thing now. Like show me girls with mustaches.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So look, there's pros and cons, but not to get big picture here, but I feel like I have a niece. I'm an aunt. Yes. which is very important, I FaceTime her all the time and then hang up when she gets cranky. She is given strict screen time things and there's proven studies about the development of your brain.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

So I think it's starting with kids, but I think in 10, 20 years, adults are gonna be put on a screen

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Get the sleep you deserve with Soundcore's Sleep 820 earbuds at soundcore.com. That's S-O-U-N-D-C-O-R-E.com. Use code SLEEP at checkout and get $30 off S-L-E-E-P in all caps.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I never get mad about... a social media app closing, because we all know social media is not good for us.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

People will be fine. People are telling people where to go, which is kind of, it feels like when you're waiting for a train, and you don't know what the train is gonna be and then they announce the train and everyone starts running towards the train track.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It's funny because mine is like people crying.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Because it's like the LA Fires, which are so fucked up. So fucked up. And then like a 22-year-old crying about TikTok. And I'm like, let's get our priorities in order.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Yeah, we're like vetting because I feel like...

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Because during strifling times, is that a crazy way to describe it?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

I'm not okay. Wait, can we normalize strifling?

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

No, but I didn't realize...

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

It is so funny too with all the technology and we're so advanced. We have cyber trucks that first of all, we can't figure out how to turn on a TV with less than two remotes. Second of all-

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

that like something so basic as fire like we can't yeah it's almost weird like the world will always beat us like right the environment will always be like gotcha no like they didn't have water no it's so scary like that's so fun and there's nothing you could do um but shout out i feel like in la everyone needs to remember like yeah it's huge mansions and famous people

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And then tons and tons of normal fucking people with houses.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

Also, New Yorkers, we all live in, like, tiny apartments. So when people are like, we lost our house, I'm like, holy shit. Yeah.

Giggly Squad
Giggling about boob jobs, body scans, and stoner energy

And also if you're there, they're just saying like the air quality is so fucking bad. So like, don't be a hero, wear a fucking mask. Yeah, truly. Look at me going full mom on people. So I hope Denise Richards' boobs are okay. Oh, and that's how we started. Yeah. She ruptured both her boobs. I watched Anora.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und es war so lustig, weil es war der eine Outfit, den ich hatte. Ich war so, Paige wird ihren Abend verletzen. Und sie weiß nicht, dass ihr Abend verletzt wird. Und es ist wegen mir. Und dann habe ich diesen Outfit aufgemacht. Du schaust mich an und sagst, hey, it's kind of cute. And I was like, that? The full plaid fit.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

So cute. New Yorkers, when we visit any other city, will literally see a sign post and will be like, wait, that's literally so cute.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Es ist so süß. Alles ist süß. Wir bekommen literally eine Platte und ich werde sagen, das ist die süßeste Platte. Wir lieben kleine Dinge in anderen Orten. Aber weißt du, was es ist? Wir gehen nie in die Hotels. Wenn wir in die Hotels gehen und es ein bisschen Sonne ist, sind wir so, okay, süß. Was ist das Job, wenn du... Was ist das Job, wenn es die Studie der Menschen ist?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Das ist, wie wir vielleicht psychisch werden. Besonders mit Izzy Trash, wenn Leute kommen, weil wir so viele Fragen gestellt haben, wissen wir, basierend auf... das Shirt, das sie tragen, ob sie einen Apple Watch haben, welche Art von Socken, wie sie ihre Haare machen. Wir wissen, welche Karriere sie haben, welche Art von PersΓΆnlichkeit sie haben.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Wir sind Soziologen. Wir sind Soziologen. Das ist ein wissenschaftlicher Podcast. Sprechen wir ΓΌber Wissenschaft. Hast du die Wasser-Alien gehΓΆrt? Sind sie in deinem Algorithmus?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

This is why they're pushing Domingo so hard right now on SNL, because they're trying to distract us from the water aliens.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Look, we have an eye for these things. We sure do. And we have an eye for humor. Yeah, the water aliens. Like, hello? What are we gonna do? Are they cool? Are they not? Like, I need some more information.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Sind es ihre Freunde, die ΓΌber sie sprechen? Weil dann sind sie cool. Aber wenn es ihre Feinde sind, dann natΓΌrlich die Feinde, die auf sie sprechen.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Im aktuellen Klima werden wir unter dem Wasser gehen.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

literally me going anywhere in the midwest i'm like so cute i have no interest yeah i'm just i was watching this alien abduction thing on netflix about how this woman was like she's like this italian woman that was just like one day the aliens like put something in my nose and they did x-ray and there's like a little thing in my nose and they're like tracking me

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Kann ich nur etwas ΓΌber das Internet sagen? Das Internet sollte die Wahrheit an die Welt bringen. Und irgendwie ist nichts akkurat. Und alles, ich meine, schau dir das an. Nein, Hannah, nichts ist wahr. Lass uns ΓΌber Mike Tyson und Jake Paul sprechen.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich bin froh, dass Mike Tyson 20 Millionen Dollar gekostet hat. Ich musste keine Γ€lteren Verbrechen auf meiner TV sehen.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Okay, so my toxic trade is, I think I could do a Mike Tyson impression.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

No one's talking about it. No one talks about it. I'm just doing my Andrew Collins with a higher octave. No, but that's why I was scared. Because Jake Paul comes in all flashy. His brothers spraying him with whatever they're promoting.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Was auch immer, es ist ein Spray Deodorant und sie trinken es und sie haben Autos und Explosionen. Sie hatten Pigeons in einer Box.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ja, und dann zeigt Mike Tyson sich selbst in einem rippten schwarzen Shirt an und ich bin wie, ich bin raus. Ich wΓ€re so erschrocken.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Auch als ich herausgefunden habe, dass Mike Tyson seine ZΓ€hne nicht bruscht, war ich wie... Das ist verrΓΌckt. Das ist das gleiche Verhalten und deshalb will ich nicht mit ihm kΓ€mpfen. Dann haben sie angefangen zu kΓ€mpfen und zuerst haben wir gesagt, okay, es ist 58, er kann nicht kΓ€mpfen. Aber dann hat jeder gesagt, dass er keinen Unterkopf gemacht hat, welcher seine gewohnte Bewegung ist.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Well, that little girl interviewed Mike Tyson. It was so cute. And she was like, Mike Tyson, what does this mean for your legacy? And he was like, legacy that made up and we're all gonna die and be underground someday. And she was like. Oh, I never thought about it that way. She was like, perfect, thank you. That girl quit her job and she was going to be a future sports reporter.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

And he went to the dark side with her. But anyway, long story short, I'm just sick of fake shit.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Alles ist Klickbait. Alles ist Klickbait heute.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

We get down to Texas and I'm so excited because I put together an outfit like cute farm girl country. Like could not be more what a stereotype of what I think someone in Texas dresses like. But I thought they were going to accept me with open arms. Walking in, everyone's dressed like the club and I'm here looking like... Annie, get your gun. And he get your damn gun.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I was gonna ask you about this.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

You're the problem.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I love that you're open and honest about that, but you ordering a TSA bin on Amazon is the craziest. That's up there with the girls taking photos in the private jets. That's just one chair in... Hollywood, like in a street.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Also, ich bedanke mich, dass du nicht nur verstehst, was Ragebait ist, sondern auch teilnimmst.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und das zeigt, wie man lernen kann und eine Perspektive auf etwas Γ€ndern kann und es beherrschen kann. Dinge, die man vorher hassen konnte. Also vielleicht bringst du den ganzen Welt zusammen in diesem politischen Klima. Also Grace hat ein paar Sachen auf Instagram gepostet und du hast kommentiert, nimm das Foto. Ja. Dann hat Grace mir gesagt, dass du ein Foto nach dem Posten nehmen kannst.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich hatte keine Ahnung. Das war eine Frau in STEM.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I have a pitch for the next Emily in Paris. Okay. Because I heard that my mom's watching it. She loves it. I know she's in Paris. And then they're kind of running out of ideas. So they brought her to Italy. I want to see Emily in Pittsburgh. I want to see Emily go to a regular city. Pittsburgh hat wunderschΓΆne WasserkanΓ€le.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich mΓΆchte, dass Emily den Jungen treffen, der ein Plumber ist, und mit ihm flirten und Marketing fΓΌr Pittsburgh... Stealers. Stealers. Stealers. I wanna see Emily in Pittsburgh next. I'm sick of this glamorous... Let's bring it back to the States. America needs you right now, Emily. Because you wanna know what?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I do have to say, it's not a chill movie. It's a movie that like...

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Hey, das ist ein bisschen artig.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Everyone was like, what are you doing? And I was like, I got brought a cowbell.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Was dachte Craig, der DP, von ihrer Videodirektion?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

It's the kind of thing you're going to watch and then you have to turn to the person next to you and you're going to have a strong opinion on it. The internet is divided. So I think everyone should watch it.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Well, Christina Aguilera and Lindsay Lohan both sacrificed the blood of orphans and injected it into their spine. And then they now look like they're 17.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

The stem cells of baby toads.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Shout out to Texas for being the first state that the Izzy Trash guy got booed off stage. That's never happened in the history of Z-Trash.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

It's, technology is getting like scary. But I do have to say, and someone on, I don't know who said it, but it's important on TikTok. It wasn't me. They said, would you rather look weird, but young. Look weird, but young. Okay. Like you look young, but you look off. Okay.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I want to be one of those interesting older women that wears thick glasses. Big glasses. And it's honestly one of the hardest parts of my life, is that I have 20-20 vision. So I can't, and I really get overstimulated when I have glasses on.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich trage auch die günstigsten Sunglasses. Aber ich will eine Àltere Frau sein mit einem großen Schmuck. Okay. Okay. Okay. Okay. Okay. Okay.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I curse, but it's hilarious. Like everyone's like, watch out, grandma's... Oh, there's the f-bomb. And you have like three grandkids. And let's be honest, by that time, Des will have passed.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I will have a rotating suitors and no one's allowed to tell the suitors that there are other suitors. So when they come in, they think their grandma's only one. I said, don't tell them that grandma saw someone different last night.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Yes, eclectic Martha Stewart. And that's your vibe. And that's my vibe. What's your vibe going to be?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

You have your own Atlantis in your home. You are a water alien of your mansion. I love that for you. Thank you. Not to bring politics up, but what's a cabinet? Who cleans it? Who stocks it? Why are there cabinets and are they organized? Are they in the house, in the White House? Are they not in the White House?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Cardi B. Cardi B. Domingo.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I didn't know that. Scorpio Kings.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und ich habe nur... Oh, sie sind in ihren Kommentaren.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich will nur sagen... Lass uns eine professionelle Meinung jetzt haben.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Das ist ein sehr wichtiger Punkt, wenn wir ΓΌber Menschen sprechen, die in ein Fernsehserie kamen. Wenn du die neuen Leute bist, schaust du herum und es gibt einen Fluss, wie alles lΓ€uft. Es ist im Grunde so, als wΓΌrdest du dir vorstellen, dass du einen Film filmst und niemand jemals einen Film gefilmt hat. Und sie sagen, mach es. Du brauchst ein paar Leute, die sagen, das ist so, wie es lΓ€uft.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Um einen guten Show zu machen, brauchst du bestimmte Charaktere, du brauchst eine Storyline, du brauchst Archen. Und es braucht viele Leute. Es ist Arbeit. Und es ist auch nicht nur ein paar Leute, die reden, auch wenn es nicht so ehrgeizig aussieht. Es gibt Geschichten, die jeder hat.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und wenn die Leute sagen, oh, sie produzieren sich selbst, weil sie sich literally gesagt haben, dass sie eine Geschichte brauchen oder sie aus dem Show ausgeschlagen werden.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Sie sollten nicht alle grün sein. Sie sollten ein Legacy behalten. Sie sollten sogar Legacy genannt werden. Sie sind noch lebendig. Sie sind noch lebendig. Aber ich denke, es ist etwas Wichtiges zu sagen über Leute, die die Râpfe kennen und wissen, wie sie eine gute Saison machen. Und ich mâchte auch noch etwas sagen, da wir es alle da draußen haben.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Die Grund, warum die ersten Saisons die Leute lieben, ist, weil, wenn etwas zu dir passieren wird, dann mΓΌssen die Leute sich um dich kΓΌmmern. Und niemand kΓΌmmert sich darum, wenn sie sich nicht im ersten Moment mit dir verbunden fΓΌhlen. Also kommen viele Leute rein und in der ersten Saison werden sie im bestmΓΆglichen Licht gezeigt.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

We actually have no idea what's going on.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und dann, in der zweiten oder dritten Saison, ist es normalerweise so, wenn es den Fan schießt. Und sie sind so, wie kânnte das passieren? Ich habe das selbe gemacht, was ich letzte Saison gemacht habe. Und es ist so, naja, wir werden dich jetzt nicht mehr vorstellen. Wir benutzen dich jetzt für Storylines.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Es gibt viele Zeiten, wo man sich fragt, wie nur eine Person die einzige Dramatik der ganzen Saison war. Nein, es gab andere Dramatik, aber sie wussten, dass es nicht das war, was der Publikum sehen wollte.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

aber ich denke auch, dass sie nicht wussten, wΓ€hrend der zweiten Saison, was sie nicht wussten.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und auch, wenn sie hΓΆren, Shoutout, wenn du auf einem TV-Show bist, kannst du nie glauben, was sie dich gemacht haben. Weil wenn du glaubst, dass du die Person bist, die sie auf dem TV stellen, dann glaubst du an den Hype von dir selbst, was nicht wahr ist. Es ist immer noch ein Charakter.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I was told something similar. I was told you can't believe the hype or the hate. Because if you start believing the hype about yourself, then naturally you're going to believe the hate also. And people are just judging based on the oversimplified version of you. And it's true. I actually just watched this documentary about WWE. von Vince McMahon. Es war ein langer, langer Dokumentarfilm.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Aber WWE sind alle Storylines. Und die Weise, wie sie eine gute Storyline bekommen, ist, von Leuten Emotionen zu bekommen. Also hat er gesagt, wenn sie jemanden bekommen wΓΌrden, und sie wΓΌrden nicht wissen, ob die Fans die Person lieben oder hassen wΓΌrden, aber sie brauchten eine Reaktion.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und wenn ein Typ aufgehΓΆrt hat und Leute geboot haben, war er glΓΌcklich, weil das bedeutet, dass der Publikum engagiert ist. Aber wenn ein Typ aufgehΓΆrt hat, um zu kΓ€mpfen, und niemand hat etwas gemacht, war er so, dass das nicht funktionieren wΓΌrde. Ja, wie, ich bin fertig. So they needed to at least get people to love or hate.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I mean, at least people are talking about Roni, but I guess they're mad that it's boring.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

You guys, this is the realest reality TV lore you're getting right now. With Salt Lake City, they had to prove themselves.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

They came on being like, you're Utah. Like, who gives a fuck? We don't even understand your religion. We don't understand your families. We don't know who you guys are. Why should we care? And these women gave everything.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

But New York... I think Bravo really wanted to make sure and guarantee that the audience was gonna like the new New York and not miss the old New York. So they pushed it so hard to be so good. And it's almost like they didn't earn it. Und sie wurden einfach gesagt, du bist die neuen Leute und ihr seid großartig.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und dann denke ich, dass die MΓ€dchen diese Marke verteidigen, die sie einfach gegeben haben und sie nicht verdient haben. Und ich meine nicht das, dass sie natΓΌrlich hart gearbeitet haben, in einer gewissen KapazitΓ€t mit dem, was sie tun kΓΆnnten. Aber niemand ist in den GefΓ€ngnis gegangen.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Es ist sehr schwierig, besonders eine Freundschaft. Ich denke auch, was wΓΌrdest du tun, wenn du Bravo wΓ€rst? Bringst du Dorenda und Luann zurΓΌck und versuchst, eine Freundschaft zu schaffen?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Yeah, I mean also, I just want to preface this. This is coming from two people. I've never seen a minute of the new Rodney.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und das war das andere Show. Okay, Texas. Ich habe so viel zu sagen ΓΌber Texas. Das ist das Problem. Es gibt viele Probleme. Ich habe ein Abortionen in der BΓΌhne bekommen, kam raus.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Unsere erste Saison, wΓ€hrend sie uns vorgestellt haben, und sie wiederholten, wie oft ich Tennis spiele, und du sprachst darΓΌber, du liebst Fashion Outfits, das konnte die erste Saison nicht auslΓΆsen. Wir brauchten andere Menschen, die schlechte Geschichten haben. Genau. Also ist es so, dass in der ersten Saison alle sich vorgestellt haben, und sie sagten, das ist so lustig.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

In der zweiten Saison, wir geben es nicht. Wir wissen, wer du bist. zeig mir, was du an der Table bringst, wenn du RealitΓ€t TV machen willst.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Once you're liked, it's hard because you want to keep that. So when they ask you, hey, can you bring up this problem? You're like, I don't want to be the one. Why would I risk it? And then you have a bunch of people who are trying to save face. You think anyone in Vanderpump ever tried to save face?

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich denke, die besten Shows auf der RealitΓ€t sind, wenn es ein VerstΓ€ndnis in der Kasse gibt, dass jeder seine Vorteile und Nachteile hat. Aber zusammen machen wir eine gute Show. Ja, und ich denke, das ist, wo es mit Summer House Vorteile und Nachteile gab, als es weniger darum ging, dass wir eine gute Show machen und stattdessen versuchen, Leute auszupassen oder so etwas.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Warum schaust du mich seltsam an? Die MΓ€nner, Γ€hm, haben es Buhs auf Giggly Squad? Ja.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Oder wer der Mann der Gruppe ist oder was auch immer, was mit Vanderpump passiert ist. Aber wenn jeder sagen kânnte, lass uns eine gute Show machen. Aber dann ist es schwierig, weil du nicht weißt, wer das Schlimmste aussieht, wenn es aufhârt.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

It's, you know, a little bit more because Love Island, it's going out every day. Yeah. Bei Bravo weißt du von den Fragen, die du in Interviews bekommst. Ja. Also, du wirst in einem Interview sehen, oder du wirst hâren, dass alle über dich reden in Interviews, also denkst du dir, oh, schau, ich denke, ich bin das Problem.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Es gibt immer Buhs. Wenn ich meinen Job gut mache, wird dieser Mann gebuht. Will ich ihn zerstâren? Nein. Und werde ich ihn zerstâren, um ihn wieder aufzubauen? Ja. Es ist eine Art und Weise, wie wir es mit Izzy Trash machen. Ich weiß, wie man mit dem Publikum und dem Mann navigiert. Und ich mache es so, dass niemand getâtet wird.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Aber es ist auch so, dass alle ΓΌber jemand anderen reden kΓΆnnen, also es ist so, dass es im Grunde nach einem Hangout ist, welche Gruppe du dann mithΓ€ngst, wer ΓΌber wen spricht. Du kannst ΓΌber jeden reden nach dem Hangout.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

anyway it's just it's interesting perspective and i think like wwe is a perfect example of how like you need people that you like and people that you hate but that it's it's not always accurate and they don't always know how people are going to respond with that said is this why there's some like rumors going around that you might join roni that okay who started that daphne daphne literally sorry that no i don't know who started that but like

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Es ist seltsam, weil ich glaube, dass die Leute sagen, es ist furchtbar, es ist furchtbar. Aber du kannst nicht mit den MΓ€dchen verabschiedet werden. Es ist ein Gruppeprojekt.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

And not to have toxic positivity, but it takes one person sleeping with another person's husband and then you have Sandoval and Vanderpups back. So maybe let's, you know, let's keep our eyes open. Yeah. And our legs. Oh, goodness gracious. I had one more note about cats. Okay. Yes, and we'll take it. Ich habe einen Witz in meinem Netflix-Spezial. Ich weiß nicht, ob ich es darin darstelle.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Es geht darum, wie Katzen wirklich schlechte PR haben. Und Hunde haben unglaubliche PR. Und Katzen PR ist schrecklich. Die Pickable PR und die Hunde PR arbeiten zusammen. Weil jeder Hund in jedem Film ist wie der beste Freund und er ist da fΓΌr ihn und Marley und ich und Air Bud, sie spielen fucking Basketball. Katzen in Filmen sind immer ein Hintergrund, sie sind nie Teil der Geschichte.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

That was literally the exact word I wanted to say, but I could never come up with that word. I'm not entirely sure on what it means, but... No, but it's perfect for the moment. This man comes up, and I think he was blackout, which is funny, because the boys never get blackout.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Es ist immer so, dass es einen Katzen gibt, der im Hintergrund schlΓ€ft, nicht mit einem Mann zu tun hat oder sich auf dem Feindeslapp sitzt, also es mit Schicksal verabschiedet, oder eine Schwester und die Leute verurteilt. Und niemand sieht, wie Katzen tatsΓ€chlich sind. Also wenn Leute wie du einen Katzen bekommen und du denkst, oh mein Gott, ich hatte keine Ahnung. Es ist nicht deine Schuld.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Die Medien haben mich gebraucht. Die Medien haben dich gebraucht. Es ist und es gibt eine Krieg um Katzen. in the media because if i was actually show like a tv show of hannah with mike and who has a cat you wake up my cat's sleeping with me get up to eat the cat's coming with me we go watch tv the cat's with me but in movies the cat doesn't want to be on camera

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Katzen sind so, als ob ich mit diesem Mann mit einer riesigen Kamera in meinem Gesicht kuddeln wΓΌrde.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

dogs are a little attention whoring i did i did i say on the pod how des lost his dog i think i did he lost this dog in ireland and he was like with a new family by night time it was it was sleeping in a new family's bed at night

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Let's be honest, you've been gone for a couple days and Daphne's not happy. She's not happy. And she has full-time cat sitting.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

You spoiled her. So whenever she's alone, she's like, this is unheard of.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Maybe she didn't love that she wasn't the first grid post in your last Instagram dump.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Cats actually know what's going on at all times. I don't know how. I want to let you guys know, we have a couple tickets left in Orlando coming up this weekend on Saturday. So, because we added another show in Orlando. So get tickets if you're going to be in Orlando. And then we have Connecticut, Ohio, Windsor and a couple tickets left in New York. So go to GigglySquad.com.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich bin sehr gespannt auf diesen Drop. Er ist top-tier. Ja. Wir haben wirklich hart daran gearbeitet, ihn zu designen.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Haltet eure HΓ€nde hoch, Leute. Ich werde es durchziehen. Wir lieben euch so sehr. Und danke, dass ihr mit uns giggelt. TschΓΌss!

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I want the boys at a club to feel like how girls normally feel at a club.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

So this man comes up drunk and also cocky. Like he was like, like I asked him a question. He's like, well, repeated it back to me. And I was like, oh no. But then the crowd was like, I guess like he showed enough disrespect that the crowd was like, we're not going to even let Hannah and Paige deal with this. Like we're dealing with this. To the point that I was like, guys, it's okay, we got it.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

And the crowd was like, get him off.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich habe nur eine Frage fΓΌr ihn. Er wird ausgewΓ€hlt. Dann kommt der nΓ€chste Show in Austin. Ich sehe einen Dschungel im dritten Rang. Und ich sagte, bist du ein Freund? Sie sagten, ja. Ich sagte, Baby, komm her. Und er schlΓ€gt seinen Kopf. Nein. Nun, viele Leute, viele Leute machen das. Und ich sage, schau dir an, du bist traurig. Bring deinen Arsch hierher. Er ist so, nein, ich komme nicht her.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Und ich bin so, okay, das ist, ich habe nie so viel Verletzung erlebt. Und Und ich sah ihn an und dachte mir, ich werde nicht dumm sein, was natΓΌrlich eine LΓΌge ist, aber ich dachte mir, ich habe dich. Wir machen das jeden Show. Du kamst zum Show. Das ist das Einzige, was du tun kannst, ist die Gigglers zu entertainen. Und er wΓΌrde nicht kommen. Und dann hattest du eine VerschwΓΆrungstheorie.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I've literally never been wrong ever. Period. But it's funny because we're like, we're not going to go through your phone. But then the guy that comes up, I go, I ask them like, what's the background of your phone? And this guy pulls out like a whole to-do list that's on his background. And I go, I go, give me the phone, babe.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

And I look at it and I'm like, first of all, I literally put my hands on his shoulder because I have a inspirational quote on my phone. And I was like, we've both been through dark times.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I've had it because I'm a little superstitious. So when things started going well, I was like, I can't change the quote. But it still is like the most depressing quote on my phone.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

No, if I change my background, the whole world will collapse.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

And I also like to see it to be like how far we've come. So that when I'm sad, I'm like, remember when you were sad, sad? Remember when you were sad, sad, sad? So anyway, the first thing it says is like... Be grateful. So I'm like, oh, this is dark. And then he said the most manly shit. He was like, when you're not doing anything, do pushups or squats. Just do it.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

And I'm like, okay, toxic masculinity. Damn. And then my favorite was by Friday, fix your finances.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Aber dann sagt er, setze eine Therapieabteilung. Und dann die nΓ€chste Woche setze ich noch eine Therapieabteilung. Ich sage, du bist so knapp. Lass uns es nur tΓ€glich setzen, damit du nicht immer eine setzen musst. Aber du bist so knapp.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Okay, but can I just explain how Paige is? This is her Tuesday. But come Friday, when we have to be in Miami, this bitch is gonna have it together. I'm like, wait till I use my outfit tonight. Throughout the tour, Paige will be like, I can't do it anymore. And then she'll get a good Diet Coke and be like...

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

She was taking photos of it. I was like, this is dark.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Wait, no, people don't know this about me. People don't know this about... Because people be like, oh, Hannah's not fun. Like, she doesn't do coke and she doesn't party.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Bitch, I party. I party, but I party with pancakes to the face. Like, I'm dancing. I'm dancing. I know exactly what to order. I... I will find like in the middle of nowhere when I'm driving from like city to city, the perfect brunch spot. And I have an eye for diners. Like I can tell when it's shit.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Eye. And it's like it can't be taught. So like anyone listening, it's either have it or you don't.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

And I don't mean to promote capitalism right now, but I still fuck with Yelp. And you've made fun of me before. I pull out my Yelp, I put breakfast spots, and then I'm looking at it and I'm looking through the photos. I'm looking through the reviews.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

I see their aura. So, there was a place in Dallas, but Paige had to walk like four blocks, and I was like, she's gonna have a fit. Like literally a toddler. So like second block, she's like, Hannah, where are you taking us? And we see like one shop that has pink bows, and she's like, can we stop by the pink bow place? And I'm like, focus, we're going to food.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

She goes, are you sure it's not that place? I'm like, no, it's not the place with the pink bows. That was a... Du kΓ€mpftest fΓΌr dein Leben und du warst so, geh in Richtung der pinken Mose. Nein, das ist nicht, wo wir gehen. Nein, ich kΓ€mpfte fΓΌr mein Leben. Und dann kommen wir da hin und wir bestellen Pancakes, so glΓΌcklich, wie sie jemals war. Sie war so, ich liebe Tour.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Giggly squad.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Are you saying, what's up, Gigglers? What's up, Gigglers? Now let's say it louder. What's up, Gigglers? Gigglers. Yes! How y'all doing? Paige and I just came back from Texas and we've saved at least 22 minutes off our lives by saying y'all instead of you guys.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich muss sagen, Pancakes fΓΌr den Tisch ist ein Power-Move.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Ich bin besessen damit. Pancakes fΓΌr den Tisch, weil es ist wie Brot fΓΌr den Tisch.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

It's extra bread for the table. Or like a little dessert to dabble in. Also, we are, do not tell me I could get one drink. When you get to brunch, you need your water, because you need to hydrate. You need your orange juice or Coke, whatever your juice or soda of choice is. And you need your caffeine. So, I want to drown myself in liquids before the eggs even come. Und das ist nur die Regel.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Du und Grace haben immer die gleiche Ordnung.

Giggly Squad
Giggling about brunch, aging backwards, and water aliens

Wo Grace und ich nur schreien, um zu sagen, wie ist Paige heute? Ist sie in einem Mood? Ich habe sie am Morgen erwartet. Ich habe gesagt, Paige wird meinen Outfit heute nicht lieben. Also bereite dich mental vor. Sie wird nicht glΓΌcklich sein. Und Grace war so, bist du ernst?

Giggly Squad
Giggling about onlyfans, canada, and cake

Did you see Ariana and Cynthia were both nominated for Golden Globes? Yes, as they should.

Giggly Squad
Giggling about onlyfans, canada, and cake

Wait, so it's a section of TV, film, musicals slash comedy?

Giggly Squad
Giggling about onlyfans, canada, and cake

How many musicals slash comedies are there?

Giggly Squad
Giggling about onlyfans, canada, and cake

And when you say it's comedy, it's just movies and TV. It's not specials. Specials was just given last year its own.

Giggly Squad
Giggling about onlyfans, canada, and cake

And it's sometimes- Who was nominated for- Specials?

Giggly Squad
Giggling about onlyfans, canada, and cake

But that's why you- Who's nominating the people? Okay, actually, this brings me to my next thing. Lana Del Rey didn't know that you had to submit your songs to the Grammys.

Giggly Squad
Giggling about onlyfans, canada, and cake

But she was like, I didn't know that was even a thing. Her managers had to tell her, no, you have to submit to get a Grammy.

Giggly Squad
Giggling about onlyfans, canada, and cake

No. She just thought, oh, you just get put on the ballot.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, but then they submitted her. Oh, OK. But going into it, she was like, oh, I thought you just like.

Giggly Squad
Giggling about onlyfans, canada, and cake

Grace, can you double check that? Yeah.

Giggly Squad
Giggling about onlyfans, canada, and cake

Anything you're trying to improve on, change? I'm drawing a blank. That's crazy. I'm perfect.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah. No, I want to work out more. This is the first time in my life I'm like, no, I need to work out because I'm brittle and frail and I will die. Not like, oh, I want to have like a high tight butt. But like also, yes, but like.

Giggly Squad
Giggling about onlyfans, canada, and cake

Like I need to be stronger.

Giggly Squad
Giggling about onlyfans, canada, and cake

My goodies. My goodies. Another thing, I have a question for you. Yeah. Say you're walking into your bedroom.

Giggly Squad
Giggling about onlyfans, canada, and cake

You're walking into your personal bedroom.

Giggly Squad
Giggling about onlyfans, canada, and cake

Because I'm trying to set the scene. This is you walking in. Okay. You're walking in. You're staring at your bed. Okay, you're at the foot of it. You're staring at it.

Giggly Squad
Giggling about onlyfans, canada, and cake

Okay. What side do you sleep on?

Giggly Squad
Giggling about onlyfans, canada, and cake

Okay. That is how I sleep too. Like I'm always closer to the window.

Giggly Squad
Giggling about onlyfans, canada, and cake

They get them first. They get them first. as they should but i saw this thing on tiktok that was like it has nothing to do with like the door or whatever there's a masculine and feminine side of the bed and she said if you're single you have to sleep on the left side of the bed to like tell the universe you're ready for someone i support women in the arts i don't support this it's not true

Giggly Squad
Giggling about onlyfans, canada, and cake

But in like, okay, me not even knowing this inherently, I go to the left side. Like I go to the feminine side.

Giggly Squad
Giggling about onlyfans, canada, and cake

I'm not trying to be negative, Nancy. In my old apartment, I slept on the right. But I felt very in charge and very masculine. I love when life imitates art. That's when I was really just coming into my own.

Giggly Squad
Giggling about onlyfans, canada, and cake

I so need to come into my feminine energy in 2025. I'm going to be softer.

Giggly Squad
Giggling about onlyfans, canada, and cake

When I came home yesterday from tour, she was, like, giving me attitude. Like, oh, look who it is.

Giggly Squad
Giggling about onlyfans, canada, and cake

Like, she wouldn't come over to me. Like, I obviously picked her up and was like, we're snuggling, we're hugging, we're loving. And she was like, okay. And then, like, I'm going to go do my own thing. So she wasn't, like, actively coming over to me. It was more just, like, can't believe you're back. Like, this is what we do here. So, like, fall in line. And then at, like, 3 a.m.,

Giggly Squad
Giggling about onlyfans, canada, and cake

I felt her little head on my head and I said, okay, are you not mad at me anymore? And then we loved each other. And then this morning was good. This morning I was just like, you're perfect.

Giggly Squad
Giggling about onlyfans, canada, and cake

Rotating in and out of the apartment, like feeding you, petting you. You probably had no idea what was going on. And then I just come home and I expect you to be like obsessed with me. And she was like, give me a frickin minute.

Giggly Squad
Giggling about onlyfans, canada, and cake

A lot more monster. Someone came up to me on the streets of New York City.

Giggly Squad
Giggling about onlyfans, canada, and cake

So page coded. You're not just coming into my life and like rearranging things. But the best thing was my brother was watching her over the weekend and he calls me the one day and he goes, hey, everything's fine. Daphne's fine. And I'm like, what's wrong? And he's like, well, she's just like really lethargic. I don't know if something's wrong. Like, And I'm like, oh my God, what is she doing?

Giggly Squad
Giggling about onlyfans, canada, and cake

And he's like, she's just not getting up. And I'm calling her name. She's not looking at me. And so I look at the clock. And I'm like, it's 2 o'clock. We're in prime napping time. Call me when there's something actually important. Goodbye.

Giggly Squad
Giggling about onlyfans, canada, and cake

I'd be like, they're going to shoot me in the face. So we almost didn't make it to Canada. No, we almost didn't make it back into America. Both.

Giggly Squad
Giggling about onlyfans, canada, and cake

this tour is sponsored by neutrogena i have to confess something and hannah's actually turned me into a new person i can't believe i let her do this to me but we no longer get glam when we're on tour doing it myself i have to have the perfect base and that's why i love the neutrogena hydro boost water gel i actually don't use primer because my amazing makeup artist once told me

Giggly Squad
Giggling about onlyfans, canada, and cake

that you really just need good hydration so i always use it as my primer and the hydro boost water gel really is such a weightless hydration and it stays for 24 hours and we're flying multiple days in a row so we need that 24 hour protection and we can both use it and we have two very different skin types and it's suitable for all skin types shop it now at neutrogena.com

Giggly Squad
Giggling about onlyfans, canada, and cake

Hahaha.

Giggly Squad
Giggling about onlyfans, canada, and cake

Giggly Squad is a professional podcast. Let's talk about something that's really important. Border control. Let's talk about border control. You didn't think this was going to be top of the agenda today. And I understand that Canada was, in fact, trying to keep out the riffraff. And we respect that. And I respect that. We respect that. We pull up to the border.

Giggly Squad
Giggling about onlyfans, canada, and cake

Okay, after being on tour in a thousand different cities, the airport is made up.

Giggly Squad
Giggling about onlyfans, canada, and cake

TSA is straight up made up. We broke into the airport in Indianapolis. Hannah almost got on with no ticket. Like that, I'm not kidding, that scarred me. Accidentally. When I said, how did she get through TSA? And Delta goes, we don't know.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, TSA is a lie. The border is a lie. Like there's no authority anywhere.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah, it's just like crazy. No, that woman getting on the Paris flight is.

Giggly Squad
Giggling about onlyfans, canada, and cake

I was just going to say that I've been stopped getting on the flight because Just because I have a mini purse that's like not consolidated. If I hear the word consolidated one more time in the airport.

Giggly Squad
Giggling about onlyfans, canada, and cake

It's an extension of my body.

Giggly Squad
Giggling about onlyfans, canada, and cake

So why don't we split that purse up?

Giggly Squad
Giggling about onlyfans, canada, and cake

No, you don't.

Giggly Squad
Giggling about onlyfans, canada, and cake

You put your purse on first.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yep.

Giggly Squad
Giggling about onlyfans, canada, and cake

I'm done with airports. I'm done with TSA. I'm done with planes. The last plane we got onto, it was all men in the aisle rows. And I'm like so tired and like struggling. And my arms are shaking, like putting my luggage up. And I literally put it in the overhead bin. And I'm not kidding. I turned and I looked at all of them. And I said, you should be ashamed.

Giggly Squad
Giggling about onlyfans, canada, and cake

I mean, I didn't say that, but I gave them all looks. Yeah, we've lost etiquette. We've lost the plot. We've lost the plot. There's no airport etiquette.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, thank you.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, thank you.

Giggly Squad
Giggling about onlyfans, canada, and cake

Being at just like picturing being at like a bar.

Giggly Squad
Giggling about onlyfans, canada, and cake

And we get – first of all, we get our passports. We, like, give them to her. She's stunning. I feel like that's, like, important.

Giggly Squad
Giggling about onlyfans, canada, and cake

Like where, where would that, in what situation would that be like, oh, thank God I have my, thank God I have my spy glasses. No, that's the thing. In what situation is that like helping?

Giggly Squad
Giggling about onlyfans, canada, and cake

Unless like it was for like the police. Yeah.

Giggly Squad
Giggling about onlyfans, canada, and cake

But I don't need one at Starbucks.

Giggly Squad
Giggling about onlyfans, canada, and cake

Don't approach me. If you're a man, don't approach me. Also, if you're a man with stupid sunglasses at a Starbucks, don't approach me.

Giggly Squad
Giggling about onlyfans, canada, and cake

I rarely get approached, I feel like, by men. Unless their girlfriends want a picture.

Giggly Squad
Giggling about onlyfans, canada, and cake

Mine thinks I'm a lesbian. No one said that. No one said that. I've gotten more and more that I give lesbian energy.

Giggly Squad
Giggling about onlyfans, canada, and cake

I don't think. She just goes down on you all the time? I don't. Here's the thing.

Giggly Squad
Giggling about onlyfans, canada, and cake

I could be a lesbian if we were just chilling on the couch and chatting. But that's just a friend. Would you be? Well, I couldn't be a lesbian because of the sexual stuff.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah, but we don't...

Giggly Squad
Giggling about onlyfans, canada, and cake

Um... I don't know what I would want. I think that's gay of you. The fact that you considered all of us, I think you're gay. My instinct is I would want like a femme girl.

Giggly Squad
Giggling about onlyfans, canada, and cake

And then this is the difference between me and Hannah. Hannah wanted to give her her life story. Like, this is why we're here. This is what we're doing. And I was like, tell this bitch nothing. Nothing.

Giggly Squad
Giggling about onlyfans, canada, and cake

Okay. But if I went more masculine, like a girl that was more masculine, I've dated gayer men than that. I've actually been with someone more masculine.

Giggly Squad
Giggling about onlyfans, canada, and cake

That's, I mean, their apartment must be so, when I think of lesbians, I just think about like their apartment must be so tidy and organized. Yes. Like everything must have a home. And everything's fixed. Everything's fixed. Everything's in its proper place. And they're cooking, but they're cooking like steaks. They're cooking, but then they're cleaning up after they've cooked. Yeah.

Giggly Squad
Giggling about onlyfans, canada, and cake

You know, like they're not waiting for the next.

Giggly Squad
Giggling about onlyfans, canada, and cake

No. No, but there is one WNBA girl. But I don't know if she's actually out.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yes. She's not out. I'm obsessed with her, though. But like her vibe. I'm like, oh, she's like has like swag. And I'm like nervous. Like when I look at her. But like I don't want to date her.

Giggly Squad
Giggling about onlyfans, canada, and cake

But also imagine I dated someone with the same name. Like the tailors. Yeah. The tailors. If I went lesbian, I would only go lesbian with someone named Paige. Which is honestly so page-coded. She's so page-coded. And just think about us as a couple, we're P-squared.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, but I once had a guy say that like my fingers are so girly looking and like my nails are always done that like he liked the way my hand looked.

Giggly Squad
Giggling about onlyfans, canada, and cake

Oh, God.

Giggly Squad
Giggling about onlyfans, canada, and cake

So girls are coming out being like... They're the only ones on it. No, they made it. The call is coming from inside the house. Guys, you came up with it.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, I think a year.

Giggly Squad
Giggling about onlyfans, canada, and cake

I saw this quote that was like, I can't remember it exactly now, but it was something where it was like women...

Giggly Squad
Giggling about onlyfans, canada, and cake

fuck it was like women if it's unconsensual it's sexy if it's consensual it's just slutty so like men like feeling like we don't want this and that's like seduction and like i'm gonna make her want this but when we're like yeah give it to me they're like you're a whore and that sounds my therapist would say is you don't love yourself

Giggly Squad
Giggling about onlyfans, canada, and cake

it's just the women are just smart enough like no i'm not paying for porn yeah but you're a bunch of idiots these fucking guys being like i would never i would never marry a girl who does only fans i'm just gonna she wouldn't touch you no she wouldn't touch the guy she's she'd literally buy and sell you also like she makes so much money you would be a joke to her like these

Giggly Squad
Giggling about onlyfans, canada, and cake

Can I admit something to you that I don't think people would like ever really like imagine? I've never been truly hit on in my DMs. Like ever.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, like I've never had a man that I've like not previously met. Like, yeah, I've had like guys like, oh, I met him at a club or like, oh, he's a friend of a friend, like slide into my DMs and be like, you look whatever.

Giggly Squad
Giggling about onlyfans, canada, and cake

No. I don't I don't have random men being gross and sending me sexual things and I don't have anyone like ever shooting their shot in my DM I've never had a guy that I've never met before who is like anything that like I would potentially date DM me and say like let's go on a date or something never

Giggly Squad
Giggling about onlyfans, canada, and cake

I hate to say it, and I hate to, like, support Pretty Privilege, but, like, it's because... I think my Instagram is not even anti-men, but it's like, oh, this is literally, like, shoes, clothes, and, like, Daphne.

Giggly Squad
Giggling about onlyfans, canada, and cake

So, like, the girls who are posting... My first shot is at my ass. Actually, you did? That was for... Who was that for? That was for myself. That was for myself to be like, you're 32, but you still got it. But no, my Instagram very much gives girl. Like for the girls.

Giggly Squad
Giggling about onlyfans, canada, and cake

Did you see my wicked note? Because I did hit it. And it just immediately goes, yeah, it is a band.

Giggly Squad
Giggling about onlyfans, canada, and cake

Not lesbian, but for the girls.

Giggly Squad
Giggling about onlyfans, canada, and cake

Don't fucking DM me. This is not an invitation. This is me saying, I like where it is. Keep it that way.

Giggly Squad
Giggling about onlyfans, canada, and cake

I never really even like did that well on dating apps.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah.

Giggly Squad
Giggling about onlyfans, canada, and cake

I think like my whole, if I look at my 20s as a whole, like how many years of that I was on dating apps, like definitely like more than two. I legit only went on two dates from dating apps. Math, maybe three. I've gone on... Yeah, no.

Giggly Squad
Giggling about onlyfans, canada, and cake

I don't really get that many match.

Giggly Squad
Giggling about onlyfans, canada, and cake

Well, because you want to know what? Dating apps actually used to make me really mad because... Sometimes I'd get like someone sliding in there and I'd be like, how dare you? How in what fucking world?

Giggly Squad
Giggling about onlyfans, canada, and cake

Like you just pissed me off.

Giggly Squad
Giggling about onlyfans, canada, and cake

In what world?

Giggly Squad
Giggling about onlyfans, canada, and cake

Like that would annoy the shit out of me.

Giggly Squad
Giggling about onlyfans, canada, and cake

But like if you have the confidence.

Giggly Squad
Giggling about onlyfans, canada, and cake

I'm sorry, you don't have a husband. And no prospects.

Giggly Squad
Giggling about onlyfans, canada, and cake

Wait, you know that you're funny because your husband... I don't think Des is better looking than you. I think you actually are a very complimentary couple.

Giggly Squad
Giggling about onlyfans, canada, and cake

Gotcha. Gotcha. That's my whole personality. I don't know if Paige just insulted me and read me for a film.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, I'm not gonna. I wouldn't even dare sing along. Yeah, but that's when we get our giggly fits. No. Wait, what were you saying?

Giggly Squad
Giggling about onlyfans, canada, and cake

When I look away from the mirror, yes.

Giggly Squad
Giggling about onlyfans, canada, and cake

And you said comedy.

Giggly Squad
Giggling about onlyfans, canada, and cake

Did you see... Jonathan Bailey in Wicked? No. Did you... Cooper Koch in Fernandez Brothers? We have to get over the gay men that are never going to bark up this tree, okay? They don't care.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah, no. They'd literally look at your vagina and be like, ew. Yeah. No, what was it? Oh. Sorry. Did you see Timothee Chalamet? Oh, with the sports thing? Just like talking about sports?

Giggly Squad
Giggling about onlyfans, canada, and cake

I don't know one thing he said. That was hot. That's above my pay grade. That was hot. I don't give a shit. But I could not. Was he acting? Like, I couldn't understand the bit. Who knows? Don't care. I could not stop listening and watching him. There's something about a guy doing...

Giggly Squad
Giggling about onlyfans, canada, and cake

I think because I'm so girly and I love doing like girl stuff that when I see a guy doing like boy shit, I'm like, I'm obsessed with you.

Giggly Squad
Giggling about onlyfans, canada, and cake

He is just like a New Yorker.

Giggly Squad
Giggling about onlyfans, canada, and cake

It was like, wait, and suddenly I'm pregnant.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, nothing's as bad as Jacob Elordi.

Giggly Squad
Giggling about onlyfans, canada, and cake

Let's say ours at the same time.

Giggly Squad
Giggling about onlyfans, canada, and cake

He's like this British guy that's in... He's in like a lot of random things, but like most recently he was just in that HBO show. Oh. What's that one where they go away on vacation?

Giggly Squad
Giggling about onlyfans, canada, and cake

That's like him younger. No, he's beautiful. He's beautiful. And he's swaggy, I feel like. And I think he's tall.

Giggly Squad
Giggling about onlyfans, canada, and cake

Well... Here's the thing in my head. If we did have cocaine in our pussy, who was going to stop us?

Giggly Squad
Giggling about onlyfans, canada, and cake

Who is she? who's she with callum turner or something he's is he like skinny with tats no he's like he just looks like a guy who could take a punch see i can't do anyone that like i i like timothy chalamet but i can't do someone like skinnier than me one that'll send me into a fucking tailspin no no no like i don't want to be able to like snap you in half

Giggly Squad
Giggling about onlyfans, canada, and cake

No, I don't think I've ever dated someone like lanky. Not my brand. I've never dated like a tall, lanky guy. You love them sturdy. I love them compacted. I love them stout.

Giggly Squad
Giggling about onlyfans, canada, and cake

They weren't going to find it because this is the first time I've ever gone into Canada driving, so going through the border in a car.

Giggly Squad
Giggling about onlyfans, canada, and cake

You want a chonky one. I love a chonk. I love a chonk because I'm like, this is the best day of your life.

Giggly Squad
Giggling about onlyfans, canada, and cake

Well, it's also like most of my life, my type has been either like Italian or Jewish. And sorry, they're chonky. I'm Italian, so I can say this, but I'm sorry. They like, they pack a punch. Like they... 100%.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah. And not to pick sides. Well, maybe. I don't know. I was never. Here's the thing. I'm going to.

Giggly Squad
Giggling about onlyfans, canada, and cake

That's.

Giggly Squad
Giggling about onlyfans, canada, and cake

what i'm confused about i've never been like a miley miley stan yeah i was never really as invested in their relationship as other people i like her and i i've i like her more as i we both get older i didn't i was too young for hannah montana so i like feel like also whenever i met anyone they'd go oh like hannah montana and i'd have to be like yeah oh like when you're like hi i'm hannah yeah i was really traumatized you should have been like no hannah like banana that's what i would say like hannah banana that was first

Giggly Squad
Giggling about onlyfans, canada, and cake

We can get a banana!

Giggly Squad
Giggling about onlyfans, canada, and cake

Instead of Elf on a Shelf, it's Hannah eating a banana.

Giggly Squad
Giggling about onlyfans, canada, and cake

I hope by the time we have kids, that fad's gone.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, well, you have to do it if everyone's doing it.

Giggly Squad
Giggling about onlyfans, canada, and cake

I know, but think about them going to school and being like, my elf, and then your kid's going to be like, I don't have an elf.

Giggly Squad
Giggling about onlyfans, canada, and cake

Actually, when you have children, they're growing up and like you're doing all the Christmas stuff and you're doing like you're sneaking around like all the Santa's real stuff and all of that. If your child gets to an age where they're still believing in Santa, will you tell them?

Giggly Squad
Giggling about onlyfans, canada, and cake

Or like, are you, are they, is every mom just waiting for like them to find out on their own? Because like, is there an age? Because I feel like there's an age where I'm like, all right, look, we can't have her be the freaking class. Like, we gotta let her know.

Giggly Squad
Giggling about onlyfans, canada, and cake

But like, what if I did? Like, I totally could have in that car.

Giggly Squad
Giggling about onlyfans, canada, and cake

Oh, there's... Like, how old were you when you found out that Santa wasn't real?

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah. In a very truly page-coded way. I remember I was in fourth grade. I was hearing murmurs. I was like, oh, all the kids are chatting about.

Giggly Squad
Giggling about onlyfans, canada, and cake

The gossip was so hot on the playground. The tea was teeing. And Christmas was coming up. And I said, you know what? Let me do a little test. And I didn't put on my list this pair of leather pants that I wanted. I was in fourth grade. I was like, I need these leather pants. Didn't put them on the list like that I knew was going to my mom.

Giggly Squad
Giggling about onlyfans, canada, and cake

And in my head, I was just like, I want these leather pants. And then when they didn't come that Christmas morning, I was like, something's up.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, Canada, tighten it up.

Giggly Squad
Giggling about onlyfans, canada, and cake

Because I think there are some kids that, like, now... Like, I meet some adults and I'm like, you seem like one of the kids that were in seventh grade. And you're like, no, he is real. And I can't have that energy around me.

Giggly Squad
Giggling about onlyfans, canada, and cake

I actually had a moment this year at 32 years old. This is the first time I've ever decorated my own apartment with Christmas stuff. And I was like, that's so crazy. The past 10 years living in New York City, I just haven't cared about Christmas decorations. Don't need to put them up. It's not like I'm sad about it. I'm like, I just don't give a shit.

Giggly Squad
Giggling about onlyfans, canada, and cake

And one of my friends said, well, that's because you must have grown up in a household where your mom made Christmas so special. that you don't like long for it. Like you're just like, oh, I know when I go home, like it's Christmas there. And I was like, wait, that's so true. Like I've never felt like, oh, I'm not in the Christmas spirit. It's just like, no, my mom's going to do it.

Giggly Squad
Giggling about onlyfans, canada, and cake

My mom is doing it.

Giggly Squad
Giggling about onlyfans, canada, and cake

What about when you walked into my bedroom and I said, it used to be my parents, but I made them trade you.

Giggly Squad
Giggling about onlyfans, canada, and cake

No. Oh, my God. No.

Giggly Squad
Giggling about onlyfans, canada, and cake

I feel like every boyfriend I've ever had.

Giggly Squad
Giggling about onlyfans, canada, and cake

Well, because so many people it's such like a mix, you know, and it's like, oh, when you marry someone, you marry their family. But then other people are like, don't go by the family like you're marrying the person. Yeah. I very much I feel like go by the family. Yeah. And I've even stayed with boyfriends too long because I'm like oh but I love his mom.

Giggly Squad
Giggling about onlyfans, canada, and cake

Like I'm obsessed.

Giggly Squad
Giggling about onlyfans, canada, and cake

sometimes you know those guys who just like tell their mom to shut up and like roll their eyes and you like never saw that side before and you're like oh because you want to fuck me yeah there was only one relationship i ever had and i saw the dad and the way he talked to the mom and like how the mom like reacted and i remember sitting there and just being like oh i will never be in this family and i have to break up with your son literally tomorrow because that just terrified me yeah

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah.

Giggly Squad
Giggling about onlyfans, canada, and cake

Is that how they say it?

Giggly Squad
Giggling about onlyfans, canada, and cake

I... Don't care. Well, they made it very like Gen Z. They made it look like it's literally like a fizzy drink brand. Oh my God. Yeah. It looks like it like will get you fucked up if you bring a pack like a six pack to a friend's house.

Giggly Squad
Giggling about onlyfans, canada, and cake

It's for local cars. It does not give luxury whatsoever. And Jaguar is like a luxury car. But I feel like Jaguar is not

Giggly Squad
Giggling about onlyfans, canada, and cake

I feel like one of my earliest memories of you, is this real or is this you or someone else? I'm going to say it, but I'm pretty sure it's you. I feel like were we ever walking down the street one day and you tried to say the word espadrille, but you said the word Esmeralda? Was that you? I feel like it was. And it was like the funniest thing that's ever happened to me in my life.

Giggly Squad
Giggling about onlyfans, canada, and cake

And I was like, what'd you just say? And you're like, she's wearing Esmeraldas.

Giggly Squad
Giggling about onlyfans, canada, and cake

It's as if I had knowledge. It's Giggly Squad, but the second co-host is knowledgeable.

Giggly Squad
Giggling about onlyfans, canada, and cake

That's like how it felt. No. And immediately I'm like. I turned into my mom. You turned into yours. I start praying.

Giggly Squad
Giggling about onlyfans, canada, and cake

I almost lost my virginity in Hollywood, Florida. Keep going.

Giggly Squad
Giggling about onlyfans, canada, and cake

Wait, I'm so excited to go to Salt Lake City.

Giggly Squad
Giggling about onlyfans, canada, and cake

Maybe we'll stay out there and do a little ski vacay.

Giggly Squad
Giggling about onlyfans, canada, and cake

For the rest of your life.

Giggly Squad
Giggling about onlyfans, canada, and cake

Hahaha.

Giggly Squad
Giggling about onlyfans, canada, and cake

You looking through your bag was so iconic because Grace goes, why are you looking in your bag? I'm trying to be helpful. I'm looking under my shirt.

Giggly Squad
Giggling about onlyfans, canada, and cake

We reside here now.

Giggly Squad
Giggling about onlyfans, canada, and cake

We weren't in America, but we weren't still in Canada. So we couldn't get back. No, we couldn't go back to Canada to be like, we forgot it.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, truly.

Giggly Squad
Giggling about onlyfans, canada, and cake

I'm like, there's no way. There's no way. This is 2024. You can't get into America without a passport.

Giggly Squad
Giggling about onlyfans, canada, and cake

We were like, what do we have to do?

Giggly Squad
Giggling about onlyfans, canada, and cake

I was like, there's no logical possible. I was like, if you had your ID and you lost your passport, yeah, you're saying you're Grace.

Giggly Squad
Giggling about onlyfans, canada, and cake

America was like, we don't give a flying fuck.

Giggly Squad
Giggling about onlyfans, canada, and cake

We've denied her request every time. We're like, put it in the comment box. We'll get to it.

Giggly Squad
Giggling about onlyfans, canada, and cake

One time Paige commented on my boobs and how she wanted to see them.

Giggly Squad
Giggling about onlyfans, canada, and cake

She will legit ask for HR. We start laughing. We're like, that's so funny. We have to harass you.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah.

Giggly Squad
Giggling about onlyfans, canada, and cake

And you're far away.

Giggly Squad
Giggling about onlyfans, canada, and cake

Hahaha.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah.

Giggly Squad
Giggling about onlyfans, canada, and cake

He's funny.

Giggly Squad
Giggling about onlyfans, canada, and cake

I feel like there was a time in the 2010s where magicians were really having a moment.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah, I don't need live animals.

Giggly Squad
Giggling about onlyfans, canada, and cake

But David Blaine and locking yourself in a cage that goes into shark-infested water, it's like, maybe call a therapist. Maybe call a therapist. Men will do anything to not go to therapy, and they'll become magicians.

Giggly Squad
Giggling about onlyfans, canada, and cake

Well, have you ever seen a female magician like putting a man into a box and and sawing it up? OK, now that's my next Netflix show.

Giggly Squad
Giggling about onlyfans, canada, and cake

Yeah, I've never seen a magic show advertised and it was like a woman.

Giggly Squad
Giggling about onlyfans, canada, and cake

I'm actually into that TikTok. I feel like me and you should do it. But it sounds like, have you ever seen this one? Have you ever seen this one?

Giggly Squad
Giggling about onlyfans, canada, and cake

The only reason I wanted to become a cheerleader in high school was the vibe.

Giggly Squad
Giggling about onlyfans, canada, and cake

Actually, one of my favorite things to watch on TikTok is like college dance team competitions.

Giggly Squad
Giggling about onlyfans, canada, and cake

Hannah, we're so lucky there's so many things that you can't do. We're so lucky that you don't have the voice of an angel.

Giggly Squad
Giggling about onlyfans, canada, and cake

We're so lucky that you're not flexible. If I was flexible, I'd be sitting here with my leg around my head. And we're so lucky you're not a morning person. If you had those three things, I don't think we'd even be friends. I don't think we'd even be sat at this flower table. I might be the star of Wicked.

Giggly Squad
Giggling about onlyfans, canada, and cake

No, not the short men.

Giggly Squad
Giggling about onlyfans, canada, and cake

It's either staying the same or getting better, but it's not getting worse.

Giggly Squad
Giggling about onlyfans, canada, and cake

And you had a true throat.

Otherworld
Episode 116: Auntie Gloria

But I would say the Lord's Prayer over and over and over again until I fell back asleep. I was really scared. And of course, like after the fact, as I'm describing this to Mark, my skeptical husband was skeptical. And, um, We like toyed with the idea of this being a sleep paralysis instance, but I never experienced sleep paralysis before.

Otherworld
Episode 116: Auntie Gloria

I wasn't under any kind of like exceptional stress at that time. Like I wasn't going through really like a big, aside from having bought a house, like, and I'm not a super stressed out person anyways, but there really would have been no triggering incident for having sleep paralysis. And aside from that, like I just wasn't asleep. Like I woke up and saw these two things.

Otherworld
Episode 116: Auntie Gloria

This became like a regular topic of conversation in our house because I was really, really scared. I did not want Mark to travel for work anymore. And if he did travel for work, I slept like with Francis in the bed with me. Or I even would sleep at my parents' house sometimes if Mark was traveling because I just really did not want to be in the house by myself.

Otherworld
Episode 116: Auntie Gloria

It's like if you've ever lost somebody in your family or a close friend, you might have had this experience where there's three or four days after you lose someone where everything just feels a little bit thinner and a little bit... There's a very specific like opening of a sense that you don't always have. And then after a few days, it kind of goes away. I don't know.

Otherworld
Episode 116: Auntie Gloria

That might make sense to some people. It might not make sense to some people. But that's how my house feels all the time. It like always feels like there's a little bit of thinness and a little bit of like pressure that's otherwise not there. So at this time, like... It was just a more intense version of that. It felt, like, kind of heavy.

Otherworld
Episode 116: Auntie Gloria

And I still do love the house, but I think Mark, you know, and as things started to pick up more and more, Mark also started to figure out, like, we can't live in this house like this forever. Like, that's not going to work. Like, we're going to have to do something about this because... We live here now, like this is our house and we don't want to leave.

Otherworld
Episode 116: Auntie Gloria

And the next couple things that happened, I think Mark, he started to get like not just a little bit less skeptical, but he started to get full on board with getting rid of whatever was in the house. There were two more incidents that happened within the span of a week. The first one was pretty innocuous. I had what I thought was a regular night's sleep.

Otherworld
Episode 116: Auntie Gloria

And when I woke up in the morning, came downstairs, it suddenly hit me, this memory of having my hand held in the night. My hand was dangling over the side of the bed. And I had like that physical memory sensation of somebody holding my hand. And I turned to Mark and I said, somebody was holding my hand last night.

Otherworld
Episode 116: Auntie Gloria

A few nights later, Frances was getting up really early, so we would take turns being up with her at like 4.35 in the morning and let the other person sleep. So I was sleeping in on this day, and I was laying in bed, and I heard my door open. And then I felt somebody's hands around my ankles. They slowly pulled me down, probably a foot. So I was now off my pillow.

Otherworld
Episode 116: Auntie Gloria

My legs were probably dangling like from my knees to my feet off the end of my bed. And I sort of like shook myself and I felt the ankles, my hands around my ankles again, and again pulled me down. But this time I felt myself being pulled off the bed completely, like hitting the ground. I could feel my cheek rubbing against the linens. I could feel my body smacking against the wood floor.

Otherworld
Episode 116: Auntie Gloria

And when I opened my eyes again, I was back on the top of my bed at my pillow. I don't know how to explain this, but I felt like I was being taken to another place. My physical body wasn't being pulled, but I was being pulled out of my body. I felt like I was being taken somewhere. I felt like I was receiving a very forceful invitation to enter another world. It felt like a trick.

Otherworld
Episode 116: Auntie Gloria

It felt like it wanted me to trust it. Whatever is trying to take me here, it wants me to feel like this is playful and no big deal. But there was something really deep down in me that was just like, you're not supposed to go there. And I very quickly was just like, fuck that. Under no circumstances am I going anywhere against my will. Like, I'm not going to let anything take me anywhere.

Otherworld
Episode 116: Auntie Gloria

If I go to another plane, like, I have to be in control of that. And then I went downstairs and I told Mark everything that had just happened. And I was extremely, extremely shaken up at this point. This was very, very scary for me. Felt like maybe in the absence of the other things that had happened, I would have been able to write this off. But it felt to me like such a clear escalation.

Otherworld
Episode 116: Auntie Gloria

It got really, really scary because I also felt like it's one thing just to like see somebody in my room. But it's another thing for something to be like touching me or like holding me. And I was just like, I'm not, I'm really afraid. I don't want that. And I don't know like where, what is this thing and where is it trying to take me?

Otherworld
Episode 116: Auntie Gloria

The look on his face, like it turned, I think, from skepticism and laughing it off to concern. whether it was just for me and my mental state or for my safety or what was happening in the house. I think it was probably some combination at that point. So I started to do a bunch of stuff around the house based on the advice of a friend who I felt was very attuned.

Otherworld
Episode 116: Auntie Gloria

I talked to her about the situation and She suggested playing loud music, move the furniture around, and she was like, just talk to it and tell it that it's not welcome there and to get the fuck out. So I started doing that. Mark started doing it. She suggested putting plants and offerings in the basement.

Otherworld
Episode 116: Auntie Gloria

So I didn't do offerings per se, but I did put flowers in the basement and just tried to really change the energy of the space. And the night incidents... stopped. But that's when everything with Francis started.

Otherworld
Episode 116: Auntie Gloria

My name is Grace. I'm 35 years old. I live in Eastern Connecticut, like kind of near where Mystic Pizza takes place, that classic Julia Roberts movie. I'm a wedding planner and event designer. And the story started when I moved back to Connecticut in 2018. I had been living in California

Otherworld
Episode 116: Auntie Gloria

So at this point, it's like March 2020 and COVID had just hit and there's like nothing to do but like go for walks with Francis. Like I was working from home. I worked in nonprofit at that time. So Francis and I would go to the park all the time and we'd take these like long walks all the time. So one day I'm at the park and Misha, who has three sons, randomly shows up at the park too.

Otherworld
Episode 116: Auntie Gloria

And we get to chatting. We like weren't close friends yet at this point. And I just asked her about the skull that she had mentioned because Mark and I basically thought that she had made that up to scare us since the house negotiations had gotten a little contentious. So I was like, you were like fucking with us, right? And she was like, no, I was not. I was not making that up.

Otherworld
Episode 116: Auntie Gloria

That absolutely happened. And then she said, let me go. I'll confirm all the details with Chris when I get home. So she texted me later that night and she told me, not only is that true, that skull, but she said that Chris, after that happened, did a bunch of research on the property and learned that there was a church and graveyard in that portion of the yard.

Otherworld
Episode 116: Auntie Gloria

So most likely, in his opinion, that was probably a graveyard where they pulled that tree out. I sort of told her at that point, like, I didn't give her a lot of detail because I was a bit bashful about being judged. But I told her a little bit, like, there's something going on with this house, and we love it, but there's just something going on here. That summer, the weirdness persists.

Otherworld
Episode 116: Auntie Gloria

Frances and I, like I said, we're taking all these really long walks, and there's this forest near my house where we walk every day during COVID. At this point, she's like a year, a little bit over a year. And we just hear whistling in the woods every time that we go, like following us through the woods. Not birds, like human whistling. Nobody else is in this nature preserve.

Otherworld
Episode 116: Auntie Gloria

Like I said, like weird things like that were just happening with remarkable frequency. But it was one-offs. Like it was a little thing here and a little thing there. And Frances was just starting to talk. And when she could start to clearly communicate with us, she started to say some like pretty jaw-dropping stuff about what was happening to her at night.

Otherworld
Episode 116: Auntie Gloria

This is when Auntie Gloria like enters the scene. It wasn't like a gradual introduction to Auntie Gloria. It was like one morning just before her second birthday. She told us that Auntie Gloria had come to see her last night and was playing with her toys and reading her books. And Mark and I kind of looked at each other and we started to probe her just a little bit. who's Auntie Gloria?

Otherworld
Episode 116: Auntie Gloria

What does she say when she comes? Is she friendly or is she mean? At that time, like, she was pretty open about it. She would say, like, she's really nice. She reads me the stories that she wrote. She just comes and says hi. She told me happy birthday. And so Mark and I, obviously, we get, like, kind of curious. Like, well, let's figure out, like, is this Auntie Gloria – Who is this?

Otherworld
Episode 116: Auntie Gloria

So we look up like Auntie Gloria. and the name of the town that we live in. And right away, the first hit is an obituary from 2003 or 2004 for a woman named Gloria Barber, who, as we came to find out, was the person who lived here when the house was excavated. She rebuilt this house. She was known by community members as Auntie Gloria. She was a children's author.

Otherworld
Episode 116: Auntie Gloria

And when I got pregnant with my daughter, Frances, we moved to New Haven and started looking for houses in Connecticut. I grew up here in Eastern Connecticut, so we were looking all over. Around November of 2019, Frances had been born at that point. She was probably about eight months old.

Otherworld
Episode 116: Auntie Gloria

and she renovated a bunch of the old houses in the neighborhood. At this point, we're both just like, this is undeniable. We had never talked about Gloria. There was just no way that Frances could have just made this up. And every week or so, she would tell us about another visitation with Auntie Gloria. I would try to tell her, make sure Auntie Gloria respects your space.

Otherworld
Episode 116: Auntie Gloria

You don't have to talk to her if you don't want to. One day she woke up and said that Auntie Gloria wants you to paint the house red again. And I told a neighbor about this kind of offhandedly, like, oh, Frances is talking to Auntie Gloria. Because obviously the neighbors who'd lived here for a long time remembered her. My neighbor told me, like, indeed, the house used to be red.

Otherworld
Episode 116: Auntie Gloria

And it was a very specific shade of red that Gloria had gone to, like, incredible lengths to find because she wanted it to be really historically accurate. And apparently she was upset when it was painted over black. She would tell Frances things like, tell your mom not to leave her cakes out on the counter so long before she puts them in the oven.

Otherworld
Episode 116: Auntie Gloria

So she would be, you know, for, like, a two-year-old to say that, it was... Literally unbelievable. It was literally unbelievable.

Otherworld
Episode 116: Auntie Gloria

Or even that you would paint a house.

Otherworld
Episode 116: Auntie Gloria

Like a two-year-old just doesn't think about the world that way.

Otherworld
Episode 116: Auntie Gloria

Right. Right. So this was like, I think I recorded this one and sent it to you. But after we chatted, you know, because she's really sheepish about it now. Like she clams up when you ask her about it. But at one point we were making cookies and I was, I try to keep it super casual with her, you know, like no big deal. It's just like, you know, see what comes out.

Otherworld
Episode 116: Auntie Gloria

Try not to put too much pressure on her because like I said, she clams up. So she did end up telling me, like, Auntie Gloria was telling her about her aunts, her mean aunts. I probed a little bit and just said, like, well, why are her aunts mean? She said that her aunts do bad things to children. And she said they do bad things with belts to children, which is, like, really dark, I know.

Otherworld
Episode 116: Auntie Gloria

I'm not super mom, but like my child is not exposed to anything like that, like ever. So to even know that that's a thing that happens is, I just, I don't, maybe I'm naive, but like I just don't see how a two or three-year-old could make that kind of a connection. Like how they could, she could say that spontaneously. I don't know.

Otherworld
Episode 116: Auntie Gloria

I went to an astrologist named Michael, who I'd gone to several times before, because I wanted to have Frances' birth chart read. So I have Frances' chart read, and he said a bunch of really interesting stuff. It was really cool, but what he said about Frances that I thought was interesting and that stayed with me is that he said she was surrounded by spirits.

Otherworld
Episode 116: Auntie Gloria

Obviously it's upsetting, you know, to think that your little girls like being exposed to things outside of your control. That's like what every parent, like that's probably one of the hardest parts about being a parent, maybe the hardest part about being a parent. But I also think that like, She didn't seem scared or upset.

Otherworld
Episode 116: Auntie Gloria

And so I didn't want to map any of my like shit onto the way that she was experiencing it. So when she told me, I just tried to stay like pretty neutral and curious. I don't know. That's, I guess, my parenting style is like, well, she's not freaking out about it or scared. Why would I put that on her? I don't know if that's right or wrong, but that's kind of how I approached it. Thank you.

Otherworld
Episode 116: Auntie Gloria

Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.

Otherworld
Episode 116: Auntie Gloria

A few weeks later, I'm looking at houses. I had driven like an hour from New Haven to my hometown and I was looking at houses around like Mystic and I went to a house in Mystic and it was a total bust. Like it was just a dump and I was like, okay, this was kind of a waste of an hour drive. Let me see if there's anything else nearby to go check out.

Otherworld
Episode 116: Auntie Gloria

So I got on Zillow, I found a spot, and it was on this road that was a mile from where I grew up, but I didn't even know that this road existed. And the house was, like, really cool. It was a black house, salt box on an acre of land right on the river. So I was like, all right, let me go check it out. So I was with Francis, Francis and I went to the house.

Otherworld
Episode 116: Auntie Gloria

cle cle Athlet cle cle cle cle cle cle cle cle cle cle cle cle cle cle cleacacacacacacac Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athletacacacacacacacacacac cleketketketket cleacacacacac cleketketketketket cleacacacacacac cleac cle cleket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacket disputacacketacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacaceni Clket

Otherworld
Episode 116: Auntie Gloria

Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. . . . . . ., a, P. P. P. P. P. P.ε―¦ , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , a Laboratory a

Otherworld
Episode 116: Auntie Gloria

And when we walked into the house, it was like a flip just switch. Like it was a no brainer that we were going to buy this house. We put an offer then in that day. And, um, we were like on our way to closing in December. So at the closing, you know, the negotiations with the homeowners, I think it was probably pretty typical for the way that negotiations go.

Otherworld
Episode 116: Auntie Gloria

, , , , , , ,, P. P. P. P. P,ε―¦ε―¦ , , , , , , , , , , , , , , , , , , , , , P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P laοΏ½ laοΏ½ boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  boΓ  go , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ,

Otherworld
Episode 116: Auntie Gloria

Like, it wasn'tβ€”like, we weren't warm and fuzzy. Misha, the homeowner, she's one of my best friends now. But at the time, like, we didn't even want to look at each other at the closing because we had argued about a bunch of stuff with the house. So anyways, at the closing, we signed all the paperwork. We're sitting there, andβ€”

Otherworld
Episode 116: Auntie Gloria

Uh, no, he, but we scheduled a time for him to come over and pointed out to me. So he came over like a couple of weeks later. He spent like a couple hours with me and we started just like talking about what the excavation process was like and what the carpentry was like. And he did tell me stuff just about like, you know, some of the things that they found outside.

Otherworld
Episode 116: Auntie Gloria

And, um, one of the things that he, um, described to me was at one point they were like digging the foundation and then they had excavated just like a portion of the driveway too and they found like the carpentry team like the construction team found a fire pit that went down like you know it was carbon dated down like 8 000 years at least like it had been used for fires for like 8 000 years

Otherworld
Episode 116: Auntie Gloria

And then we, like, walked around the property, too, and he could, like, pick stuff up off the ground. Like, there's all theseβ€”I didn't know what they were until he came over, but there's all these littleβ€”they just look like tiny white cylinders everywhere.

Otherworld
Episode 116: Auntie Gloria

And he would, like, pick them up off the ground, and he'd be like, you know, they were, like, not thatβ€”like, they didn't have the science that we had, butβ€” They knew enough to know that if you shared a pipe, you would get the same sickness that the guy next to you had. So they'd make these super long pipes, and then they'd just crack off the part that they used and throw it on the ground.

Otherworld
Episode 116: Auntie Gloria

Yeah, just in my yard.

Otherworld
Episode 116: Auntie Gloria

Yeah. There's all these weird like stone fixtures around my house. And like some of them are like there's a hitching post, right? Like where they would tie their horses up. Like some of the stuff I kind of knew what it was. But as we walked around the property, there were other things where he would like pause like he was kind of like jogging his memory.

Otherworld
Episode 116: Auntie Gloria

And one of the things that he showed me were, like, these marble slabs that had been repurposed into steps. And he said that they used to be gravestones. Like, you know, the old 1800s marble-looking white gravestones that you see. So that was really interesting. And then it was, like, time to talk about the treasure. Like, I was ready to...

Otherworld
Episode 116: Auntie Gloria

to broach it with him so what he told me was that when the house was under construction they were always hiding things there because people would you know like kids would come through the house and mess around at night and like if there was any valuable tools they wouldn't want them to get messed with So they found this place in the house where they could tuck things and nobody would find them.

Otherworld
Episode 116: Auntie Gloria

And it was like a running joke between Brian and Gloria that when she passed away, she would put a bonus in that space for him to come back and get. I asked him to point out to me where it was and he went like straight upstairs. and showed me that the place where this like secret room had been or is has been like dry walled over.

Otherworld
Episode 116: Auntie Gloria

Misha said, hey, just a heads up, like, everything's out of the house, but when you go down to the basement, you're going to see that there are like five or six boxes down there, and those have to stay with the house. They belong to the house. So if you ever leave, you need to leave those there. And I was like, okay, well, what are they?

Otherworld
Episode 116: Auntie Gloria

So somebody at some point between his construction and me living here covered it. And he basically said, like, there was a trick door that if you moved into this house and nobody told you it was there, you wouldn't notice it.

Otherworld
Episode 116: Auntie Gloria

And so if you didn't like the way it looked, like, it would make sense that somebody would just cover it with sheetrock because it doesn't look like anything if you don't know what you're looking at. So basically, it's hidden behind this drywall. So when Gloria lived here, she... only lived on the first floor because she had a premonition that she would die on the stairs.

Otherworld
Episode 116: Auntie Gloria

Brian told me all of this, like that she would die going up or down the stairs. So whenever he came or like anybody came to visit her, she would have people like run up or down the stairs and get things for her because she refused to go up and down the stairs. So anyways, so the upstairs of the house is like A-frame shotgun rooms.

Otherworld
Episode 116: Auntie Gloria

The pitch of the ceiling, you would say, is, like, much steeper than the pitch of the roof. So there's, like, a big gap between the roof and the ceiling. And that's where the secret room is.

Otherworld
Episode 116: Auntie Gloria

Yeah, exactly.

Otherworld
Episode 116: Auntie Gloria

No, he has no idea, but he has like total certainty that there's something there. So obviously I, I told him like, let's like crack this bitch open. Like, let's do it. Let's see what's back there, you know? And yeah, It was weird. He actually got kind of squirrely about it and sort of shook his head and was not interested. Huh. Yeah. Which is super weird, right? He would think if...

Otherworld
Episode 116: Auntie Gloria

I don't know if he just, like, he's old. Maybe he just doesn't want to take on a project like that. Or maybe he doesn't want to, like, maybe he just doesn't want to be involved anymore. I don't know. I did call him afterward, too, and I offered again, like, I'll pay for, like, the materials, you know, like, and whatever's in there, you can keep. Like, it's obviously for you.

Otherworld
Episode 116: Auntie Gloria

I don't, even if it's, like, cash or whatever, like, I just want to know what's back there. But, yeah, he was not interested.

Otherworld
Episode 116: Auntie Gloria

Yeah, I did.

Otherworld
Episode 116: Auntie Gloria

So I had a friend come and I told him about like a kind of a handy friend come and like cut like a probably like a one by three hole in the wall for us to crawl into and check out. And it was a bust.

Otherworld
Episode 116: Auntie Gloria

You're right. And there's like, I cut into one section of the room and there are four sections of the room. Yeah.

Otherworld
Episode 116: Auntie Gloria

Exactly. Yeah. Yeah.

Otherworld
Episode 116: Auntie Gloria

And she ended up telling me that in 1998, when the house was rebuilt, right, because the house is from 1725, but it had a new foundation poured in 1998. And whenever construction is happening on like a potentially archaeologically significant piece of property, you're supposed to let the state know. I learned all of this since then, obviously.

Otherworld
Episode 116: Auntie Gloria

Yeah, I don't know.

Otherworld
Episode 116: Auntie Gloria

No, I think it's a gag. If anything, I think it's a gag.

Otherworld
Episode 116: Auntie Gloria

Yeah, like an inside joke. So I also had an archaeologist come and visit the house who knew Gloria too. And his perspective was like, Gloria was an extremely, extremely practical person. And he does not think she would have left anything of value there.

Otherworld
Episode 116: Auntie Gloria

I kept it pretty vague, but I did ask him if he ever hadn't any experiences in the house. And he sort of laughed and he said that Gloria believed that the house was haunted.

Otherworld
Episode 116: Auntie Gloria

I did. I mentioned it again. I was just sort of like testing the waters to see if he'd be receptive. And his response was just like, I believe it. That was basically it. I believe it.

Otherworld
Episode 116: Auntie Gloria

I haven't had any experiences with Gloria. But, you know, a couple things have happened in the past few months that I feel like have been... like above and beyond confirmation bias.

Otherworld
Episode 116: Auntie Gloria

And the biggest one is my husband, Mark, he went outside to like take the compost out and he came back in and he closed the door behind him and he turned and like just looked me dead in the eye, like had this look on his face. And I was like, what? He said, when I was walking back inside, right next to the garage, I heard somebody in my ear say, hello.

Otherworld
Episode 116: Auntie Gloria

He was like not from a distance, like not yelling far away, not inside, like somebody right in my ear. And then they said, Francis? Francis? And he literally was like, I'm not talking about this anymore. Like, once I was like, oh, my God. He was like, done. Conversation over. I don't want to think about it. And I was like, okay. But my son and my daughter overheard him.

Otherworld
Episode 116: Auntie Gloria

And they were like, oh, the voice that says my name? Like, the voice in the tree? Yeah. And I was like, what? And they were like, oh, we hear that all the time outside. It was like very nonchalant, them saying like, yeah, that's normal for us.

Otherworld
Episode 116: Auntie Gloria

Yeah, crazy.

Otherworld
Episode 116: Auntie Gloria

Yeah. Yeah. I mean, that's the weird thing is that like, there's not like a nice clean narrative structure. I feel like to these things most of the time. And there's not like, like some clear, succinct meaning to derive from it.

Otherworld
Episode 116: Auntie Gloria

Yeah, hopefully.

Otherworld
Episode 116: Auntie Gloria

See ya.

Otherworld
Episode 116: Auntie Gloria

So the homeowner at that time had let the state know, I'm putting an addition on and I'm doing a new foundation. Do you want to come and conduct an archeological dig? So they did. UConn and the Connecticut State Archeologists, like the State Historical Society, they came and conducted a dig on the property.

Otherworld
Episode 116: Auntie Gloria

And they took some of the artifacts that they found, but they left these five boxes in the basement So I was like, oh, that's cool. I didn't know that before. You know, we've got like some old spooky shit in the basement. So I just asked her really off-handed like, oh, is it haunted? And she said no. And then she paused and she looked at her husband, husband at the time, Chris.

Otherworld
Episode 116: Auntie Gloria

They looked at each other and like they gave each other this really funny look. And then she turned back to me and she said, but we did find a skull in the yard. And I was like, like a human skull? Aren't you supposed to, like, call somebody, like, if you find that? And she was like, yeah, it was definitely a human skull.

Otherworld
Episode 116: Auntie Gloria

We had a big pine tree removed from the yard, and we found all these bones, but we just gave the arborist, like, 300 bucks and told him to throw everything back in there. I was like, okay, uh... Really like fun story, like kind of a party trick that I can tell people, you know, like over cocktails or whatever.

Otherworld
Episode 116: Auntie Gloria

That was what we argued about.

Otherworld
Episode 116: Auntie Gloria

Yeah, I mean, okay, just there is like legal precedent for disclosing haunted houses. But I think that she didn't think the house was haunted. She just knew that there was a skull. Now, she probably should have reported it to somebody. But, yeah, I think that her husband, like, I feel like that knowing look was just like, Misha, like, shut your mouth.

Otherworld
Episode 116: Auntie Gloria

Don't tell them about the buried bodies, like, in the yard. Like, you know, you're going to fuck this up.

Otherworld
Episode 116: Auntie Gloria

We thought it was fun at that point. We were like, this is cool. Like, this is cool. This is like a fun, it's like, like I said, it's like a party trick. He is eternally skeptical about, But I think like even things will happen now. And he'll say to me like, if it doesn't happen to me, I don't believe it. So at that point, we had already signed the paperwork.

Otherworld
Episode 116: Auntie Gloria

So it was not even like we had an opportunity if we were like, wait, this is sort of like could have changed our offer on the house. We didn't even have that opportunity because everything had already been signed. So it wasn't like we were mad about it. You know, we still loved the house. We still do love the house. But we basically took the keys and we left. That was it.

Otherworld
Episode 116: Auntie Gloria

We get to the house, like one of the first things we do, Mark actually was traveling. I'm remembering now he was traveling for work a lot at that time. So I think I actually moved into the house without him initially. Francis and I were in the house. One of the first things that I did was I pulled all the boxes out of the basement and I brought them upstairs. and started to look through them.

Otherworld
Episode 116: Auntie Gloria

They were meticulously organized. So there was an inventory list with codes for everything, including the GPS location, exactly where on the property everything was found. And inside, man, there's so much cool stuff. A lot of it is really old, like, Pequot artifacts. Like, arrowheads, obviously, but also pottery and old bits of clothing.

Otherworld
Episode 116: Auntie Gloria

And then through colonial times, so, like, lots of stoneware, painted ceramics, like, children's shoes. And then a lot of animal, or, I mean, I think animal, some of it is unknown, but bone fragments, like, there's... horse jaws and old pipes and like bone pipes. So like a lot of really cool and pretty creepy stuff, a lot of bones down there. I kind of love creepy stuff.

Otherworld
Episode 116: Auntie Gloria

And again, like at that time it was just entertainment for me. So I was like, this is weird, but I also like, I love history. And I was, it really got me super interested in like the history of the property and who had lived here before, because there was so much. And even like, you know, my first month living here, forgot to mention this, but like there's gardens all over the property.

Otherworld
Episode 116: Auntie Gloria

I'm looking at them right now. There's like five stone garden beds. There's a raised garden. There's all this hardscaping with perennial flowers. And the first month I was here, I would find arrowheads like every other week, like just on top of the dirt, like as if somebody had placed it there. Just like beautiful stuff, old milk bottles and old ceramics. Like there's just stuff everywhere.

Otherworld
Episode 116: Auntie Gloria

So I just got really, really interested in the history of the property and who had been here before me, because it obviously had been inhabited for a really, really long time. So like I said, Mark had been traveling a lot at that time. And around February, so like two or three months later, was when it stopped being fun. At this time, my bedroom was upstairs.

Otherworld
Episode 116: Auntie Gloria

So we have the first floor, second floor, and then there's a little attic above the third floor, really small. The first visitation in February, I woke up and it was the middle of the night. I don't remember what time it was because As soon as I opened my eyes, I was looking at the bookshelf on the side of my bed.

Otherworld
Episode 116: Auntie Gloria

And in the bookshelf, I could see the outline of two little boys laying in the bookshelf looking at me. I think everybody's probably experienced like when you open your eyes in the dark and you think you see something, you think you see a figure and you just keep staring at it because you can't tell. That is not what this was. It was dark, but it was like moonlit in the room.

Otherworld
Episode 116: Auntie Gloria

And I think what was, I mean, obviously that was exceptionally strange. What was... Maybe more strange in retrospect was my lack of action. I didn't do anything about it. I didn't go under the covers. I didn't get up and walk out. I didn't scream. I didn't turn the lights on. I just stared until I fell back asleep.

Otherworld
Episode 116: Auntie Gloria

When I woke up the next morning, I think I was actually way more terrified the next day when I remembered what had happened the night before. Pretty soon after that, like three or four, I think it was three for me, one for Mark, more things happened at night and the intensity was like escalating. The second incident, Mark again was traveling.

Otherworld
Episode 116: Auntie Gloria

I was laying in bed and I opened my eyes in the middle of the night and I was staring straight up at my ceiling. And in my peripheral vision, this thick green mist was starting to like enter my line of sight directly overhead. And as it came together, it formed a very distinct face of a man, like a full head of hair,

Otherworld
Episode 116: Auntie Gloria

Eyes, but like no pupils, you know, like that didn't look like it was, it didn't look like it had anything inside of its eyes. When I saw the face come together, I wasn't like frozen with an action at this time. I let out a really loud like gasp, almost a scream that I will not explain.

Otherworld
Episode 116: Auntie Gloria

replicate because it's a little embarrassing but I made like a really loud noise of shock and the face almost like mirrored my face like opened its mouth and it I felt like it screamed. And as soon as it opened its mouth, the mist dissipated back to my peripheral. And I was just laying there in bed. Like, you know, you can imagine like scary, heavy breathing.

Otherworld
Episode 116: Auntie Gloria

So that was the second thing that happened. This time I was very scared. It was a little bit different than the previous incident. I was horrified. And for the rest of that week, actually, probably for the rest of that year, if I ever woke up in the middle of the night, I'm not religious. I'm kind of anti-religious.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

It felt like he was consciously recognizing that we... That he, that it was, that he was like, yes, I am a man. Like he, he stood up on the back of the car to be like, I, yes, you were right. I have the face of a man.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Cause it just wasn't, it was like not, um, like it wasn't big, big. Well, the other thing too is like, it's, it had paws and it had like skinny little legs and there was no way anything was inside of that creature. The body was so distinctly mangy and, and dog.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Like the other thing too is like, you know, you see coyotes in LA and you see, and I've seen wolves before, but it wasn't like that either. It was very much like the body was, was almost too, I don't know what the right word is, like too,

Otherworld
Episode 114: The Michigan Dogman Pt. 2

gentle not gentle but like soft and and and skinny and to be a coyote or to be a wolf like it was definitely a dog and the and the tail wasn't so coyote like either the tail was the normal tail of a dog like like not crazy big it was just like it felt to me like like my uncle used to have this dog named, um, named Digger. And it felt very much like the tale of Digger, but the coat was very dark.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Like the coat was sort of this like brownish reddish blackish coat. I remember. And then the face, the hair on the face sort of was less so like the hair there was hair on the face, but it wasn't like, it wasn't like dog hair. And the features were distinguished. The lips were distinguished in a way that humans' lips are distinguished.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

The eyebrows, it had distinguished... And the eyebrows weren't even comical eyebrows. It made sense for its face. The dog, because I was sort of recessed from it, looked from afar to be like 60, 80 pounds-ish. And... I remember I turned back to see my uncle, to look at my uncle when he said, turn around and look at that dog's face. But I remember it looking smaller.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And then when it came up to the side of the car, you know, Land Rovers are tall cars. And so I remember it thinking like, wow, this dog is really tall because the dog really was looking at us, like almost level to us through the back of the car. So I think the dog, I mean, I don't know how tall the dog was. on all fours, but on two must have been maybe the height of a human man.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

So my uncle looks at us and is like, turn around and look at that dog's face. And we turn around And the dog has since approached the back of the car. And it was almost like turn around and look at that dog's face. And then the dog, as if it knew that my uncle had said that, appeared in the back window looking at us, very curious about us, but also confirming

Otherworld
Episode 114: The Michigan Dogman Pt. 2

This is my face, you know, like, oh, you're asking about my face. Here I am. I remember being like mystified almost like, like, like, whoa, that is crazy. That dog, that dog has the face of a man. Like I was 13. I wasn't, you know, maybe a complex thinker, but I was just like moved by seeing a dog with the face of a man.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And my mom's, I remember looking at her after I saw the dog and she couldn't take her eyes off the dog. And she was just like, it was one of those things where it was just like, oh my God. And it was that collective experience that we were all having where I think if I'd had this experience alone, I would wonder today if it actually happened.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

But because I looked into the face of all the people that were looking at this dog, we were all having this mystified sort of trance-like experience for a moment. that I knew it was real. And then I remember my uncle was like, we got to get the fuck out of here. And like, was like, we got to go. And my aunt started going like, go, go, go, go. Because they were like terrified.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

By that point, they were terrified of the dog. I was totally in sort of this like trance-like experience. But then when they broke me out of it to sort of with their own fear, I was like, oh, fuck, that is really scary. And then I remember thinking like, this dog definitely knows where we live and definitely knows how to find us. Like, I don't know why I thought that, but I remember thinking that.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

So we like drove out of there. We like, you know, he laid on the gas and we drove back to their house. We drove directly back to their house in Buchanan. And then I remember that night like I was in my bed and it was dark and there were no lights and the sound, it was very quiet. And then that night, I swear to God, there was so much howling.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Like there was so much howling outside, but it didn't feel like a lot of dogs. It felt like one dog or wolf or whatever. It felt like one animal was making a lot of noise. When we got back to the house, we called my uncle, who lives in Dallas now, because he's really into spooky stuff. He's like a conspiracy-lite kind of guy.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And we called him, and I remember he Googled it while we were on the phone. And he was like, oh, there is this thing, this dog, man-dog. At the time, we were calling him man-dog. But... He was like, there is this man-dog theory that there is a dog with the face of a man that many people claim to say they've seen. At the time, it wasn't in reference to Michigan.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

It was just like this thing he found on the internet. And he asked us, I remember he asked us a lot of questions and was really like into the story, which is I think why another reason why I really remember this happening too is because my uncle was so like... He was just surprised that we had run into something so mystifying.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

He'd always wanted that experience for himself, maybe, and was really excited that we'd had it. In my memory, I think me and my mom were leaving the next day, and I think they drove us back to the airport. And the whole time, we were just like... Not the whole time, but we were like, that man-dog was crazy. Like, that's the craziest thing.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

But again, something you need to know about me and my mom, too, is that we're not crazy ghost people. We're not crazy, like... I mean, now, thinking about it and telling the story, I'm like, maybe there is sort of this... presence in that dog that I should have recognized and been more consciously aware of in that moment because he clearly was trying to say something maybe.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

We're not big, spooky people. So we kind of were like, that was the craziest thing ever. And then we kind of got on a plane and went back to Dallas. And every once in a while, we'd be all together and we'd tell the story to somebody and we would talk about man-dog. But it was more of a funny thing because a dog with the face of a man in a lot of ways is... ridiculous.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And I think telling the story was really fun for us because we got to be like, yeah, that actually happened. There were four of us in the car and that happened. And I think people were always really surprised by that. So that was fun for us. I mean, I think the thing that will be more interesting with my aunt than with me is that she was a full adult when this happened.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And she knows that area very well because she had a house there. And she also like There's the funny thing is when this got brought back up, there was no point where any of us were like, did that happen? We were all like, oh, yeah, man dog. And that, I think, is to me the most striking part about it is that there is there was it's not even like any of us were like, wait, what?

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Or, you know, like, oh, yeah, it was completely for everyone. Like, yeah, man dog.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

I'm worried about all the science. Up in the sky.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

I'm Grace. I am 31. I live in Los Angeles. I'm a director and I grew up in Dallas, Texas. I went to Boston College and then I went to work in New York. I actually worked at Saturday Night Live for a long time. And then I came to LA two years ago and have been directing for like three or four years, and just directed my first feature. I'm engaged to a guy who's obsessed with Otherworld.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

My fiance's name is Jack and I love him so much. And he moved to New York for me because he lived in Austin when we started dating. And then he very kindly moved to LA for me too. So he's been following me around. So I have to tolerate, you know, things like his podcasts, him repeating the entire story of a podcast out loud, which podcasts can be riveting, but the retelling of them is less so.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And he works at this wine store. He works at Silver Lake Wine with a guy named Steven, who we love. And Steven introduced him to this podcast. I also have been seeing Otherworld podcast billboards all over town. But I would kind of send the picture of the billboard and Jess to the both of them because I'm going to be honest with you.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

I'm not a fan of this podcast only because I'm not... It's not you or the hosts. It's just I don't like spooky stuff. I'm not into ghosts. I'm not into, you know... unidentified flying objects or anything. Sure, sure. I'm just like, I'm sure it's out there. It's not like I'm... It's fine, Grace. It doesn't exist, but it's just not for me. And so Jack... It's not you, it's me.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

It's not me, it's you. But Jack's obsessed with it. Jack loves...

Otherworld
Episode 114: The Michigan Dogman Pt. 2

ghost stories he loves that kind of stuff so does steven and so they have like they like really created their friendship over this podcast and now i mean we went to their house last night for a movie night like we're very close with them and it really i think this podcast is part of that and so i i had never told him this this we call it man dog but i'm hearing people call it dog man

Otherworld
Episode 114: The Michigan Dogman Pt. 2

My mom was in town a few months ago, and so I had two friends over for dinner. And I cooked dinner, and my mom was there. And our friends were talking about how they think there's a ghost in their apartment. And then Jack was sort of pulling answers out of them because he was really interested in their ghosts. I mean, even in our house that I'm sitting in right now, we have... It's really old.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

It's from the 1920s. And a woman died here. And, you know, the lights act strangely. And Jack thinks it's a positive ghost. Only love and light exist, he's always saying. But, you know, I'm like, whatever, that's just an old house. And so we were sitting here and he was like at this dinner with my mom and my two friends.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And he asked the table, he was like, does anybody else have any sort of otherworldly stories? My mom looks at me and she goes, well, do you remember Mandog? And I was like, oh, my God, I completely forgot about Mandog. And obviously Jack's ears perked up and he was like, man, dog, what are you talking about? And then my mom was like, well, we were in Michigan.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And then Jack stopped her and she goes, wait, you know, the Michigan dog man is like a legend. And we didn't. We knew that, like, Dog Man, or Man Dog as we call it, was sort of a, you know, a lore. But I didn't know specifically that the Michigan Dog Man was this, you know... interest in a lot of worlds of otherworldly conversation. And so I remembered it.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And my mom told a very brief version of the story, which is what I remember. But I haven't really intentionally, because Jack wanted me to do this podcast, I haven't really heard their full versions because I think probably for the best... for your storytelling and for this story, I could just tell my version of it.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Because if you talk to my aunt, she might have a, I think memory works in very funny ways. So I think it might be more interesting if we tell you our raw versions of our stories. And so my mom told the story, the brief version that night, which was when we were driving through rural Michigan. We saw this dog with the face of a man.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

I kind of like had put it back somewhere in my brain, but it wasn't something that was like, oh, it was like, oh yeah, the man dog. It wasn't something that took me a while to recall. It was something I remembered immediately. When my mom said that, Jack was like, why haven't, you've never told me that? That's the craziest thing that you've ever done. Why haven't you told me that?

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And I just hadn't even thought about it in a really long time. So I think it was just one of those things. I also am not a person who is like, That was otherworldly. That was spooky. I was just like, that was really weird. That dog had the face of a man.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And so it wasn't something that would have been something that I would have been like, oh my God, I had this spooky story because I really didn't have a spooky story in my head. It was more of like a crazy thing that happened to me. I was 13. My aunt had an apartment in Chicago and a house in like a country house in Buchanan, Michigan.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And we were going to visit her house because we'd never been there. And her husband is an artist who is very talented at a lot of things. And he, they bought this house in Buchanan and they, um, It was an old house that he modernized with, you know, a new architecture and an add-on. And it was still, it had the sense of it being old and the basement was really scary, I remember.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

But it was also a testament to their style. He loved mid-century modern stuff. And my aunt has like a tiny collection of chairs that are all like famous mid-century modern chairs. Like they're into that kind of stuff. I remember at night, it was so dark and so quiet that you almost couldn't sleep. Only sounds you would hear were like howls and rustling and like the scariest shit ever.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

So sleeping there, I remember, was like a nightmare for me. And so we went out there from Chicago and we were there. I was 13. I was probably, you know, whatever, eighth or ninth grade. I ended up going to my mom's room and sleeping in her bed, I remember, because I was so scared.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

I remember also like, it took a while to get anywhere because the roads, I mean, you were just so far out that your house would be 30 minutes away from wherever you were getting your supplies or going to a restaurant or, in my memory, it was very far away. And so they were all, and all the roads were super rural. You barely saw another car when you were driving down them.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

There was sort of just like land to the left and to the right. And so they had a nice house on their street, but the houses next to them were not very nice. Like they were like, you know, run down and people clearly weren't keeping, you know, maintaining them. And they were a little spooky, you know, like I wouldn't want to go there alone. Yeah.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And everybody's house was super set back on their lots. So you could see them, but not completely. So yeah. It was also like that weird thing of not seeing anyone was sort of scary. Like you really did feel like you were alone everywhere you went. There weren't a lot of people around until you went to like a restaurant or a farmer's market. Then you would see a lot of people.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

But clearly these people are coming from all over the place. I remember not sleeping very well, obviously, because of the darkness and quietness. And we got up and we were like, we went to breakfast. We had lunch. We did the thing. We went and had drinks. And then I remember it being dusky. Like, I remember part of the reason we left was because it was getting, it could get dark soon.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And so I remember we were driving from like one place to the next and it takes a really long time. So we were going down these super rural roads. My aunt and uncle had this Land Rover and I remember the Land Rover because when we were driving in Michigan, we would pull over all the time if there was like a dead animal in the road and she would check on it.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Or, you know, if it was like a raccoon, she would like take its tail. She's very strange, but amazing. The four of us are in the car. My uncle was in driving the car. My aunt was in the passenger seat. My mom was on the left side in the back seat and I was on the right side in the back seat.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And we were driving and obviously the, we were driving on the right hand side of the road and, and you know, we'd just come from something. And I remember it being like a pretty rural part of the road. And we, we kind of are driving and we see something ahead in the distance and it's sort of like a,

Otherworld
Episode 114: The Michigan Dogman Pt. 2

To me, I remember it being like, I didn't know what kind of animal it was because it was sort of, you know, when a dog is sleeping and it wraps itself up in itself. So we're driving and we see something ahead on the road and I don't really know what kind of animal it is because it's sort of curled up in itself. And my uncle, I remember him being like, what is that?

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And then my aunt, we pull up next to her and my aunt, you know, she likes to check on animals, as I said, and so... she was like, wanted to get out and check on it. And my, I remember my uncle being like, no, stop. I don't think you should get out of the car. And he got out of the car. And I remember I was on the side of the road that had the dog on it.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And so I remember like opening the door to the car and watching him go out and look at this dog. And the dog stood up. When the dog stood up, I remember being like, like the thing I'll say is the dog to me reminded me, do you know when Sirius Black turns into a dog in Harry Potter?

Otherworld
Episode 114: The Michigan Dogman Pt. 2

So I remember the dog having that kind of shape, like mangy, but skinny, but long and, and sort of feeling sad for the dog because feeling like the dog maybe was abandoned or whatever. But when it stood up, it was very clear that the dog had confidence in the dog. This is a weird thing to say, but it felt like the dog knew itself. You know what I mean?

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Like the dog was very aware of itself and self-assured. And I remember my uncle was like, whoa. And he took a few steps back. He slowly, slowly walked back to the car. And then he got in the car. He closed the door and said, look at that dog's face. Like, look at the dog's face. And as we turned back, I remember the dog started approaching the back of the car very slowly.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

And the dog, I swear to God, we look behind us and we're all looking out the back window and the dog props itself up onto the car and looks at us through the back window. And the dog, I swear to God, had the face of a man. Like it was a man's, it wasn't a threatening face, but it was very clearly a human man's face. Like,

Otherworld
Episode 114: The Michigan Dogman Pt. 2

so masculine in the way that it reminded me of, in my memory, it reminded me of like Cary Grant or like Marlon Brando, like really distinguished, confident, you know, rugged, a little bit man, like truly like a leading man. You know how a dog's face is pointed with its nose? And you know how like a pug is flapped? it was neither of those things. It was sort of like the shape of a human.

Otherworld
Episode 114: The Michigan Dogman Pt. 2

Like it was rounded in a way that doesn't, that I've never seen in a dog before. Like it was, or since I have two dogs, one sitting on my lap. And like the funny thing about it was, it was, yeah, it was just like, it didn't have like a point to its face. It didn't have a smashed face. It had like a curved human face. And so it,

Otherworld
Episode 114: The Michigan Dogman Pt. 2

I remember that being the thing that made me be like, oh my God, that's the face of a man. Like it wasn't a dog, the face, the body completely. But the face was strange in its... And the thing was, it looked at us too. So I think the looking at us, it looked at us and it felt like being looked at by a man. It didn't feel like when a dog looks at you.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

Hi, John. How are you?

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

It was definitely a hard conversation. I kind of anticipated it not going the way it went but just maybe not having the outcome we wanted um simply because there's like other tensions you know in life right now and um i'm the oldest of four just to give some context how old are you and i'm 26 i just turned 26 in january um and

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

mine and Ethan's relationship is my first like long-term genuinely, like this is going to happen kind of thing. Um, and on top of that, it's been long distance. So, you know, that ropes in some difficulty as far as family time and them getting to know one another and things like that.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

And, um, we'll be having dated a year in April, but it's just, it's come with its own like good and bad at times, but, Going back to that conversation, I think it was a lot of fear that was like the root of that reaction.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

Yeah, that was my biggest fear.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

I don't think it was, it was never an intentional, let me set him up for this to happen the way it did.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

I think my inner fear was, what if this happens? But then on the flip side, I was like, I would hope at 26 they can see that I'm happy and we're happy and then just be in support of that and be happy for us kind of thing.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

I mean, I think to them support looks like being available or being involved in a way. Um, but I've never truly dated someone where it was like, I knew I wanted to spend life with them. Like I wanted to have them around and, you know, pursue life with them.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

And so I think there was always an idea that it would be somebody familiar or somebody close to home or, you know, not necessarily like states away. Um, And so things being different than expected, it's just been very hard for them to come to terms with that.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

In all honesty, it just triggered the little girl in me. And believe me, John, believe me. And I wanted to speak up, but I felt like I couldn't in a way. Have you gone back? I felt like I was the one in the wrong since then. Have I gone back and spoken up? Oh, for sure. Yeah.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

I know it was heard and it was very honest and straightforward. And I think it established a boundary that was probably not known before. Prior to now or prior to that conversation.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

Um, Honestly, for me, it's not really a codependency thing. It's more so just that as their oldest daughter, I always prayed for and envisioned them having that relationship with my spouse, significant other, before they could hand that over with joy and excitement. And I can't make them feel those things.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

I think they do feel those things, but there's, it's a, it's coupled with grief because they see their daughter's not going to be around like she always has been. Sure. And available to them in ways that I have been. And, um, like, you know, life has ultimately dealt, dealt my family cards in ways that it's like, at the end of the day, all we had was family. Sure. Like the six of us.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

And so that is what's hard is drawing that line of separation, you know, to step away from that. And so it's like at the end of the day, I know I love my parents and I, you know, I seek their wisdom and all of that. But I also know that I am an adult.

The Dr. John Delony Show
I Only Feel Loved by My Wife When We Have Sex

Yeah. Yeah.

The Ramsey Show
Be the Tortoise Not the Hare

So I just took a sales job. I was working in ministry before. My base income is $55,000 for the year, so I make about $3,500 a month, not including commission. I'm just starting to make any kind of commission.

The Ramsey Show
Be the Tortoise Not the Hare

I wanted to go to med school, and so I went to a private school. I went and played volleyball. I made terrible choices. I didn't have great oversight from my parents on what signing a private loan meant. And now I'm 27 and I'm really, really feeling the weight of that.

The Ramsey Show
Be the Tortoise Not the Hare

I did graduate, but I ended up feeling like I was being called into ministry, so was obedient to that.

The Ramsey Show
Be the Tortoise Not the Hare

No, no, no. But I was 18 and stupid.

The Ramsey Show
Be the Tortoise Not the Hare

He actually is not scared. He knows that this is right and this is from the Lord, and he is like, we're going to do this together. We're going to tackle it together.

The Ramsey Show
Be the Tortoise Not the Hare

I know. You don't believe him.

The Ramsey Show
Be the Tortoise Not the Hare

I am, and I feel empowered, so thank you. All right, here's the deal.

The Ramsey Show
Be the Tortoise Not the Hare

Hi, how are you guys?

The Ramsey Show
Be the Tortoise Not the Hare

I love that. I love that. Thanks for having me.

The Ramsey Show
Be the Tortoise Not the Hare

I was calling in because I am getting married later this year. My fiance has no debt, but I am bringing in quite the load. I have about $180,000 in student loan debt. That's all private. And about $15,000 in credit card debt. And I've been told multiple things. I've been told to file for bankruptcy while I'm single. No!

The Ramsey Show
Be the Tortoise Not the Hare

Yeah. So I just, I feel a lot of options. I've been grinding. I got a higher paying job and I'm really trying, but I'm just curious, you know.

The Ramsey Show
Be the Tortoise Not the Hare

They have, but I mean, my monthly payment is about $800. I've defaulted on two of them already because it's four separate loans. And I just feel like every single month I'm barely scraping by.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

Hey, thank you for having me on. Sure. Um, yeah, so let's see about eight years ago, 2016, my mom tragically passed away. Um, I was just graduated high school. My whole community just rallied around me. They, you know, supported me. They, you know, did fundraisers and, um, got me a pretty big lump sum of money enough so I could buy my first car, my first laptop so I can get to college.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

It was just absolutely fantastic. Um, so that, that in itself is absolutely amazing. Now, fast forward six years from then. So two years ago, um, me and my, we were fiance's or my fiance, then we're married now. We were trying to save up for our wedding and trying to just pick up extra shifts and really didn't want to go into our marriage with any debt, um, especially not from our wedding.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

And so unfortunately though, we had racked up about a $2,000, um, give or take a few, um, And randomly, one of my mom's friends from whenever she was alive, she messaged me just one day randomly and said, hey, there's a bank account that is for you that we set up that has the money in it. And I don't know why, but they hadn't given it to me.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

I think they had just forgotten or something had happened. Um, anyways, long story short ended up being the exact amount of money that we were in debt, um, on our mom, my credit card. And so it was just amazing. People had given money and putting this, put it in, put it into an account for us. Um, and then six years later, it was still there and it just.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

just shows how good God's grace is and that it's never ending.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

God's hand. Very precise.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

Oh yeah, absolutely. Yeah. Anytime, anytime we just,

The Ramsey Show
It’s Our 2024 Annual Giving Show!

it's really not even a second thought sort of thing it's just like if I have this and somebody else needs it absolutely we just had our first first child about seven months ago so even then having a child and just seeing how giving people were for her and just for us and it's just it's amazing how um how kind and generous people can be and it does it has it has moved us in ways that

The Ramsey Show
It’s Our 2024 Annual Giving Show!

I don't think people will ever really know.

The Ramsey Show
It’s Our 2024 Annual Giving Show!

We just have to repay what we can as often as we can.

The Severance Podcast with Ben Stiller & Adam Scott
S2E7: Chikhai Bardo (with Dichen Lachman and Jessica Lee GagnΓ©)

Hi, my name's Grace. My question is, if your innie had a wellness session with Miss Casey, what facts would you want them to know about your outie?

The Viall Files
E889 Ask Nick - Rebound Rodeo

Hi, how are you?

The Viall Files
E889 Ask Nick - Rebound Rodeo

My name's Grace.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I am wondering if my situationship is a narcissist.

The Viall Files
E889 Ask Nick - Rebound Rodeo

We started seeing each other two years ago. Actually, our first date was a year ago yesterday. And we kind of were like in this often, like we started seeing each other and it went really, really quick. Like he was driving me to the airport. We were like meeting each other's family super, super quickly. I'm a little bit younger. I'm 24. He's 28.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And it was kind of like a dream come true, like fairy tales type situation. And we actually didn't even like Und was war der Grund dafür, dass du sagst, wer entscheidet, dass Dinge langsam gehen? Er. Es ist einfach nie so passiert, glaube ich. Wir waren stÀndig draußen und machten Dinge.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ja. Auch damals lebten wir beide mit unseren Eltern. Also hat das auch eine Rolle gespielt.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ja, ein bisschen. Und dann fassen wir weiter. Es gab viele Parallelen bevor wir uns kennengelernt haben. Der Grund, warum wir uns kennengelernt haben, war eigentlich, weil ich seinen Freund vor ihm gesehen habe. Der Freund und ich sind auf vier Dates gegangen. Es war nichts ernsthaftes. Er suchte keine Beziehung. Sehr amikabel. Wir stoppten zu sprechen.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Zwei Tage spΓ€ter kam ein Freund zu mir und wir haben uns angefangen, einander zu sehen. Wir hielten es unter Rappen, weil ich derjenige war, der sagte, ich mΓΆchte nicht, dass du ein Freundeskreis machst, wenn das nicht wirklich etwas sein wird. Also mΓΆchte ich, dass du ihn erzΓ€hlen wirst. Und wir waren beide auf der gleichen Seite darΓΌber. Und dann war Memorial Day Weekend.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ich habe mich da ein bisschen verwirrt. Sie sind Freunde. Sie sind einfach wirklich nahe Freunde.

The Viall Files
E889 Ask Nick - Rebound Rodeo

That's how I knew who my situationship was. Like he followed me on Instagram while I was talking to his friend.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And then DM'd me on Instagram after we stopped talking.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Like the next day.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Yes, he did know. And he told, when we first started talking, he told me a lot about the guy that I was seeing that like some bad things. He talked shit. Maybe he necessarily wasn't a good guy.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Okay. Yes. It's a red flag. So then fast forward to we both go to the same beach town. We actually have houses on the same street across from each other. And so when we first started talking, I thought this was going to be, that was like the dream situation. I was like, that's amazing. He was doing a house in a beach town a little bit north with a bunch of his friends for the summer.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And the guy I was talking to before was in that house. And I kind of put the pressure on of like, I want you to tell him because we are actually like... dating now and you need to tell him. So he said he told him, he said it went really poorly so I couldn't really come to the house very often. We couldn't really see each other that much that summer.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And it was kind of like pulling teeth to make plans with him that summer.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Genau, ja. Und er war auch sehr, ich initiierte den Hooking-Up mehr als er. Er war viel weniger in dieser Partie. Und das hat mich immer ziemlich unabhΓ€ngig gemacht, weil in meinem Vergangenheit hatte ich Leute, die das alles wollten. Und zuerst hat es mir gefallen. Aber dann wurde es mich ziemlich unabhΓ€ngig gemacht, weil ich mir dachte, warum machen wir das einmal pro Woche oder zwei Wochen?

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ich dachte, das wΓ€re seltsam.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I wouldn't say begging, but yes.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Initiating, yes. And then September rolls around. We both are back home. We start seeing each other a bunch more. I'm thinking, oh, this is great. This is what I wanted. The summer doesn't matter. Awesome.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Sein Geburtstag war im November und ich habe ihn zum Abendessen genommen. Und dann am nÀchsten Abend ging er nach Hause um mit einigen Freunden zu gehen. Ich ging zurück nach der Strandstadt mit einigen meiner Freunde. Und er war wirklich trank auf dem Golfkurs. Und ich konnte sagen, dass etwas aufgefallen ist. Wir haben auch Beziehungen mit einander geteilt, wie durch all das. Das ist großartig.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Essentially, I guess. We had talked about rules and expectations back in like May. But once we started kind of seeing each other again in September, when things got more serious again, we never like reset those expectations, I guess. And I was kind of just happy that like he was giving me what I wanted again. And so then that night he was like golfing, he was really drunk.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And I like looked at his location. He was in the car. I was like, okay, I'm going to call him. Er hat nicht geantwortet. Und er hat gesagt, ich bin in der Fahrt, ich kann nicht antworten. Und in meinem Geist bin ich so, das ist seltsam. Du bist wahrscheinlich mit jemandem, mit dem du nicht in der Fahrt sein solltest. Er ist wirklich seltsam, dass er mich diese Nacht nicht geantwortet hat.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Also bin ich nie der Art von Person, der mehr als einmal ruft, mehr als einmal schreibt, aber ich war so, dass etwas passiert. Und so habe ich ihn ein paar Mal geholfen, er hat nicht geantwortet. Am 2 Uhr morgens bekomme ich einen FaceTime von ihm und ich war so aufgeregt. Und es war diese Frau. Und er wurde in den Uber verabschiedet und sie war so, hi, bist du sein Cousin?

The Viall Files
E889 Ask Nick - Rebound Rodeo

Und ich war so, nein, absolut nicht. Ich habe ihn gestern Abend nach Hause genommen, eigentlich fΓΌr sein Geburtstag. Und alle MΓ€dchen im Auto fangen an zu schreien. Sie fangen an, ihn aus dem Auto zu schlagen, rippen sein Shirt. Ich bin so verwirrt. And he's blacked out at this point. I had no idea what was going on. And so then me and him got coffee the next morning.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And I found out that he had started seeing that girl in July over the summer. And it was this girl that he was really good friends with, that he would hang out all the time. That was his old boss. It was her sister. So he never technically lied to me about where he was. Because he would always tell me when he was with that friend. Yeah, but he lied to you. Well, yeah, he lied to me.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And I was struggling a lot because I'm like, we weren't actually dating at this point, but it felt like being cheated on. And he lived this double life, but I was kind of the one in the background. She was constantly with all of his friends down at that beach town. He was like, I could bring her around because it wasn't a problem with my friends and I didn't want to cross my friends.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And I'm like, well, you made that decision when you reached out to me. And basically made it seem like he was like, I was two-timing you guys and I got caught. And I was devastated by this. Ended up talking to him again about two weeks later. Spent Christmas together that year. This was last year. After you caught him? Huh? After you caught him? Yeah.

The Viall Files
E889 Ask Nick - Rebound Rodeo

She blocked him on everything and never talked to him again.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I guess. I guess you could say that. I was the one that initiated keeping talking to him. This was also my first, the most serious I had ever been, really, with anyone. So then... Ended things on New Year's Eve last year. And was like, I am not into a serious relationship at the moment. And I was like, okay, I was sad. But then about a month later, he reached out again.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And then we were just in this on and off situation. He would reach out. I would ignore him. I would reach out. He would ignore me. All these things. Fast forward to last summer. Our house, he was actually at his house that's across the street from mine. And we had really been hanging out again. And then all of a sudden I get a text on like a Friday before I went down the shore.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And he was like, I don't think we can be friends. I'm seeing someone. Meanwhile, four days before that, we were hanging out. And then I literally had to watch him bring this girl down to the shore right across, like I could see his house from my bedroom window. And like we were on the same beach, pretended like he didn't know me. They were seeing each other for like a month.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I was moving across the country two months after that. So I had this big move coming up. I got a new job and was like trying to do better for myself, trying to move on. He was seeing that girl for like a month. It devastated me. He had her down the shore every weekend and then they stopped talking. He blocked my number for like a week. and then called me on Instagram.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I didn't even know you could do that. And I was just so confused by all of this. He stopped seeing her, started seeing me again, then I moved across.

The Viall Files
E889 Ask Nick - Rebound Rodeo

He has me blocked on everything.

The Viall Files
E889 Ask Nick - Rebound Rodeo

No, no, I didn't block him. He blocked me.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ich habe seit ca. einem Monat blockiert. Ich denke immer noch darΓΌber nach, was fΓΌr mich wirklich schwer ist, weil ich mir nicht gewohnt bin, so etwas ΓΌber jemanden zu fΓΌhlen. Es dauert mir viel, um jemanden zu lieben. Wie fΓΌhlst du dich ΓΌber jemanden? Thinking about them every day. Sure.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I get sad because I feel like, you know, if I, the classic, like if I was enough, then like he never would have started seeing that other girl. And like, we would be in a different spot. Maybe I wouldn't have moved like all of these like moving parts, like being, I'm so mad at him, but I'm also, but I also miss him.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I thought I did. But I don't know how I could love someone that would do such bad things to me and show me that he doesn't give a shit.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Zwei Jahre jetzt, ja.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Yeah, that's super accurate.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ja, das ist... Meine Mutter sagt mir immer, dass ich keinen Selbstvertrauen habe, wenn ich mit ihm weiterrede. Das ist definitiv wahr. Ich fΓΌhle mich immer mit Selbstvertrauen im Allgemeinen, mit MΓ€nnern, mit MΓ€nnern, mit MΓ€nnern, mit MΓ€nnern, mit MΓ€nnern.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Das ist nicht ein Problem. Ja, das ist es. Das ist es, mit dem ich gestruggelt habe. Ich fΓΌhlte, als ob ich stΓ€ndig kΓ€mpfe, um zurΓΌck zu kommen, wo es zu Beginn war. Aber das war so lange weg.

The Viall Files
E889 Ask Nick - Rebound Rodeo

And I think when I moved it like I'm across the country now. So it's like it's even more pointless to have it still take up headspace. And like I'm definitely trying. I do go to therapy. I honestly think my therapist at this point is pretty fed up with hearing about it.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ja, ich habe es nie so gedacht, aber ja, das ist sehr aktiv.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Yeah. I started reading the Lethem Theory book by Mel Robbins and I have been highlighting the shit out of it because I feel very... It's the same for, yeah, Mel, like, whatever, she has a lot of good things to say.

The Viall Files
E889 Ask Nick - Rebound Rodeo

my friends here they have now instituted a rule that if i bring him up they get to pretend like i'm not part of the conversation because like i'm a yapper i love talking that's it's just my thing and they get to have a conversation and pretend like i'm not even there and they're not they're just gonna ignore me for like five minutes which i've appreciated and i think i realized that like

The Viall Files
E889 Ask Nick - Rebound Rodeo

And what are you thinking about? You know, I think about how it was in the beginning. I think about missing that aspect of things. I think about how he betrayed me. But also, like you said, I'm not really the victim anymore ever since I decided to go back. And actually, when I moved to where I live now...

The Viall Files
E889 Ask Nick - Rebound Rodeo

I met a girl at a bar and we were chatting and she was really cool and I really wanted to be her friend. And then I found out, we connected the dots, that she was best friends with the girl that he two-timed me with. And it kind of just like, the first person I met when I moved here.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Yup. That's exactly what happened.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I have been.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I feel like I've gotten sucked into the social media of it. Everybody's saying that everyone's a narcissist. How to get over your narcissistic ex or all these headlines. I'm sitting here watching all of them being like, oh my god, yeah, oh my god, convincing myself, whereas I never totally thought that. Wenn wir uns gesehen haben.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ja, ich habe es nie so gedacht, dass er mich blockiert hat. Und wenn er mit jemandem gesprochen hat, war er besser.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Ja, meine Mutter macht mich ziemlich wΓΌtend, weil sie sagt, du hast eine Traumwelt. Genuinely, du hast so viele Dinge, die Leute trΓ€umen, und du bist hier, fΓΌr dich zu entschuldigen, ΓΌber jemanden anderen.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Yeah, she stopped listening a long time ago. Let's just say that. And rightfully so.

The Viall Files
E889 Ask Nick - Rebound Rodeo

I can do hard things. So that's what my therapist says.

The Viall Files
E889 Ask Nick - Rebound Rodeo

It really was. I really appreciate it. Thank you.

The Viall Files
E889 Ask Nick - Rebound Rodeo

Okay, well.

This American Life
835: Children of Dave

On the drive back from the theater, Grace was like, Wow, horny Zendaya tennis movie sure was horny, don't you think?

This American Life
835: Children of Dave

Right. But the movie was also like really horny, right? Did it make you horny? Uh, maybe.

This American Life
835: Children of Dave

Bowen, did the horny Zendaya tennis movie make you horny? Why are you being so immature about this?

This American Life
835: Children of Dave

Which you can't teach.

This American Life
835: Children of Dave

I don't know. It's an MRS div. What do you mean?