Kristen
Appearances
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Well, there was a read receipt.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Well, I mean, we met through mutual friends and, you know, we just kind of clicked and we went to a concert together and I thought we had a great time. And yeah, I haven't heard it from him ever since. And, you know, I'm trying to figure out maybe why that happened. And I'm yeah, I'm at a loss.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
So we went to a concert and we had a couple of drinks and we made out and I think he was looking for something maybe a little more And I kind of backed out. You know, I'm not kind of looking for a hookup right now. You know, I think maybe I sang too loud and got a little drunk. Maybe he didn't like my singing. I can get a little loud and boisterous. So maybe that maybe scared him.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
I mean, that's what you're supposed to do at a concert.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
I mean, I thought it seemed okay, but now that I haven't heard from him, I'm really trying to rule out what the possibilities were. And, you know, I wish he'd be an adult and, you know, have a conversation if there was an issue. Maybe it's just he wanted to hook up.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
I guess, you know, and it's a real bummer that he couldn't just be up front and tell me that, you know, if that was what he was looking for and, you know, I wasn't giving what he wants. He could just be an adult and say like, hey, you know, for whatever reason, I'm not interested and be gracious about it as opposed to just hiding.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Yeah. Yeah, he was kind of handsy and, you know, kind of got a little below the equator. Okay. And, you know, I kind of pulled his hand away and I'm like, I don't know if I'm ready for this quite now, you know. We ended the night on a nice note and, you know, I didn't really want to take it any further for the first date.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Yeah, no, no, no. You know, I mean, he wasn't thrilled about it, obviously. But yeah, I just, I don't know why he ghosts me about it. He could have just been upfront about it.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
at the beginning you know and that's kind of what I want to find out a little bit more about and you know if there's a good reason why he ghosted me then you know, I'd be really interested in potentially having a second date, but you know, I guess we'll have to find out why.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Yeah, so Garrett and I met through mutual friends. We went out on a date because we clicked almost instantly. And we went to a concert and... After the show, he ghosted me. It's been three days. I sent him a text. He left me on read. And yeah, I want to figure out why. Like, did I get a little bit too drunk? Was my singing really loud and bad? Or was it just that he was looking to hook up?
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
And I'm not too sure which one it was, but he seemed a little bit upset when we were making out and his hands started to go a little bit south. And I told him I wasn't looking for that. So I want to figure out why. And if there's a good reason, then, you know, I'd love to have a second date.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Yeah, OK.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Nice to hear from you. Yeah, I didn't know I would. What happened? You know, I texted you three days ago and, you know, I said I had a nice time and you disappear and ghost me. Like, what's up with that?
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Yeah, well, I mean, the thing was, like, we met through friends, and if you wanted to hook up and we were drinking that first night, why didn't you just take me home with you? Like, I don't understand, like, why would you go to a concert and make it an event? You know what I mean? Like, if you wanted to hook up, we could have done it that night when we were just drinking together.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Like, you bought concert tickets. You picked me up. Like, we went to a show. I thought maybe you were a little more interested.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
This conversation is wild. You can't text me back like an adult and say, Hey, I had a nice time, but you know, maybe we're not looking for the same thing. Like you could at least be courteous. Everyone's on their phone the entire time. Like everybody's on social media and you say you're too busy to respond to a text. Like that doesn't apply.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
The most obvious form of ghosting.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
I mean, he could have just been up front, you know, and just said, hey, like, you know, I'm looking for this. And if I said I wasn't looking for it, then it's like, okay, well, we can't give each other the same thing. Have a great, you know, life.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
It's supposed to be implied. Okay, you think I'm a mind reader? Like, what's up with that? That's so rude.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Thank you for your honesty, but yeah, I just, you know, you could have had better communication.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Well, Garrett, how would you feel if I said I actually want to sleep with you? I just didn't want to do it on the first date.
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
All of a sudden, no. Yeah. Not on the first night. So what does that mean then? Is this going to happen?
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Hi, I'm, besides being ghosted, doing great. How are you doing?
First Date Follow Up - The Jubal Show
Kristin is getting ghosted by Garret - let's find out why
Like three days. Well, that's not too bad. Well, around the three-day mark, I don't know. I feel like he's probably not interested, and I want to kind of figure out why.
Something Was Wrong
S23 E7: How Did We Get Here?
Eventually, Markita responded to me and she joined the group. And then I posted my story in the group and then she posted hers. And then other people started to post theirs. Talking about all kinds of different things happening in pregnancy. Failures to assess gestational diabetes and address other abnormalities and concerns and near misses.
Something Was Wrong
S23 E7: How Did We Get Here?
Dating back years, some of these people had births in the 20-teens. under different care, under ownership when it was Amy, Tate and Gina and Caitlin. For example, in one story, her baby was born after mine. We were there at the same time and she was being seen by Jennifer as well. She didn't know that she was unlicensed.
Something Was Wrong
S23 E7: How Did We Get Here?
And during her time as well, Jennifer was also supervising another midwife and saying that this midwife was a midwife in training. While Jennifer herself was the student. Yes, she was training other midwives. This is someone I met through the group. We'll call her Jane. Jane had reported this to me through direct message. She was saying how in her birth class, one of them lost their baby.
Something Was Wrong
S23 E7: How Did We Get Here?
It was really shocking and so sad to see all of these negative experiences. I did not know Amanda at the time, but Markita knew Amanda. They were at Origins together. They were pregnant at the same time, in the same birth class. Their due dates were like days apart. That's how Markita knew Amanda and brought Amanda to us. At first I was skeptical. I was like, I don't know.
Something Was Wrong
S23 E7: How Did We Get Here?
Not because of Amanda, but I was just skeptical of anybody at that point because I knew that Origins was trying to figure out what we were talking about, figure out what we were doing. Origins Birth and Wellness, they had what they called a community group, which was private. You could enter through requesting to enter the group. And you had to be an origins client.
Something Was Wrong
S23 E7: How Did We Get Here?
Everybody that was in the survivors group was in the origins group. At one point in time, various of us left at different times for different reasons. For me, I left pretty soon after I gave birth to my son just because I couldn't bear to see the word origins pop up on my feed every time I opened up Facebook. But there were some that stayed in there forever.
Something Was Wrong
S23 E7: How Did We Get Here?
Because the moms would talk about all kinds of stuff, crunchy solutions or their births. There is also community gatherings and things like that. I mean, Origins created a very large client pool and made sure that they were all interconnected through their Origins community. And they did a lot together. They talked a lot together.
Something Was Wrong
S23 E7: How Did We Get Here?
When I started the survivors group, November of last year, there were several members who were still a part of that origins group and they used their own identity. So every mom was welcome. They just hadn't been very vocal about their experiences because it was pretty widely known amongst the community that if you spoke out about your experience or shed any kind of
Something Was Wrong
S23 E7: How Did We Get Here?
negative feelings towards Origins that you would be contacted by Gina and Caitlin directly. And anybody who had supported us in any kind of way or anyone they even thought supported us, they started booting from the group. Worst case scenarios, they slapped a few cease and desist orders on a couple of people from what I understand.
Something Was Wrong
S23 E7: How Did We Get Here?
This was a response concerning the birth of my son from Gina and Caitlin. It says, Dear Kristen, we are saddened by the recent developments on social media regarding your birth experience with Origins. We would have loved the opportunity to process with you personally to address your concerns.
Something Was Wrong
S23 E7: How Did We Get Here?
Please note Origins has and always will maintain thorough policies and procedure protocols for managing pregnancy, labor, and delivery. Thank you so much for joining us. and followed up with you on January 19th to ensure you were getting the care that you and your baby needed.
Something Was Wrong
S23 E7: How Did We Get Here?
As far as your concerns regarding having an unlicensed provider involved in your care, all our midwifery interns work under the supervision of a licensed NARM-approved preceptor who oversees every patient interaction through your care with us. We are so very sorry you had a traumatic birth experience, but are very grateful that you and your baby got the emergent care that you needed.
Something Was Wrong
S23 E7: How Did We Get Here?
If there's anything we can do to help you on your healing journey, please reach out to us personally. This is our direct email address and contact information. Gina Thompson, CPM LM and Caitlin Wages, CPM LM, co-founders of Origins Birth and Wellness Collective Dallas. That was their response to my review. But they also knew you had started this Facebook group.
Something Was Wrong
S23 E7: How Did We Get Here?
Yes, they knew because I had become public. All they said was that they follow ACOG guidelines in adherence with Texas's bylaws for midwifery and that their students are never without supervision. So without really saying it, saying you're lying, we don't believe you. But this is what was happening. This is what happened to me. I know I'm not crazy.
Something Was Wrong
S23 E7: How Did We Get Here?
I know that I saw Jennifer in that room several times by herself without anyone else present.
Something Was Wrong
S23 E7: How Did We Get Here?
Honestly, it doesn't make me as angry as it used to. It's just really sad because they're outright lying. And I know that. It is really disappointing to see people who were held in such high regard in the community be so callous and to lie so blatantly to someone who trusted them. And paid them for good care.
Something Was Wrong
S23 E7: How Did We Get Here?
I see that as an insincere attempt to give some sort of politically correct statement and to cover their own liabilities. I think they knew what they had done. I really do. And they were just trying to convince me that they didn't do it. Gina and Caitlin were very quick to disregard us on their social media platforms, especially.
Something Was Wrong
S23 E7: How Did We Get Here?
They really denounced us in those groups, saying that we were just angry moms that weren't happy with the experiences that we had had. There's a lot of biblical references used in these groups. Caitlin, she made two or three posts citing our group. One of them, she was like, you are probably aware, but there are a small group of women who are very, very vocal on social media.
Something Was Wrong
S23 E7: How Did We Get Here?
This is upsetting to say the least and disheartening. They can neither confirm or deny our claims because of our privacy, HIPAA and whatnot. But essentially... What she says is, it is our passion to be in service to you, the women who run the world.
Something Was Wrong
S23 E7: How Did We Get Here?
We are coming to you to ask that you remember who we really are, to remember that the words being used against us are not a universal truth, and that a conversation requires two parts. What is being portrayed is only one part of a larger picture. This is a very trying time for Origins team as a whole, and your love, support, and words of encouragement are always appreciated.
Something Was Wrong
S23 E7: How Did We Get Here?
We're just one piece of a larger picture. She is completely brushing underneath the rug death. We're talking about negligent death and saying, ah, this is just something that happens. This is just a part of our story. You know who we really are. She also states in that specific post that conversations are two parts. Well, she didn't want to have conversations with us.
Something Was Wrong
S23 E7: How Did We Get Here?
If anything, she's drawing more attention to it. That's what we thought, too. But we were like, that's fine. Let her. Even though it hurt to see her continually deny and misconstrue our real lived experiences. In other posts, she asks for Origins moms to tell their stories. And the responses from these moms, they came up in the arms of
Something Was Wrong
S23 E7: How Did We Get Here?
It was very disturbing to see what some of these women were saying about us. I mean, one of them even saying that how she had wanted to physically attack us for saying anything negative about origins at all, and that origins were sunshine and rainbows. Other moms commenting under Caitlyn's post saying how they're the sacrificial lamb and that they'll get through this.
Something Was Wrong
S23 E7: How Did We Get Here?
Another mom on there saying that we just need to make our stories go viral and redeem origins. And mind you, at this point, all we had done was share our stories on Facebook platforms, like on mom groups and things like that. As a response to these, how would you call these posts? They're like testaments to action.
Something Was Wrong
S23 E7: How Did We Get Here?
You know, she's like rallying her troops, getting these moms all riled up about what these angry moms are saying about her and her teammates. The amount of like brainwashing or echo chamber that was kind of happening here where Caitlin and Gina had all of this social power over this large group of women and were able just to say something.
Something Was Wrong
S23 E7: How Did We Get Here?
And to those women, it was just true enough for them to completely disregard severe cases. Caitlin had people trying to get into our group. We actually had an ex-employee we didn't know. And she had gotten into our group claiming she had a bad birth with origins and birth trauma and all this stuff. She was sending screenshots to Caitlin and Gina and the nurse practitioner.
Something Was Wrong
S23 E7: How Did We Get Here?
We were able to narrow down who that was. And I kicked her out. She left me like crazy voice messages, blew up my phone for an hour. There were like 14 messages in between each one of my messages. But that is how serious Gina and Caitlin were taking our accusations, so much so that they wanted people inside of our group to tell them what was going on there.
Something Was Wrong
S23 E7: How Did We Get Here?
And that wasn't fair because the group was built for women like us to have a safe place to talk without someone running to Caitlin and Gina and telling them what we said. I mean, we're talking about vulnerable things. You're talking about birthing a human and all of the things that go wrong in that. And there's a lot of very sensitive information in there.
Something Was Wrong
S23 E7: How Did We Get Here?
And so for someone to be in that group, it's a violation of one, the group rules, but two of the privacy of everybody that is there. Can we talk about the Facebook post? that big Facebook post that Jennifer made? Yes. She starts with saying, super vulnerable post.
Something Was Wrong
S23 E7: How Did We Get Here?
So many times I have thought of what I would write when I could share my side, although very lengthy, it's not even close to every detail. I did seek legal counsel prior to finally speaking out. Finding an attorney to actually speak to me was difficult as there has never been a malpractice case. I actually prayed for one so my side could be heard.
Something Was Wrong
S23 E7: How Did We Get Here?
HIPAA has not been violated as these families have publicly opened up for discussion with previews on every platform. And then she goes on to say it's even harder to open up after being called a racist midwife, a perpetrator, a liar, stupid, incompetent, and the list could go on and on. They say as a midwife, it's not if it happens, it's when.
Something Was Wrong
S23 E7: How Did We Get Here?
As a student, I witnessed transfers and even heartbreaking bad outcomes. Bad outcomes do not equal bad midwives. Bad outcomes happen all the time in the hospital, yet oftentimes the hospital is quick to throw midwives under the bus. With that being said, it's not all hospitals or hospital staff are like that. Thankful for the collaboration I do have.
Something Was Wrong
S23 E7: How Did We Get Here?
She goes on to say, I believe it's a lack of relationship that she had with me, Markita and Amanda, because they had such a high volume of clients that they've encountered so much hate. Even when their numbers dropped, there was no way to give clients the time they needed to build a relationship compared to small practices.
Something Was Wrong
S23 E7: How Did We Get Here?
Clients that truly know me and my heart know that I would never put a client or baby in danger. There are risks associated with out-of-hospital birth. There are situations that can turn quickly, and shared decision-making is made when pink flags pop up. She goes on to say, you know, she works hard not to practice in fear and remain calm.
Something Was Wrong
S23 E7: How Did We Get Here?
She says she finished her primary birth numbers in October of 2020. Her apprenticeship was not easy. It was one of the hardest things she ever had to do with an unfaithful spouse and other personal issues. She was never home, gained over 50 pounds, no sleep, and she wasn't thriving. She loved her clients even before she was finishing her numbers.
Something Was Wrong
S23 E7: How Did We Get Here?
She said, The births that didn't count even when I caught, but my heart in that moment was full.
Something Was Wrong
S23 E7: How Did We Get Here?
And here is something I would like to say to that matter. Like a lot of people, they're like, well, I don't feel that way about the consequences that my actions caused. Like I had a heart full of love when I was neglecting you and your baby. Just because you feel good about what you're doing or you have the best intentions in mind doesn't mean that you're faultless.
Something Was Wrong
S23 E7: How Did We Get Here?
Something very interesting that I see happen when you're talking to people who've perpetuated trauma or negligence and things of that nature, they say, oh, I would never hurt anybody. And maybe Jennifer never hurt anybody out of malice, but she did things knowingly that put me and many other people at more risk than we needed to be put in.
Something Was Wrong
S23 E7: How Did We Get Here?
And she made those decisions without recognizing the fullest extent of the consequences of which these are very high stakes situations. Consequences are death and severe injury. So that's where fault lies, regardless of how you feel about it. Okay. So she kind of outs herself too. She said, I was doing full clinic alone in 2021 and was paid a very small amount to do so.
Something Was Wrong
S23 E7: How Did We Get Here?
So she was attending clinic alone in 2021 without her license. She was not a licensed midwife. She apparently had finished all of her births in October of 2020, but by 2021... She still was not a licensed midwife. She still had not passed her examinations or completed her education to become licensed.
Something Was Wrong
S23 E7: How Did We Get Here?
And then she says, September 2021, my preceptor was going to leave the practice by the end of the year. She was put on call with a brand new CNM who ended up quitting in the middle of the night and I was left to cover her shift with no sleep. Then a client complained it was me because she asked for the CNM. who would be my assistant and come towards the pushing stage.
Something Was Wrong
S23 E7: How Did We Get Here?
She delivered clients who were no student on their forms, but I was reassured that I was a graduate student. So here she's stating that she was reassured that she was a graduate student, even though she was not legally licensed by the state. I was surprised she said this part. This is how many DFW midwives practice where I worked. I can name at least five off the top of my head.
Something Was Wrong
S23 E7: How Did We Get Here?
So she can name at least five people who operated illegally as students with origins. all have seen what is happening to me and none have reached out. And then she says, my original preceptor asked me to have the other owners be my preceptors and I agreed. This was after a devastating loss, literally that day. I didn't even get a day off to process. People only cared about covering themselves.
Something Was Wrong
S23 E7: How Did We Get Here?
She cites a loss that happened during that time that she was unlicensed and operating by herself.
Something Was Wrong
S23 E7: How Did We Get Here?
Oh, you're telling me. If you talk to any midwife in the area, it usually takes years with proper education and guidance to become a licensed midwife. So I don't think that she got the proper education that she needed. I don't believe that Gina and Caitlin were doing her any kind of good.
Something Was Wrong
S23 E7: How Did We Get Here?
And somehow that means that we can exclude that information from the clients that you're seeing, that your clients don't want to be assured that you're licensed by the state. And then she says they said it was fine. She signed her charts accordingly. And state guidelines allegedly were followed with a licensed midwife during the actual delivery. And my preceptor within an hour away.
Something Was Wrong
S23 E7: How Did We Get Here?
Preceptors are supposed to be in clinic with you all the time.
Something Was Wrong
S23 E7: How Did We Get Here?
And honestly, like I could not be more grateful that she aired out all the things she did. She damned herself and then damned everyone around her.
Something Was Wrong
S23 E7: How Did We Get Here?
Yes, that is a lot too. I mean, think of it from an outside perspective. You have Jennifer here who probably feels like she has to do her best. She has to be in all the places at once. She has to be at work because if she's not there, we're going to fail all of these women and their babies.
Something Was Wrong
S23 E7: How Did We Get Here?
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Something Was Wrong
S23 E7: How Did We Get Here?
I stumbled across Markita's review, which was written in August that year. So I was writing my review about a month or two later. I don't remember exactly what Markita's review said verbatim, but it essentially talks about how her perfectly healthy son Malik was in the womb for nine months. She went into labor naturally, was at the birth center for many, many, many, many hours.
Something Was Wrong
S23 E7: How Did We Get Here?
I called many attorneys. In the state of Texas, statute of limitations for malpractice is two years. Before my son turned two years old, I reamped the efforts to find an attorney. We came across a family friend who did malpractice insurance, and I told him my story. And he said, Kristen, I'll tell you what no one else is going to tell you.
Something Was Wrong
S23 E7: How Did We Get Here?
They're not going to take it because one, these people don't carry malpractice insurance. Two, it's very, very hard to sue for malpractice in the state of Texas. To point out here that honestly, it doesn't matter. Even if they did have us sign something that says that we can't sue them for malpractice, licensed midwives in the state of Texas are not required to carry malpractice insurance.
Something Was Wrong
S23 E7: How Did We Get Here?
Attorneys are not going to take cases where they're not going to get paid out anything. Me and Markita started meeting whenever we could. I mean, she's a nurse and me working part time and then also caring for my son full time. It could get difficult at times, but we would bring our laptops, all of our medical paperwork and things like that.
Something Was Wrong
S23 E7: How Did We Get Here?
And we'd sit at a table in a coffee shop and just dive into this stuff. The big question that we were trying to figure out, how did we get here? I was trying to understand where legally they had messed up and where they had violated a direct code. Also trying to help Markita with that as well, because what happened to her son was absolutely preventable.
Something Was Wrong
S23 E7: How Did We Get Here?
And I also wanted her to get recourse, knowing that I couldn't get recourse myself through malpractice insurance.
Something Was Wrong
S23 E7: How Did We Get Here?
And her son was in distress. There was thick meconium present. And her midwife, Jennifer Crawford, was barely present and hardly monitoring her during this time. Jennifer was able to get her license through the state of Texas in May of 2022, a few months after my son was born.
Something Was Wrong
S23 E7: How Did We Get Here?
In the prosecutor's email to me alleging that they do not have to report criminal activity, she also discusses how they contract expert witnesses. So it is another licensed midwife who are overseeing these cases.
Something Was Wrong
S23 E7: How Did We Get Here?
I wanted to do everything that I could to prevent this from happening. So I figured I would talk to the powers who could possibly change that. I went to the Texas Medical Association with Markita and Amanda. We told them our stories. And that is what set us on the road to legislation.
Something Was Wrong
S23 E7: How Did We Get Here?
We don't know. When Markita had thick meconium coming out and was using all the towels available to them, Jennifer didn't even come in to ask why they were using all the towels in the room. That's something that sticks out with me a lot, is her... utter disregard and lack of urgency during Markita's labor. It was almost as if nothing could go wrong during labor and delivery.
Something Was Wrong
S23 E7: How Did We Get Here?
Jennifer was actually one of my favorite midwives and I trusted her more than anyone else. I felt like I had grown a relationship with her more than anyone else. Markita did not feel that way. She was very cold and aloof towards Markita. Markita and her best friend, they arrive at the ER at Baylor University Medical Center Jennifer didn't go with Markita. What was Jennifer doing?
Something Was Wrong
S23 E7: How Did We Get Here?
During these hours of time that had passed, was she texting somebody? Was she playing Candy Crush on her phone? What was she doing while this little boy was in Markita's womb and struggling to survive? These are things that stick out to me in hearing Markita's story and then comparing it to mine.
Something Was Wrong
S23 E7: How Did We Get Here?
But something that is quite the same is Jennifer's lack of understanding or recognizing when something is wrong. And something was very wrong in both of our cases. And she failed to realize it, whether that's from her lack of training, lack of regard. I don't know, but it's cost people everything. Markita left her review and they responded. This is what they said.
Something Was Wrong
S23 E7: How Did We Get Here?
We hesitate on responding to this as a mother's grieving heart is something we would never wish upon anyone. We would love the opportunity to go over your birth with another midwife as a mediator if that is ever a possibility. At this point, we cannot continue to remain quiet without being able to defend ourselves. We would like to reply to your statements.
Something Was Wrong
S23 E7: How Did We Get Here?
Giving the birthing mother and partner space to build oxytocin is a common recommendation for labor. If at any time the mother desires to have all support people present, she can. It was a suggestion due to a loud birth space. The suggestion is brought up in prenatal care. The waiting room and the birth suite were separated by a door that was purposely not shut all the way.
Something Was Wrong
S23 E7: How Did We Get Here?
Midwifery team was outside the door on the other side of the suite. All vitals show we were in the suite very often, more when needed. So this particular statement is responding to Markita's claim that Jennifer was hardly ever in the room.
Something Was Wrong
S23 E7: How Did We Get Here?
And I would like to combat this last little tidbit that they leave responding to Markita's review saying, all vitals show we were in the suite very often, more when needed. This is not true.
Something Was Wrong
S23 E7: How Did We Get Here?
If they were in the room as often, instead of sending a student or whoever their assistant midwife was in to tell Markita to stop using towels for the meconium that she was leaking, Jennifer would have known that Markita was leaking thick meconium and that that is a sign of distress. Let's pause there and let's talk about meconium. Meconium is when a baby releases its bowels in the womb.
Something Was Wrong
S23 E7: How Did We Get Here?
Even if the meconium is not thick, that baby could still aspirate meconium and still could have its lungs filled and blocked with meconium. Markito was using all of the towels and origins to mop up the meconium that was being leaked. It's not like it was just a little bit here and there, copious amounts.
Something Was Wrong
S23 E7: How Did We Get Here?
I'm not a medical professional, but from what I understand about meconium and stories I've heard about meconium, this tells me that this was definitely something that needed to be taken more seriously. And for whatever reason, it was not. but we'll continue. Your midwifery care team consisted of a primary LMCPM Jen, a birth assistant, also LMCPM, and student.
Something Was Wrong
S23 E7: How Did We Get Here?
Jen was the only person not of color on your birth team that day. Grace had nothing to do with any treatment or medical decisions. Jen went to the only white person of Marikita's birth team and said, you're the only person that I can talk to. So to move on, their response to Markita's review, electronic medical records cannot be altered and edit audit can clearly be shown.
Something Was Wrong
S23 E7: How Did We Get Here?
Charting was also done by others. Meconium was discussed per protocol. Shared decision making was made by you and your partner opting to stay at the birth center when it was first discovered. I think it's important to note here that Origins used a charting system called Maternity Neighborhood, where they had one login where every midwife could use to log in and make charts and edits as needed.
Something Was Wrong
S23 E7: How Did We Get Here?
Right. They were supposed to sign their names at the bottom of appointment interactions. But sometimes it was your loving midwives or on mine, it was just Jen. It's not foolproof. People could go in and they could lie. And we would like to think that people don't do that. So moving on, I feel confident no rules or regulations were broken.
Something Was Wrong
S23 E7: How Did We Get Here?
When something went out of my scope and birth was not imminent, I immediately initiated a transfer of care by having a student call EMS and every protocol was followed. I opted to not wait for EMS, which was taking too long. My frustration is when the other midwife was ignored when directing your driver to the proper location for a higher level of care or hospital staff was waiting outside for you.
Something Was Wrong
S23 E7: How Did We Get Here?
This delayed critical treatment. So you can tell that it is Jennifer responding to this because at this point she says, I. I immediately initiated da-da-da-da-da-da. According to Markita, the midwife that was there didn't know what to say to the ER physician that came to them.
Something Was Wrong
S23 E7: How Did We Get Here?
So that tells me that you all were not present in the room enough to know what had been happening in the last several hours of Markita being at Origins. And Markita was in labor for a long time. Now, it's also important to note that Origins often contracts their assistant midwives. So these assistant midwives do not actually work for Origins.
Something Was Wrong
S23 E7: How Did We Get Here?
Now, whether or not they're familiar with Baylor, that's up for speculation. We don't know.
Something Was Wrong
S23 E7: How Did We Get Here?
It depends on who you talk to. When Markita left her review, Origins... only a couple days later, created a post either on their public page or within their private page offering Myers cocktails and I believe $100 to anyone who left five-star reviews.
Something Was Wrong
S23 E7: How Did We Get Here?
It's an IV solution. Origins offered her a lot more than just birthing services, and IV therapy was one of them. I actually have the post right now. It's a screenshot. It's in the Origins birth community posted by Caitlin Wages. Exciting post. Good morning, beautiful Origins community. It's time for another review contest.
Something Was Wrong
S23 E7: How Did We Get Here?
This must be completed by August 31st, but we know y'all will be racing to the finish line quicker than that. The first 10 people that have not already done so, if you have, get your partner, mom, doula, etc. To leave us a Google review about your amazing experience at Origins for both locations, receive a free Myers cocktail valued at $1.99.
Something Was Wrong
S23 E7: How Did We Get Here?
It must actually have a written review and not just stars. Everyone else gets $100 Origins bucks to use for anything we offer at Origins. This can be supplements, labs, massage therapy, chiropractic care, et cetera, et cetera. Not only do you help us spread awareness about the beauty of midwifery care, but you can get extra healthy in the process. Go post your reviews and comment here when done.
Something Was Wrong
S23 E7: How Did We Get Here?
And then they cited the links below. I think someone counted like over 20 reviews that had flooded in after that post was made. I did look for other reviews and I did read some. These are very serious stories and ours wasn't the first and it wasn't the last. I began finding these people and messaging them. I looked for them on Yelp because you can message people on Yelp.
Something Was Wrong
S23 E7: How Did We Get Here?
I looked for them on Facebook. And I direct messaged them there. I was joining every DFW, crunchy mom, natural birth group that I could. And I was posting my story in every mom group that I could be a part of in the Dallas, Texas region. And Origins found out. People were sending them screenshots, letting them know that, hey, this woman is starting to speak out about her story.
Something Was Wrong
S23 E7: How Did We Get Here?
I started forming this group called Survivors of Origins Birth and Wellness. So anytime anyone looked up Origins, they would also see our group, which I'd hoped would make people at least stop for a second and look and think, hmm, that's strange. I wonder what this is about. I don't exactly remember who joined first. It was a few women and it was a little quiet at first.
Something Was Wrong
S23 E7: How Did We Get Here?
Nobody was really saying their stories or anything, but then we started getting more and more people joining or trying to join our group. I messaged Markita. I found her through Facebook while I was forming the group. So I first messaged her November 10th of 2023. I just pulled up our messages. I was like, my name is Kristen.
Something Was Wrong
S23 E7: How Did We Get Here?
I was a patient at Origins almost two years ago, and I barely, nearly lost my son in my life due to their lack of competence and knowledge. I saw your review for them. I apologized for what had happened to her and that Jennifer was involved.
Something Was Wrong
S23 E7: How Did We Get Here?
After what had happened to me and I told her, you know, if she just wanted somebody to talk to, I was here or she wanted to join our group that I had made a group for women like her and like me to come together and maybe find some justice. At first, all of this was about if we could just turn one person away, that's potentially like one person that we've saved.
Something Was Wrong
S23 E2: Life Threatening Emergency
This next part of the story, I will be telling from a second person point of view. because I was not cognizant for anything that happens next. My son is delivered via emergency cesarean. I receive a full classical incision to deliver my son because of how he was positioned. He was wedged underneath my diaphragm, so the normal transverse incision that you see as a typical cesarean section
Something Was Wrong
S23 E2: Life Threatening Emergency
was not enough to be able to pull him out, so I received a full classical belly button to pelvis incision to retrieve him. He had his cord wrapped around his neck twice, and he was born stunned and white. He had a low APGAR score. They had to use a CPAP to resuscitate him after he was born.
Something Was Wrong
S23 E2: Life Threatening Emergency
He was taken up to high level NICU to be assessed for brain damage as well as infection because I had a very severe uterine infection. Dr. Fuller is quoted to say that when she opened me up, the room smelled foul. That is how bad my uterine infection was. They are looking at my son for signs of sepsis, brain damage, organ failure, the works.
Something Was Wrong
S23 E2: Life Threatening Emergency
I'd had multiple high BP readings. I had started to swell pretty severely. At this point, I had abnormal lab results at 36 weeks. My hemoglobin was low. My hemocrit was abnormal as well. So all of these things were suggesting that there was something more going on than just a normal pregnancy. When you have preeclampsia, your body is beginning to deteriorate.
Something Was Wrong
S23 E2: Life Threatening Emergency
And it's during this time that my preeclampsia really shows its ugly head. And I go into a hyperintensive crisis. My blood pressure shoots into the 180s over 130s. My team's afraid I'm going to stroke out on the table. I'm given drugs to counteract what is happening to my body, and I'm sewn back up. Then I don't wake up after.
Something Was Wrong
S23 E2: Life Threatening Emergency
The medical team thought I had a clamped-type seizure or a stroke on the table. What none of us knew was that I had this very rare condition called pseudocoline and esterase deficiency. which is a genetic deficiency that is passed down through family that makes a person unable to break down a specific type of paralytic called sexacoline. Sexacoline is typically used, especially in trauma cases.
Something Was Wrong
S23 E2: Life Threatening Emergency
What I had was an extremely, extremely rare thing. Due to this, I woke up inside of my own body still paralyzed. I could not move. I could not open my eyes. It was like one of those movies where someone's in a coma and they're awake in their body and then they can't tell anybody they're there. I come to as like someone flipped on a light switch and all of a sudden I was conscious.
Something Was Wrong
S23 E2: Life Threatening Emergency
I realized that I couldn't breathe on my own. One of the reasons I couldn't breathe on my own is because I'd gone into respiratory failure because of the condition that I had. And I was on a ventilator. And so I was freaking out internally thinking I'm going to die. I cannot breathe.
Something Was Wrong
S23 E2: Life Threatening Emergency
And so I'm trying my best inside of my body to move, to do anything, to let the doctors and people around me know that I was in there and I was alive and I needed help. I could hear the doctors around me. My eyebrows started to kind of wiggle a little bit. And then I heard other people going, she's seizing. She's having a seizure right now.
Something Was Wrong
S23 E2: Life Threatening Emergency
I hear my husband, Thomas, and I hear Dr. Fuller in my ear saying, your honey's here, Kristen. Thomas, your husband, he's here. And I hear Thomas's voice. When Dr. Fuller and Thomas were talking to me, and Thomas will say this, other doctors and medical professionals around him were verbally saying, she is not awake. She's having a seizure and she cannot hear you. But I could. I could hear them.
Something Was Wrong
S23 E2: Life Threatening Emergency
Your kidneys are not functioning normally. Your liver is not functioning normally. In worst case scenario, you have seizure-like episodes. Looking back at my records, I don't understand why I wasn't referred. Even at 36 weeks and four days, I was not referred to an OBGYN. Because my son was breech, they did refer me for what is called an ECV, which is a medical procedure that moves the baby.
Something Was Wrong
S23 E2: Life Threatening Emergency
When my husband arrived and he started talking to me and he grabbed my hand, It was like, finally, someone will be able to see me. Someone will be able to hear me. And my body moved. And it was upon hearing Thomas's voice that I have this visceral reaction. My entire left arm shoots across my body and grabs his hand. I spend the next 36 hours in neurological ICU.
Something Was Wrong
S23 E2: Life Threatening Emergency
About 14 of those hours I spent on a ventilator, unable to breathe on my own. They monitored me for neurological damage because they had assumed that I had still seized. And honestly, to this day, we don't know if I had a seizure or not. And I had severe preeclampsia and had a hyperintensive crisis on the table. But I did not suffer any brain damage or organ damage.
Something Was Wrong
S23 E2: Life Threatening Emergency
At this time, I thought that what I had gone through, that crisis, oh my God, we got to get your baby out right now. I thought that was the mountain. What I didn't realize is that my recovery was the mountain. When I was in ICU, I was in more pain than I had ever been in my life.
Something Was Wrong
S23 E2: Life Threatening Emergency
Thomas authorized for the medical staff to give me nerve blockers and even having nerve blockers and being prescribed Dilaudid, I was still in an incredible amount of pain. Some of the first things I remember while on the ventilator is asking if I could see my son, asking if he was alive. I put my arms across my chest, like you cradle a baby, and I rocked my arms back and forth.
Something Was Wrong
S23 E2: Life Threatening Emergency
And there was one other medical staff in there at the moment, and they were like, oh, are you cold? I shook my head no, and I did my arms again, asking about my baby. At this point, I thought my son had died. I was told my son was in NICU. Thomas told me that so far there wasn't any signs of damage or anything like that. He asked if I wanted to see pictures. I shook my head, no.
Something Was Wrong
S23 E2: Life Threatening Emergency
In my head, I was going to see my baby very soon. I didn't want to see pictures of him. I wanted to hold him. And so after that, I fought to get out of the ICU. I was fighting to regain mobility because it was very hard. I was in an extreme amount of pain.
Something Was Wrong
S23 E2: Life Threatening Emergency
I had ended up getting into an argument with my neurologist who was not convinced that I did not seize and that I was capable of being able to hold my son and have full faculties.
Something Was Wrong
S23 E2: Life Threatening Emergency
My mom and Thomas were in the room and he was only talking to them as if I didn't exist and telling them what he thought had happened to me, regardless of evidence that my genetic condition, pseudocoline and esterase deficiency caused me not to wake up from anesthesia. That was extremely frustrating moment.
Something Was Wrong
S23 E2: Life Threatening Emergency
God bless that lactation consultant because she walked in right as I was laying into this neurologist. Honestly, that was one of the worst days of my life. Ever since I'd gotten out of surgery, I was fighting to see my son. Understandably, because it's been what, almost 48 hours now? And I remember being jealous and I was angry that someone else was taking care of my child.
Something Was Wrong
S23 E2: Life Threatening Emergency
Someone else was changing his diapers. Someone else was holding him. Someone else was feeding him. Someone else was loving on him. And I hadn't even seen him yet. That was very hard for me. I'm very grateful for the nurses and the staff that took care of my son. But this was my internal struggle. I struggled deeply with the situation that I was in. I was so beside myself. I was so defeated.
Something Was Wrong
S23 E2: Life Threatening Emergency
And Thomas was there and he said, do you want to go see Theodore, our son? And I said, no, I don't want to go anywhere. I felt like I didn't deserve to see him even at that point. My husband, he knew I was defeated. I just wanted to literally crawl into a hole and die is how I felt. He saw me deteriorating emotionally and he was like, we need to go see our son.
Something Was Wrong
S23 E2: Life Threatening Emergency
And I shook my head at first and he was like, come on, we'll do it together. He helps me get into a wheelchair. He rolls me down to NICU, which was a couple of hallways away.
Something Was Wrong
S23 E2: Life Threatening Emergency
So I'm scheduled for this, but also at the same time, I'm told to perform like a spinning babies exercise. Spinning babies is like a natural program or philosophy that if you do these exercises, sometimes you can naturally turn your baby over. There's one night where I feel like my son is like jumping up and down in my womb.
Something Was Wrong
S23 E2: Life Threatening Emergency
My son was in high level NICU, the same area where they keep preemie babies. So as I'm being wheeled down the room, I'm passing little babies that are 27 weeks old who are on ventilators and all kinds of monitors and little boxes and things like that.
Something Was Wrong
S23 E2: Life Threatening Emergency
It is one of the most horrific and surreal moments of my life, realizing that this is where we were and how much it changed in the past 48 hours even. And we roll up To my son, who is in a bassinet, he has a feeding tube in and is hooked up to monitors, and there is a nurse there. She's young. She's very nice.
Something Was Wrong
S23 E2: Life Threatening Emergency
She helped me wheel up next to his bassinet, and me and my husband, we held his hands, and he gripped my finger, and I honestly didn't feel much of anything. You hear... These moments of when moms meet their children for the first time and they're filled with love and awe and they're crying. And it's a very emotional experience.
Something Was Wrong
S23 E2: Life Threatening Emergency
And for me, I was completely shut down and completely numb to what was happening around me. And I felt disconnected. I looked at him and it's like I didn't recognize that he was my son. But I went through the motions. I was like, this is what you need to be doing. And when I was in ICU, that's all I wanted.
Something Was Wrong
S23 E2: Life Threatening Emergency
I don't know how to explain my reaction to seeing my son, but the nurse helped me hold him and I breastfed him for the first time. From there, my feelings for him started to resurface. A lot of it was moving through the motions at first. I knew that this is what I was supposed to be doing. This is what I needed to be doing. And I'm so thankful to the staff at Baylor.
Something Was Wrong
S23 E2: Life Threatening Emergency
Shout out to all the nurses and doctors who were taking care of my son and were on my case because I wanted to breastfeed my child, but because of how everything had happened to me and how traumatic my delivery was, it was unlikely that I was going to be able to breastfeed. My nurses were in my room every couple hours helping me pump, delivering my colostrum to my son for him to be fed.
Something Was Wrong
S23 E2: Life Threatening Emergency
The NICU team was using donor milk for my son. They also used a little bit of formula too because they knew I wasn't really producing just yet. So they wanted to make sure there was a brand that did well with him before they sent us home to make sure that he was eating. And five days later, after the birth of my son, I was producing fully. That has everything to do with the staff at Baylor.
Something Was Wrong
S23 E2: Life Threatening Emergency
And I'm very grateful for that because breastfeeding for me, I think was one of the integral parts to me really developing a deep connection with my son and bonding with him, even through that traumatic event and that disconnection at birth. And it was a way to kind of help me feel like I was doing something for him. I was taking care of him.
Something Was Wrong
S23 E2: Life Threatening Emergency
On the third day of February, I talked to Dr. Fuller and she lays out what had happened, that I had severe preeclampsia and essentially I wasn't out of the woods. That moment was really hard for me. I realized that I could still die, that I wasn't safe yet. She was very careful in how she spoke to me about origins, but she was very, very clear.
Something Was Wrong
S23 E2: Life Threatening Emergency
So I call the midwives the next day and I say, hey, I think my son turned over. Can I come in and have my baby looked at? I think it was Elizabeth who felt around for my baby. She proclaimed after doing a manual examination, pressing down on my abdomen, things like that, that my son had turned over, that he was no longer breech and he was in the right position.
Something Was Wrong
S23 E2: Life Threatening Emergency
And she pulled my records out in front of me and she took her pen and she circled places throughout my medical history where she felt like I should have been referred. And one point, for example, was when I had that BP reading of 127 over 90. It was over 20 points over my baseline, which is a sign for hypertension. She said that was the cutoff.
Something Was Wrong
S23 E2: Life Threatening Emergency
She said, you had other things before, but this was a cutoff for you.
Something Was Wrong
S23 E2: Life Threatening Emergency
Elizabeth Fuell and Jennifer Crawford. Elizabeth was the one who took the 127 over 90 BP. And she was the one that verbally suspected that I had preeclampsia and ran a liver panel, but then said it was inconclusive. Jennifer was their and responsible for not referring me when I had that placental abruption.
Something Was Wrong
S23 E2: Life Threatening Emergency
I'd also, I think, had labs done under her that were out of range, such as my glucose testing and uric acid were out of range. Both of these things suggesting that I was developing preeclampsia.
Something Was Wrong
S23 E2: Life Threatening Emergency
Also, Elizabeth threatened to put me on bed rest a couple weeks prior to that, too. There were multiple points where both Jennifer and Elizabeth verbalized that things were not right in my pregnancy, but neither one of them ever said, I want to refer you to an OBGYN. That never happened.
Something Was Wrong
S23 E2: Life Threatening Emergency
I was there for a total of five days, and my son was in NICU for, I believe, four and a half days. He was either released the day of or the night before we were sent home. When we were discharged, I remember seeing Baylor pass in the passenger window and just having this onset feeling of doom. I was terrified to be sent home with this child. We'd almost died.
Something Was Wrong
S23 E2: Life Threatening Emergency
This is kind of something that I'm realizing now. I didn't realize how much danger we were in when all of this happened. And now I was being sent home with this child who was very fragile and had just survived miraculously from something that was horrible for a newborn child to experience. And I was somehow supposed to watch over him and make sure that he was safe.
Something Was Wrong
S23 E2: Life Threatening Emergency
And I didn't feel like I could do that because I felt that I had... failed him already. When we brought him home that was kind of when things really got scary for me personally. First week of his life I felt like a failure as a mother and that I was incapable of making sure he was going to be safe. So in response to that I was extremely hypervigilant. I could not sleep.
Something Was Wrong
S23 E2: Life Threatening Emergency
No ultrasound was done to confirm that my son had flipped over at 36 weeks. And this is important to note because of how my labor and delivery will go. I think everything is well, all is good. At that time, I still felt like I was in good care. I was still feeling confident in my team. My mom was reassured that I was very, very close to Baylor, a hospital that she revered and knew was top notch.
Something Was Wrong
S23 E2: Life Threatening Emergency
I woke often just to make sure he was breathing. I was constantly terrified something bad was going to happen to him. Afraid that he was just going to stop breathing in his sleep. I was terrified of SIDS. I started doing all this research on what causes SIDS. And I remember coming across this study that suggested that possibly implicit with abnormalities can lead to SIDS.
Something Was Wrong
S23 E2: Life Threatening Emergency
I knew that because I had preeclampsia that my placenta had been faulty and was deteriorated and over-aged in the womb. The fear was insurmountable. And then I had to go back to the hospital because I was still running fevers. When I got home that night, I remember being stuck in the recliner with my baby on my chest. And I was taking oral antibiotics, but the fever didn't go down immediately.
Something Was Wrong
S23 E2: Life Threatening Emergency
About a week later, I was running about 104 degree fever and went into the hospital. We called Dr. Fuller and she told us to come in through like the physician's admittance area, but that area was closed at Baylor at the time. So the next thing we did was go into the ER and we said, hey, listen, like I need to be readmitted into the hospital.
Something Was Wrong
S23 E2: Life Threatening Emergency
I was readmitted for an additional four days and it was because of my severe uterine infection. I was given antibiotics for multiple days and they were concerned they would have to open me up again. That was worst case scenario. The antibiotics were not resolving the issue at first.
Something Was Wrong
S23 E2: Life Threatening Emergency
They were afraid that if things had progressed, then I would have needed to have had a hysterectomy at the age of 23. And that didn't happen, but that has happened to people before. Luckily, the antibiotics worked. I didn't have to undergo surgery again to resolve the issue. And I did not develop sepsis or anything of that nature, but it was a very scary prospect. I was no longer having fevers.
Something Was Wrong
S23 E2: Life Threatening Emergency
I was feeling much better. I was sent home, but I was monitored. They did discover what bacteria was in my uterus and it's kind of yucky. E. coli was what was causing my infection. Dr. Fuller was essentially like, you had your membranes open for 15 hours and the area where E. coli kind of lives is very close to the area where your baby comes out.
Something Was Wrong
S23 E2: Life Threatening Emergency
It's not unreasonable to think that some of that bacteria had just traveled and found its way into your uterus. This is my speculation, but after my membranes had broken, I took a bath and I wasn't told that I should not take a bath with broken membranes. And I didn't realize that in doing so, I was exposing my uterus to tons of bacteria.
Something Was Wrong
S23 E2: Life Threatening Emergency
I love Dr. Fuller and I'm extremely grateful for what she did to save my life and my son's life. I mean, hands down, she saved our lives, but it's hard. She was putting together puzzle pieces.
Something Was Wrong
S23 E2: Life Threatening Emergency
She didn't completely understand why I didn't wake up after surgery and was trying to pinpoint when I had gotten preeclampsia and trying to figure out how to resolve my raging uterine infection and also at the same time worrying and wondering if my son was going to make it. It was absolutely a lot. I don't know how much Origins talked to Dr. Fuller or not.
Something Was Wrong
S23 E2: Life Threatening Emergency
Origins did contact me a few times after everything happened That first week postpartum, they did send a postpartum nurse over to assess me and the baby, do a newborn check. But after I started to understand the scope of negligence that had occurred during my care, me and Thomas decided not to talk to them at all. That was it.
Something Was Wrong
S23 E2: Life Threatening Emergency
So at 39 weeks and five days, February 1st of 2022, my water breaks at 1 a.m. contractions ensue probably about an hour later. So I call the on-call line for the midwives and the on-call midwife at the time was Mariah, the CNM. And I tell them I'm going into labor. I monitor my contractions. I'm told to rest up as much as I can, eat, drink, and just wait it out.
Something Was Wrong
S23 E2: Life Threatening Emergency
But they did contact me multiple times, leaving voicemails saying that they would like to offer me a floral bath, that it could be a quite healing experience This is the funny part, because at the time they were asking me if I wanted to take a bath, I was taking showers in an office chair in my apartment. Thomas is just throwing water on me in the shower, you know?
Something Was Wrong
S23 E2: Life Threatening Emergency
I don't want your herbal tea bath, alright? Thanks. Part of me wonders if they wanted to get me in just to try to make it seem like they had done nothing wrong. We just didn't respond, honestly. Maybe we should have let them know how we were about what had happened to us, but we didn't want to deal with them anymore. We just didn't.
Something Was Wrong
S23 E2: Life Threatening Emergency
It was a very tough time in my life. It affected me in my work environment. I worked restaurant industry. I was in management beforehand and I was in a sticky work environment where I felt like I needed to prove myself to be seen in a managerial role to secure my position. After I had my son, I blamed myself for how hard I pushed myself, for how much I worked.
Something Was Wrong
S23 E2: Life Threatening Emergency
And I blamed my employment in some ways for putting that pressure on me. I didn't want to work management after that. I didn't want to work in the restaurant industry anymore after that. It was really, really difficult. I felt kind of anchorless with no purpose, no career, didn't know what I wanted to do anymore.
Something Was Wrong
S23 E2: Life Threatening Emergency
I felt like I couldn't either because my husband was a chef at a restaurant and was working like 70 hours a week. We couldn't both be working full-time management because who would take care of our son? Coming to those realizations was really hard for me. That created a lot of resentment in me towards my husband too. I felt like I was having to give up my career so he could keep his.
Something Was Wrong
S23 E2: Life Threatening Emergency
It really wasn't like that, but that's how it felt at the time for me. I withdrew from my other relationships. There was nobody I could talk to that understood me. what had happened to me or that could relate to what happened to me.
Something Was Wrong
S23 E2: Life Threatening Emergency
I would tell my story to people and you could see their eyes kind of glaze over and what I was telling them go straight over their head and be like, at least you made it. You don't even look like you had a baby, things like that. I learned just to keep it to myself and I raged within myself and I isolated. I ruminated.
Something Was Wrong
S23 E2: Life Threatening Emergency
I lost interest in everything that I liked to do before I lost interest in my career and I lost interest in my friends. My best friend, she was pregnant around the same time as I was and gave birth in May of that same year. And she had a beautiful, wonderful birth. And I remember talking to her while she was in labor and just being so afraid, just hoping that hers would be okay.
Something Was Wrong
S23 E2: Life Threatening Emergency
And it was, it was everything you would want a birth to be. It went completely normally, no issues whatsoever. I was happy for her, but I was upset that I didn't get that. That's hard too, because that's my best friend. I love her more than anything.
Something Was Wrong
S23 E2: Life Threatening Emergency
Oh yeah, that was real fun. I felt guilt. I felt like I couldn't tell her how I really felt. I was happy for her, but I was also so upset and so angry that that's not what we got. How does this happen? What was it about us that put us in that situation? It was difficult for me to hear about other people's birth stories. People will ask you too about your birth. And I think that's off limits.
Something Was Wrong
S23 E2: Life Threatening Emergency
You don't ask people that stuff. I learned that through my experience too. I was like, you do not ask people about their birth stories because you just don't know. It can be so triggering because it's such a deep and intimate thing that happens to you. It's such an emotional, vulnerable thing that happens to you.
Something Was Wrong
S23 E2: Life Threatening Emergency
It's not just like a chit chat, small talk kind of conversation or question to ask somebody. It is a great thing. It's a joyous thing. But I felt so isolated during that time. Postpartum was a very dark time.
Something Was Wrong
S23 E2: Life Threatening Emergency
I allot some of that to the medical trauma, absolutely. It's such a jarring thing to go from thinking that you're going to have this peaceful birth to what actually happened to us. That part was traumatic in having to jump through hoops and the getting better and how sick I was afterwards. I think what was more traumatic for me was the utter betrayal and distrust that I felt
Something Was Wrong
S23 E2: Life Threatening Emergency
I trusted these people with my life, with my son's life. And to find out that I had been lied to, I had been bamboozled. I felt like I'd been conned, honestly. I mean, it makes you question everything. Makes you question every decision that you make. Makes you wonder if you've done all your research, if you have good judgment.
Something Was Wrong
S23 E2: Life Threatening Emergency
You question yourself and then you begin to question everyone around you. Or at least that's how it was for me. I began to distrust the world. So that for me was more traumatic in a lot more ways than the actual event of it all, even though that was really traumatic within itself. I can't walk into a hospital without thinking of what happened to me.
Something Was Wrong
S23 E2: Life Threatening Emergency
For example, my grandmother, she died of dementia this year. And one of the last times I saw her, she was in hospital for malnutrition. She wasn't eating or drinking. And so my grandfather took her into the hospital to be evaluated. Upon walking through that ward, smelling the saline, hearing the beeping of monitors, I began to have a visceral reaction to being in that place.
Something Was Wrong
S23 E2: Life Threatening Emergency
I could feel my heart starting to pound in my chest. I felt like my throat was being constricted and I immediately thought of what it felt like to be on the ventilator. You know, the smell of hospitals is so sharp in your nose and it just brought me back to being there. So there is absolutely a great deal of trauma left from my experiences in the hospital.
Something Was Wrong
S23 E2: Life Threatening Emergency
I had a lot of trauma stored in my body, especially in my abdomen area. I felt like I couldn't exercise. I felt like I couldn't do things like that. Like we went skiing the year after my son was born. I nearly started crying because I didn't want to use my core to help me do the things. And I had weakened muscles between my legs. the tendons where your groin area is.
Something Was Wrong
S23 E2: Life Threatening Emergency
If I put too much pressure in one way or another, those tendons would lock up or they would hurt. So that was really affecting my ability to ski. And I had a ski instructor and she could tell that I was getting really frustrated. And she was like, hey, it's okay. It just takes some people longer than others.
Something Was Wrong
S23 E2: Life Threatening Emergency
And I remember getting really hot and having this visceral bodily reaction because my body was being triggered by what had happened to me medically. And I told her, I had this really traumatic thing happen to me a year ago. I'm lucky to be alive and that is affecting me today. It was good just to get that off my chest. And she was an older woman. She's like, I understand. You take your time.
Something Was Wrong
S23 E2: Life Threatening Emergency
We're going to do as much as you want to or don't want to do. And she was really supportive of me, but it helped me to just say what was going on in my head. But emotionally, I was still pretty hung up. For the most part, I had tried to forget what had happened, but it would sneak up on me. It was a dark, ugly monster that would lock in a closet.
Something Was Wrong
S23 E2: Life Threatening Emergency
And when I was least expecting it, when I was alone and my thoughts were quiet, it would tap on my shoulder and say, hey, remember me? It was like PTSD. I would have intrusive thoughts. I would have flashbacks about what had happened to me huge feelings of anger and betrayal about what had happened, even 18 months postpartum.
Something Was Wrong
S23 E2: Life Threatening Emergency
It took me a really long time to get emotionally well, which was the hardest part for me, to get in a place where I feel like myself again. And it wasn't like a me from before. It was whoever this new me is, the person that had been turned inside out and had all of her outsides on display and
Something Was Wrong
S23 E2: Life Threatening Emergency
This person who had survived this thing, who was a mother, who was also trying to deal with trauma at the same time and trying to repair her relationship with not only herself, but with her husband. When I finally started to feel like me again, though, it was like a big sigh of relief. It was like someone lifted these huge weights off of my shoulders. And it took a little bit at a time.
Something Was Wrong
S23 E2: Life Threatening Emergency
And while we were in the thick of recovering, within the first 18 months of my son's life, there were times where we were hitting rock bottom in our marriage. I was filled with postpartum rage. I was just enraged at everything.
Something Was Wrong
S23 E2: Life Threatening Emergency
The contractions, they start and they kind of peak and then they dissipate. They come in these like waves where they get the most intense at the top and then they kind of go back out. That's how mine felt anyway. I have a contraction monitor and I am recording my contractions. Probably about four hours in to my labor, I start feeling like my contractions are consistent with active labor.
Something Was Wrong
S23 E2: Life Threatening Emergency
We were two individuals who had gone through this extremely traumatic and life-altering event, just trying to recuperate, trying to heal, trying to make sense of what happened to us in our own ways. We were not always the best people to each other. It took a lot of work. At the end of the day, we really had to choose each other over what had happened to us. We went through a lot of counseling.
Something Was Wrong
S23 E2: Life Threatening Emergency
That's a good question. It was when we moved into our new house. So probably a little over two years ago. It's really helped us get to a place where we can talk about what happened to us. And we could talk about it with more ease than we were able to before. We communicate better now. We understand each other better now. And in ways we're closer than we ever were before.
Something Was Wrong
S23 E2: Life Threatening Emergency
There's more emotional intimacy there. I think a lot of because of going through what we went through, not just surviving, but learning to live after it. This has been really important key moments for us, choosing to love each other, even when it was hard. I appreciate all the work that he has done. Personally, I know I was not the best partner, not even a good friend during that time in my life.
Something Was Wrong
S23 E2: Life Threatening Emergency
When you have a child that's born with a low APGAR score or is deprived of oxygen during delivery, you're worried about a number of things, right? My son was developmentally normal, developed words and no speech delays or anything like that. We're very lucky to be where we were at that point in time. It was September or October 2023.
Something Was Wrong
S23 E2: Life Threatening Emergency
The angry monster came out of the closet while I was driving home from work and was like, hey, you remember this really awful thing that happened to you? I ruminated over that on the way home. And I got home at like midnight. And I said, I'm going to write a review. I sit down on my couch. I'm typing out this review.
Something Was Wrong
S23 E2: Life Threatening Emergency
They're one minute long and three minutes apart consistently on the dot back to back to back. That's when I call them. I say, hey, I think I'm in active labor. The reason why active labor is so important is because origins will not take you in until you are at least three to four centimeters dilated and in active labor. This is the second time I'm speaking to Mariah.
Something Was Wrong
S23 E2: Life Threatening Emergency
And essentially, I tell them my story, all the places where I should have been sent away, all the places where they dropped the ball. And I told them how Jennifer was unlicensed. At the end, I essentially said that the owners do not care. They are insincere and they deny what happened to me, even though they were not present. They continue to lie about what had happened and deny my claims.
Something Was Wrong
S23 E2: Life Threatening Emergency
This place is dangerous. And if you value your life or the life of your child, go somewhere else because this place is not safe. That was essentially my review. It's also important to note that at this point in time, this is the first time I am writing my story. This is the very first time that my story is on written record for other people, the public to view.
Something Was Wrong
S23 E2: Life Threatening Emergency
And that is what kept me from writing a review for so long. I could not even think about the idea of someone else reading my review or reading my story and then nitpicking it apart. I didn't want salt to be rubbed in that open wound, but something came over me that night. I just said, I'm gonna do it. And so I wrote it. And then after I wrote it, I started reading reviews.
Something Was Wrong
S23 E2: Life Threatening Emergency
Me and my husband, we'd stayed up all night because we'd realized that we were not the fluke.
Something Was Wrong
S23 E2: Life Threatening Emergency
I started forming this group called Survivors of Origins Birth and Wellness. So anytime anyone looked up origins, they would also see our group, which I'd hoped would make people at least stop for a second and look and think, hmm, that's strange. I wonder what this is about.
Something Was Wrong
S23 E2: Life Threatening Emergency
Mariah says, you're a first time mom and you don't sound like you're in active labor. So I was told to take a cup of Benadryl and sleep it off. 8 a.m. rolls around and Jennifer Crawford is the midwife on call now. She calls me and said, let's get this baby out.
Something Was Wrong
S23 E2: Life Threatening Emergency
She said, I want you to perform a mile circuit, which is a series of different exercises that they want you to do, different positionings to kind of get things moving around.
Something Was Wrong
S23 E2: Life Threatening Emergency
It never even dawned on me that Jennifer was a student midwife. At this point, I do what Jennifer tells me to do. I'm at home. My doula comes. I love my doula. She's fantastic. She's hanging out with me. At about 10 a.m., I noticed my contractions stall. They were no longer peaking. I was getting these crampy feelings and then they started to become inconsistent.
Something Was Wrong
S23 E2: Life Threatening Emergency
They went from three minutes apart, one minute long to once every five minutes, once every 10 minutes, once every three minutes. It was just very sporadic. We wait a little longer. I noticed that my son isn't moving as much. I tell my doula this and she said, I think you should give your midwives a call. Somewhere between 11 and noon, I give Jennifer a call.
Something Was Wrong
S23 E2: Life Threatening Emergency
I tell her, hey, my contractions have been stalled for a couple hours, and I'm noticing that my son isn't moving as much as he was. And she goes, huh, okay. Well, why don't you come in around 4 p.m., four hours after I called her? We say, okay. I look back at this now and think, wow, how crazy that I didn't see that as a red flag and that I waited that long really to go in.
Something Was Wrong
S23 E2: Life Threatening Emergency
I wish at the time that I'd just gone to the hospital and said, you know what, my labor's not going normally anymore. And this I think would go to show like how trusting I was in my providers. And how long has it been since your water broke? Water broke at 1 a.m. So 4 p.m. We're looking at 15 hours.
Something Was Wrong
S23 E2: Life Threatening Emergency
Me, my doula and my husband are in the room with Jennifer. And she grabs a limited ultrasound. And then she was having a lot of trouble with the device. So she brought Elizabeth in. And Elizabeth uses this limited ultrasound to confirm that my son is still transverse breech. So he's laying across side to side in my belly instead of up and down. So he said, you know what?
Something Was Wrong
S23 E2: Life Threatening Emergency
We're sorry, but you're going to have to have a C-section because he's transverse and he's not compatible with vaginal delivery. I was pretty optimistic. I was disappointed a little bit, but I was like, I got to labor for this long. Things just didn't work out this way. And there was no tears or anything like that.
Something Was Wrong
S23 E2: Life Threatening Emergency
I was just like, we're going to have to go get a C-section and we're going to meet our son. I was nervous about the C-section part because anybody's nervous to go under the knife. But I asked her, I said, do I need a cervical exam? And Jennifer looks at me and she goes, no, you don't need a cervical exam. You're getting a C-section. So it doesn't matter. So she doesn't do a cervical check.
Something Was Wrong
S23 E2: Life Threatening Emergency
They refer me over to OBGYN Dr. Deborah Fuller. She works in her own private practice right across the street from Baylor. So we drive over there. We are dealing with the front desk. I had left all of my effects at home, all of my personal stuff. I left my phone. I left my wallet, my purse.
Something Was Wrong
S23 E2: Life Threatening Emergency
So we're in the office at Dr. Fuller's practice, the front desk, and my husband are chatting about insurance. They're wanting my ID and everything. Also, at the same time, my mom is getting off work and she was going to take our dog. So my husband, he's like, okay, well, let me run home real quick. And we live in downtown Dallas.
Something Was Wrong
S23 E2: Life Threatening Emergency
So our home wasn't more than 10 minutes away from Dr. Fuller's office. He runs home real quick, gives my mom the dog. During this time, I'm taken back to an exam room, me and my doula to see Dr. Fuller. I'm told to get undressed from the waist down, which I do. I hop on this table. I'm in stirrups, all this stuff. And Dr. Fuller, she does an ultrasound on me and she notices he's transverse.
Something Was Wrong
S23 E2: Life Threatening Emergency
She doesn't say anything. And she's like, okay, I'm going to do a cervical check now. And I said, do I need a cervical check? And she kind of looks at me bizarre. And she goes, yes, of course you need a cervical check. I need to know how dilated you are. I need to know where the baby's position, things like that. Like there's just things that I need to know that a cervical check will tell me.
Something Was Wrong
S23 E2: Life Threatening Emergency
And I said, okay, that's fine. She does a cervical check and this is when all hell breaks loose. Upon her exam, she finds that my son has a prolapse cord and prolapse extremities. Not only his umbilical cord was in my vaginal canal, so was his hand and his foot. This is a life-threatening emergency.
Something Was Wrong
S23 E2: Life Threatening Emergency
If we don't deliver this baby in the next few minutes, you are risking serious, serious harm and death. She runs out of the room and yells to her nurse to get me into her car. She's on the phone with Baylor, telling them everything that they need to know about me, that we're coming right now. I start to hyperventilate at this point. I remember the nurse getting in my face and going,
Something Was Wrong
S23 E2: Life Threatening Emergency
You're going to be okay. This is going to be fine. I need you to breathe. We're going to take care of you. She sits me on this office chair and they roll me down to Dr. Fuller's car. I'm put in the backseat of her vehicle and put on my side. And Dr. Fuller speeds out of that parking lot like nobody's business. And as Dr. Fuller is pulling out of the parking lot, my husband's pulling up.
Something Was Wrong
S23 E2: Life Threatening Emergency
And my doula's on the phone with my husband at this point, telling him what's wrong. He sees Dr. Fuller speeding away from the office, and he follows in pursuit. And they get up to Baylor.
Something Was Wrong
S23 E2: Life Threatening Emergency
As we get to Baylor, there is a stretcher waiting in the drive with two nurses and they open the door and they pull me out and they put me on the stretcher and we are running through the hospital. I'm being asked a million questions. Do you have any allergies? Any medical conditions we should be aware of? When's your date of birth?
Something Was Wrong
S23 E2: Life Threatening Emergency
We barge into an OR room that is filled with about a dozen people who are shouting. Things are moving around. People are talking to each other. You hear like ripping of plastic and things just being prepped and put on an OR table. There are many things happening to me at the same time. My stomach is being prepped for surgery. I have a catheter inserted.
Something Was Wrong
S23 E2: Life Threatening Emergency
At the same time, my anesthesiologist is putting an IV into my arm. There is a NICU doctor. on site. And I remember him coming into my field of vision and saying, ma'am, my name is Dr. Thomas, and I will be the head of your son's care when he is born. It's at this moment that I look at my nurses and I ask, am I going to be put under for this?
Something Was Wrong
S23 E2: Life Threatening Emergency
Because I don't want to be awake for what's about to happen next. And they say, yes, you're going to be put under. And it's right then that I have a
Something Was Wrong
S23 E1: Built to Birth
And I don't mean like the typical run-of-the-mill anxiety of, are they safe? The kind of anxiety I'm talking about is gripping. It is a direct fear of death. It is all-encompassing. It is an entire visceral feeling of my child is going to die at any moment. And that is something that is not normal. It is something that was done to me, how my body responds because of what happened to us.
Something Was Wrong
S23 E1: Built to Birth
And what happened to us was preventable. Several points within my care, my providers could have said, oh, hey, something is not right here. We want to make sure you're getting the best care that you can receive. And we want to refer you to an OBGYN to get checked out for more testing because the signs that you're presenting to us is outside of our scope.
Something Was Wrong
S23 E1: Built to Birth
There would have been nothing wrong with them saying that to me, and I would have had so much love and respect for them if that is what they chose to do, but they didn't for whatever reasons. Maybe they thought they could handle it. We could speculate all day long about the why, but reality is, they didn't. No matter what the reason, they didn't. Choices like that cost people everything.
Something Was Wrong
S23 E1: Built to Birth
Licensed or direct entry midwives, they are regulated by completely different systems than certified nurse midwives or even certified midwives, which certified midwives don't practice in the state of Texas. But either of those groups are regulated by vastly different foundations with vastly different ethical and clinical standards.
Something Was Wrong
S23 E1: Built to Birth
Direct entry midwives are nationally overseen by the North American Registry of Midwives, which is a institute or foundation for certified professional midwives. They suggest that direct entry midwives should decide on their own standards for care. So what that means to me is that let's say I'm a midwife and I won't take on anyone who has preeclampsia because preeclampsia is high risk.
Something Was Wrong
S23 E1: Built to Birth
So if I suspect that my client has preeclampsia, I will refer them out to an OBGYN. That doesn't stop midwife Jane over here from taking on that client. So it's left up to the individual to decide what is safe, what is not, what is acceptable, and what is not.
Something Was Wrong
S23 E1: Built to Birth
When you look at these medical systems that certified nurse midwives and certified midwives are involved in, their foundational institute is going to be the American College of Nurse Midwives. They all have to abide by the same exact standards. They specialize in low-risk birth and pregnancy and delivery as well.
Something Was Wrong
S23 E1: Built to Birth
So not only is there a huge variance in what standards are for care and what is acceptable for midwifery care, there's a huge difference in educational standards. Certified nurse midwives having to get a master's degree in nurse midwifery certified midwives going through a three-year collegiate level program to become a midwife.
Something Was Wrong
S23 E1: Built to Birth
direct entry midwives or licensed midwives or certified professional midwives. These are all within the same kind of group. And there's a lot more variation there. In the state of Texas, there are many ways to become a midwife. You can go through what is called the PEP portfolio ran by NARM, which is an apprenticeship model where a candidate for midwifery goes through a self-study method. And
Something Was Wrong
S23 E1: Built to Birth
is in an internship or an apprenticeship with a preceptor for 1,350 out-of-hospital clinical hours. So she does not have to take any kind of accredited education. She self-studies, and she does these clinical hours with a preceptor, and then she passes the CPM examination, which I don't know what that entails. I've never seen the exam before.
Something Was Wrong
S23 E1: Built to Birth
So that is one way to become a licensed midwife in the state of Texas. And if you become a CPM through NARM, then your next step is to take the Texas licensure exam. And then they assign you licensure based on whether or not you pass that exam. Another way to become a midwife is through going through a MEAC accreditation course. It is basically direct entry midwives accredited colleges.
Something Was Wrong
S23 E1: Built to Birth
And it accredits certain programs for midwifery. They're all held to the same standard. And from what I understand, to become accredited by Meek is actually a pretty difficult task. Some of these programs within Meek are 18 months long certification programs, and some of them are three to four year collegiate level degrees. And there are some that are in between.
Something Was Wrong
S23 E1: Built to Birth
And then the last route is through a Texas approved course, which the minimum requirement to become a Texas approved course for midwifery here, is 250 curriculum hours. And then once upon completion of the programs and your preceptorship, you take that same state exam, you pass it, you become licensed. So there are very many different ways to become a licensed direct entry midwife.
Something Was Wrong
S23 E1: Built to Birth
For me, it screams red flags within the profession. It is very scary because you don't know what you're So how are you as a consumer supposed to differentiate and then understand the ramifications of those differences? Understand how it correlates to your care, how it affects that professional's ability to be able to clinically judge what's happening to you during your pregnancy.
Something Was Wrong
S23 E1: Built to Birth
I was looking for the best birth center in Dallas. I wanted something that was close enough to a hospital that if I needed or if my son needed medical attention, we could get it pretty easily. That is where I stumbled across Origins Birth & Wellness.
Something Was Wrong
S23 E1: Built to Birth
I had read many, many stellar five-star reviews, not only on their Google page, but also by magazines, and I believe DFW Child, all recommending Origins being one of the best birth centers in the Dallas area. They are located on Swiss Avenue and kind of like a historical district of Dallas, literally a stone throw away from one of the best hospitals in Texas, Baylor University Medical Center.
Something Was Wrong
S23 E1: Built to Birth
You could actually run to Baylor from Origins Birth and Wellness if you wanted to. For context, my husband and I, we both work in the restaurant industry. At the time, he was a chef at a restaurant in Dallas. If you're familiar with service industry, you'll know that we work a lot of hours and odd hours at that. So he worked a lot of the time. He was like, you know, you pick out some places.
Something Was Wrong
S23 E1: Built to Birth
We'll talk about it. This is your body. This is your pregnancy. And I'm here to support you through that. So, you know, we can make these decisions together. But ultimately, I want you to choose where you're comfortable.
Something Was Wrong
S23 E1: Built to Birth
So I went in to do a tour at the Dallas location. They did have open houses every Thursday. The facility is beautiful. Imagine Victorian style house across the street being a beautiful park with a gazebo. It had a first and a second story. The rooms were absolutely beautiful. Huge porcelain tubs and large beds everywhere. I mean, all the amenities you can imagine.
Something Was Wrong
S23 E1: Built to Birth
So it was very comfortable, very home-like setting, very different than what you typically see in a hospital room, right? Like no beeping, no weird things sticking out of walls, no monitors. It almost felt like you were at home in your own room in a lot of ways. And that's how it was meant to be set up. It was meant to be as comfortable as possible in people.
Something Was Wrong
S23 E1: Built to Birth
to help pregnant women feel like they were in their element at the birth center. If I recall correctly, I met Amy Tate, Jennifer Crawford, and I believe there was one or two other midwives there. None of them were Gina Thompson and Caitlin Wages as the owners of Origins Birth & Wellness. I spoke to those midwives and I felt really good about what I was being sold.
Something Was Wrong
S23 E1: Built to Birth
I was told that they only hire experienced professionals and they specialize in preventative care, basically. So they keep an eye out on anything that would go wrong before it does go wrong. If anything is abnormal, we would be sent to an OBGYN, which they had backup OBGYNs and they had a great relationship with Baylor.
Something Was Wrong
S23 E1: Built to Birth
I was told that if something was wrong with a baby during delivery or birth, that, you know, the NICU team would come literally running down from the hospital if the ambulance couldn't get here fast enough, which was very reassuring to me. My mother had worked for Baylor for 20 years. So I knew that Baylor was a great hospital.
Something Was Wrong
S23 E1: Built to Birth
And if I wasn't going to be at that birth center, I was going to birth at Baylor. It's not only all over Origins Birth and Wellness webpage and interviews with the owners, but I was told that they had the same standard of care as any hospital and any OBGYN. They did all the same testing standards and whatnot. Not only that, but they followed ACOG protocols and clinical guidelines.
Something Was Wrong
S23 E1: Built to Birth
So this, for me, stuck out. I didn't want an overly medicalized birth. But for me, this was very validating. I have a lot of respect for the medical field, doctors and medical staff. So to me, for them to hold themselves to this same very stringent standard of care to me was a green flag. It was like, okay, great. I'm safe with these people. They're professionals.
Something Was Wrong
S23 E1: Built to Birth
If anything was to go wrong, they would recognize it as it was happening or before it was happening.
Something Was Wrong
S23 E1: Built to Birth
Once you decide whether or not you're going to use Origins for your care, they went through a self-pay or insurance method at the time. I had Blue Cross Blue Shield of Illinois through my husband's work. So at the time, they were not taking out-of-state insurance, but I was told that there could be an in-network exception and now we just need to apply for it.
Something Was Wrong
S23 E1: Built to Birth
Most direct entry midwives do not take insurance, but Origins did. Origins billed globally under their APRN, who was their nurse practitioner. They would also have a CNM hired. So you can bill underneath an APRN. You can bill underneath a CNM. When I was billed, I was billed under their nurse practitioner.
Something Was Wrong
S23 E1: Built to Birth
She was listed as my provider, even though in the state of Texas, nurse practitioners don't perform prenatal care. It was another loophole that they got around to get more clientele. to get more money, in my opinion. This was after I'd started to begin care. And before I went to my first prenatal visit, I was given a series of paperwork and contracts to sign.
Something Was Wrong
S23 E1: Built to Birth
One of them was kind of like their orientation packet, what Origins was about, what kind of services they delivered, what they believed in, things of that nature. And then I was given an informed consent document that listed all of the midwives that would be attending me in my care.
Something Was Wrong
S23 E1: Built to Birth
When their neonatal resuscitation certificate was, how many births they had attended, and whether or not they were licensed under the regulatory body for midwives in the state of Texas, TDLR. I signed it acknowledging that the midwives that would be taking care of me were on there. and that they all had the certifications they needed to be licensed by the state of Texas.
Something Was Wrong
S23 E1: Built to Birth
Then I was given another consent document. It was basically a liability waiver. I would also like to state that while I was overviewing this paperwork, I was sitting in their waiting room. The front desk gave me this packet and said, just go through and sign. None of these documents were explained to me. There was no one there really to answer any questions for me if I had any.
Something Was Wrong
S23 E1: Built to Birth
So I was looking at this consent document and this was the first icky feeling I had about this place was looking at this liability document. It basically stated that me, my husband, and nobody who is related to us, no third party would sue Origins even in the event of neglect and death. I'm sure that there are going to be people who hear that and go, why would you ever sign anything like that?
Something Was Wrong
S23 E1: Built to Birth
At the time, I had been told and was convinced that they abided by these high standards. Well, they were in a hospital, so I guess this is just to cover themselves. This is just a formality. But me and my husband looked at that document and that was our first real, I'm not so sure about this. But we came to the decision. We signed it. We're like, well, it's just a sue.
Something Was Wrong
S23 E1: Built to Birth
And I'm sure that nothing like this would happen to us anyway. And so we signed the document and continued in care. My OBGYN, she printed out all of my paperwork that Origin sent over to her. And she said, Kristen, never sign anything like this ever again. She said, no physician would ever ask you to sign anything like this ever. This is unethical at best.
Something Was Wrong
S23 E1: Built to Birth
Looking back, what I know now versus what we knew then, and I say this in the kindest way to like the people we were then, we were very naive to a lot of that stuff. We assumed that these people were professionals that were being regulated by the state of Texas. They claimed authority. to be upheld to these really high standards of care.
Something Was Wrong
S23 E1: Built to Birth
So to us, certified midwife or licensed midwife was the equivalent of a nurse or a doctor. We trusted them because of the titles that they carried. I wish, looking back then, that we had consulted with an attorney to give this document a once-over. This put a bad taste in our mouths. And that's something that we thought about periodically throughout our care there.
Something Was Wrong
S23 E1: Built to Birth
But when things like in my first trimester were going well and everything, we thought it would be fine. And all these people who had all these great experiences were like, well, surely this is just a formality.
Something Was Wrong
S23 E1: Built to Birth
Origins Birth and Wellness used several different midwives in one practice. The idea was you would see all of these midwives. So by the time your birth and labor and delivery came along, you'd be familiar with whoever walked in the door. So I saw very many different people. At first, I saw a woman named Rachel. I believe I saw someone else named Danielle. I saw Jennifer Crawford several times.
Something Was Wrong
S23 E1: Built to Birth
I even believe I saw Amy Tate once. I was always seen by one person at a time. This is also a really important context for kind of the era that I entered into. Origins was originally owned by three people, Amy Tate, Caitlin Wages, and Gina Thompson. From what I understand, Amy Tate owned 49% of the business. Gina and Caitlin owned the rest, the majority half.
Something Was Wrong
S23 E1: Built to Birth
During my first and second trimester, there was some sort of split in ownership. Amy Tate left to have her own practice, and Gina and Caitlin kept Origins. I got an email about it. Everything seemed fine and dandy. Gina and Caitlin wished Amy the best. During this split, most of the midwives at Origins left. Thank you. Thank you. Thank you.
Something Was Wrong
S23 E1: Built to Birth
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you very much. Thank you. Thank you.
Something Was Wrong
S23 E1: Built to Birth
,,,,,,, ,,,,,,, But that is the only abnormal lab result that is on my glucose test. About 30, 32 weeks, I experienced a big bleed. I was at work. I was managing. At the end of shift, I was outside with a coworker and he was locking up the back door for me. While we were doing that, I felt this gush. I looked down my leg and my legs are streaming blood.
Something Was Wrong
S23 E1: Built to Birth
I just very calmly look at my coworker and I say, you need to call an ambulance. And he's still chitter-chattering. And I say again, you need to call an ambulance. And he looks at me and looks at my leg and kind of freaks out and runs inside. I sit down. And at this point, I am doing my very best to keep calm. I was born through a full placental abruption.
Something Was Wrong
S23 E1: Built to Birth
And I knew from my own story, from my mother birthing me, that during a placental abruption, it is extremely important to remain calm. So your heart doesn't pump faster, so you don't lose more blood. I assume, because of how much blood was pouring out of me, that I was having a placental abruption.
Something Was Wrong
S23 E1: Built to Birth
I text my husband, Thomas, and I'm sitting in this chair. One of my other managers comes out and she's sitting with me and we're waiting for this ambulance to come and get me. My husband and I were only driving one car at the time. And so I had the vehicle. He was skateboarding to work. We lived in downtown. Where we worked wasn't very far.
Something Was Wrong
S23 E1: Built to Birth
My husband ran from his job, which was probably about a mile away. ran from his job down to my restaurant and got there just as the ambulance was pulling up. So ambulance takes me to Baylor L&D and I'm kept overnight for observation. I bleed through most of the night. When I speak with the doctors, I asked them, what is worst case scenario here?
Something Was Wrong
S23 E1: Built to Birth
They say worst case scenario is that we're performing an emergency C-section tonight. And they said, we're going to continue to monitor, see if things get worse. And we hope that that's not the case. It was a very scary moment for us.
Something Was Wrong
S23 E1: Built to Birth
Through ultrasound, they were not able to tell. The doctors that were on my case, they came in and they said, we do think that this was a placental abruption, but a very small one, like the size of a nickel or something that wasn't detectable via ultrasound. And they said, if you have experienced any cramping, any more bleeding, you need to come back straight away.
Something Was Wrong
S23 E1: Built to Birth
And I was released the next morning after the bleeding had dissipated and I stayed in bed for the rest of the day. The midwives knew what was going on. We had called them when we had gone to the hospital. I go back to work a few days later and I start experiencing cramping. And it feels like period cramping. No bleeding, but just cramping. I called the midwife line and Jennifer answers.
Something Was Wrong
S23 E1: Built to Birth
And I tell her what's going on. She doesn't have me go to the hospital. She does have me come into office though. So I leave work a little early and go to an appointment to see Jennifer. I tell her what happened at the hospital. She said that she thought that what happened to me was a subchorionic hemorrhage.
Something Was Wrong
S23 E1: Built to Birth
Subchorionic hemorrhage is a pocket of blood that is essentially trapped between the uterus and the, I believe it's the like the amniotic sac. And sometimes when that's trapped there, the amount of blood is released and it produces a bleed. She was going to treat my cramping with a supplement called eutrophin. She essentially said that it would calm an agitated uterus.
Something Was Wrong
S23 E1: Built to Birth
This is Jennifer, the student. Is there a midwife overseeing this visit? No, it was just me and Jennifer in the room. I felt like I had a good relationship with Jennifer. She was the one I saw the most. So when Jennifer said that, this was just a subchorionic hemorrhage, nothing to worry about. I believed her. After I have this abruption, things really start to snowball downhill for me.
Something Was Wrong
S23 E1: Built to Birth
My mom had bought me a BP monitor because at this point I was gaining weight. I was beginning to puff up and swell. And my mother was worried. She was like, you know, I'm really worried about your blood pressure, Kristen. I'm worried about you having preeclampsia. Here is a BP monitor. It was cuff and everything. You can buy it at CVS. Just keep an eye on your blood pressure for me.
Something Was Wrong
S23 E1: Built to Birth
And so I did that. I had a reading at home that was 138 over 90. I was pretty stressed at that time because I was supposed to have this big meeting with the owner of the restaurant I was working for. I figured that it wasn't a big deal, but I went to another visit with Elizabeth. Elizabeth is one of the midwives who came on in my third trimester after there was a split in ownership.
Something Was Wrong
S23 E1: Built to Birth
So Jennifer went from running clinic by herself to having Elizabeth Fuell and a CNM working with her. So there were three midwives at the time. Elizabeth said, if you can't work less than what you're working, get off your feet as much as you are, then you are going to have to go on bedrest. So from what we understand, direct entry midwives specialize in low risk, normal pregnancy.
Something Was Wrong
S23 E1: Built to Birth
I've gotten to a point thus far where I have out of range labs. I have several instances of high blood pressure and symptoms of spots in my vision. I have this big bleed. I continue to cramp and have problems after this bleed. I'm not sent to an OBGYN and I'm threatened to be put on bedrest, but you're still continuing to keep me in care.
Something Was Wrong
S23 E1: Built to Birth
If I was having a normal pregnancy, there was no reason why I would need to be put on bedrest. Did they know about the edema too, the swelling? They never said anything, but looking at my flow chart, from 30 weeks to 32 weeks, I'm 136 pounds. From 32.3 to 34.3, I'm 143 pounds. I almost gained 10 pounds in two weeks. And then at 36.4 weeks, I go from 144 pounds and then to 38 weeks, 151 pounds.
Something Was Wrong
S23 E1: Built to Birth
So in less than two weeks, I almost gain another 10 pounds. There is severe fluid retention there. It was never addressed. My weight was never a concern. I looked into this because I was like, how did I have preeclampsia and not know? That weight gain at the end there was a big sign for preeclampsia.
Something Was Wrong
S23 E1: Built to Birth
I'm being threatened to be put on bed rest because of this bleeding episode that I have that the doctors at Baylor considered a placental abruption. My pregnancy is not normal at this point. Things continue to get worse.
Something Was Wrong
S23 E1: Built to Birth
At that time, I was still feeling confident in my team. I was always told that this was a variation of normal and that I had no reason to worry. I was never referred to an OBGYN to be tested for preeclampsia ever or any kind of further testing for my glucose readings. I was invested in my team. I believe that they cared about me. I liked Jennifer. I cared about Jennifer.
Something Was Wrong
S23 E1: Built to Birth
I thought she was looking out for me. I thought I was in good care. I really did. After 34 weeks, you sign in your financial contract that you will not receive any refund for services rendered, even if you transfer care. That being said, it was definitely frowned upon for people to transfer out of care. Because when you transfer it out of care, it just didn't look good.
Something Was Wrong
S23 E1: Built to Birth
Exactly. And also, too, even though you pay your cost for care up front, There are many other things that they're pushing for you to buy, such as their chiropractic packages, their placental encapsulation, their supplements, massages, IV therapy. At one point they were even doing Botox.
Something Was Wrong
S23 E1: Built to Birth
They offer a wide range of services, so they can't crank out any more money from you if they transfer you out of care early in your pregnancy. At 36.4 weeks, we're looking at January 12th of 2022 at this point. It is discovered that my son is breech. It's recorded, but on my flow chart, they record that I was breech at 32 weeks.
Something Was Wrong
S23 E1: Built to Birth
But 32 weeks was around the time that I had gone into Baylor for that placental abruption. And they had never mentioned this to you if that was the case? No, they never mentioned. Well, they wouldn't have known. So my scan wasn't done until 36 weeks. And I don't know why they would record it that way because my son was discovered to be breech at 36 weeks, not at 32.
Something Was Wrong
S23 E1: Built to Birth
But it was recorded as such in my chart. At 36 weeks, I see a brand new midwife. She's a CNM. I think I saw this midwife once, maybe twice. And upon seeing her, I was 36 weeks, but I was measuring at 31 centimeters fundal height. So that means my baby was not growing normally anymore. She sends up red flags. I was like, what does this mean?
Something Was Wrong
S23 E1: Built to Birth
She says, honestly, it can mean that there's something wrong with your placenta. that your placenta is not doing what it's supposed to and your son's not growing normally anymore. Those are along the lines of what she said to me. It was very upsetting. And she wasn't being rude or anything of that nature. That's not what I mean. But she was the one that was like, something's not right.
Something Was Wrong
S23 E1: Built to Birth
She says, you need to get an ultrasound. And they had a guy that came in every Wednesday that did ultrasounds. So it is Wednesday on the day that I have this visit. I go to the front desk and they say, we'll get you scheduled for an ultrasound next week. I'm sorry. You just told me that my son is weeks behind in growth.
Something Was Wrong
S23 E1: Built to Birth
And you're telling me that you're not going to get me in for an ultrasound until next week. I went out to the car and I was crying. And my husband was like, you know what? No, we're going to go in there and we're going to demand to get an ultrasound that day. And so we went back in, we talked to the front desk and we were basically like, we need to get this done today.
Something Was Wrong
S23 E1: Built to Birth
If there are issues or if there are signs that our son's not growing normally, we need to know now. We get this ultrasound done by Moody Diagnostics, Dr. Brunson. My son is breech positioned. There are many different types of breech positioning for babies. My son is what was called transverse breech. So that's like when your baby is laying like a banana in your uterus.
Something Was Wrong
S23 E1: Built to Birth
So he's laying across side to side in my belly instead of up and down. Looking at this ultrasound, my son, who had been developing normally my entire pregnancy, suddenly was almost two weeks behind in growth. This is also another major red flag that my provider should have recognized as being abnormal. I'd had multiple high BP readings. I had started to swell pretty severely.
Something Was Wrong
S23 E1: Built to Birth
At this point, I had abnormal lab results. At 36 weeks, my hemoglobin was low. My hemocrit was abnormal as well. So all of these things were suggesting that there was something more going on than just a normal pregnancy. When you have preeclampsia, your body is beginning to deteriorate. Your kidneys are not functioning normally. Your liver is not functioning normally.
Something Was Wrong
S23 E1: Built to Birth
In worst case scenario, you have seizure-like episodes. Looking back at my records, I don't understand why I wasn't referred. Even at 36 weeks and four days, I was not referred to an OBGYN. Because my son was breech, they did refer me for what is called an ECV, which is a medical procedure that moves the baby.
Something Was Wrong
S23 E1: Built to Birth
So I'm scheduled for this, but also at the same time, I'm told to perform like a spinning babies exercise. Spinning babies is like a natural program or philosophy that if you do these exercises, sometimes you can naturally turn your baby over. There's one night where I feel like my son is like jumping up and down in my womb.
Something Was Wrong
S23 E1: Built to Birth
So I call the midwives the next day and I say, hey, I think my son turned over. Can I come in and have my baby looked at? I think it was Elizabeth who felt around for my baby. She proclaimed after doing a manual examination, pressing down on my abdomen, things like that, that my son had turned over, that he was no longer breech and he was in the right position.
Something Was Wrong
S23 E1: Built to Birth
No ultrasound was done to confirm that my son had flipped over at 36 weeks. And this is important to note because of how my labor and delivery will go.
Something Was Wrong
S23 E1: Built to Birth
great, I'm safe with these people. They're professionals. If anything was to go wrong, they would recognize it as it was happening or before it was happening.
Something Was Wrong
S23 E1: Built to Birth
We assumed that these people were professionals that were being regulated by the state of Texas. They claimed to be upheld to these really high standards of care.
Something Was Wrong
S23 E1: Built to Birth
I had spots in my vision. Jennifer told me that, oh, that's nothing to be worried about.
Something Was Wrong
S23 E1: Built to Birth
And this is when all hell breaks loose. This is a life-threatening emergency. If we don't deliver this baby in the next few minutes, you are risking serious, serious harm and death.
Something Was Wrong
S23 E1: Built to Birth
There's a quote that says, at some point, we need to stop pulling people out of the river and travel upstream and discover why they're falling in the first place.
Something Was Wrong
S23 E1: Built to Birth
My name is Kristen. Me and my husband became pregnant in 2021. At the time, I wasn't one way or the other when it came to choosing a provider for my pregnancy. And honestly, when I was first looking for a provider, I wasn't really thinking about midwifery at all. I assumed that I would give birth in a hospital with an obstetrician. I didn't really even know that there was another option.
Something Was Wrong
S23 E1: Built to Birth
However, I was talking to a coworker who spoke about his wife's experience with a home birth midwife and how it was just a great experience, very easy. His wife recovered very quickly. I was like, okay, that's interesting. And then I was kind of looking into more personal how I wanted to birth, how I wanted to labor and deliver, and what I wanted my pregnancy to look like.
Something Was Wrong
S23 E1: Built to Birth
And I stumbled across what's coined now as natural birth or physiological birth. Ideally, I wanted to try to give birth without any pain management, things of that nature, just to give it a shot on my own. And when you begin to look into natural birth or physiological birth, you come across a lot of different types of content.
Something Was Wrong
S23 E1: Built to Birth
You come across bloggers, birth gurus and doulas and midwives and all these different types of accounts that talk about you don't need to give birth in a hospital. Historically speaking, women were built to birth. And so I started looking into more of how to quote unquote train for natural birth and delivery.
Something Was Wrong
S23 E1: Built to Birth
You know, when you look on Instagram and you see all these pictures and videos of these women like having these beautiful transcendent births in bathtubs filled with flowers in their home or That victory face after a woman's just given birth, unmedicated on her own. You look at that and you think, I can do that too.
Something Was Wrong
S23 E1: Built to Birth
And you're further convinced by these people on these platforms that you were built to birth. When you're consuming these types of platforms that tell you that physiological birth and natural birth is the best way to go, there's also some other stigmas that come with it where if you walk into a hospital to birth, you better be prepared to advocate for yourself.
Something Was Wrong
S23 E1: Built to Birth
You better be prepared to know more than the doctor about certain procedures and statistics. more or less, you're going to experience obstetric violence, trauma, and a cascade of interventions, which leads to higher rates of cesarean sections and whatnot. And above all else, I just did not want to be traumatized. It didn't matter to me whether or not I was with an obstetrician or with a midwife.
Something Was Wrong
S23 E1: Built to Birth
I was raised by a nurse. So I had a very neutral... feeling in a good respect and understanding for the medical field. This concept that my providers wouldn't be for me or wouldn't make the best decisions for me was kind of a foreign concept to me. I started spreading my feelers and looking for other options. I'd heard about birth centers.
Something Was Wrong
S23 E1: Built to Birth
I know in a lot of other countries similar to the United States, economically, primarily use midwives in their maternity wards. For example, New Zealand, they have some of the lowest mortality rates in the world. Texas had lots of obstetric deserts. 46% of our counties are considered obstetric deserts where women do not have access to a hospital or a maternity ward over a 30-mile radius.
Something Was Wrong
S23 E1: Built to Birth
That is almost half of our counties. And there are more and more and more people flooding into Texas in the last few years. Obstetricians are fleeing our state because of strict abortion bans and bars on their practice. We are in a lose-lose situation right now.
Something Was Wrong
S23 E1: Built to Birth
If we are looking at direct entry midwives as the answer to our lack of prenatal care and access into the state of Texas, we are in bad shape indeed. There is such a lack of foundational regulation and educational standards here. There's not a lot of unification or standardization inside of the profession itself across the United States. I really do love midwifery.
Something Was Wrong
S23 E1: Built to Birth
And there are going to be a lot of people who listen to this and go, does she really? But it's true. I was enamored by the belief in physiological birth and a woman's ability in the miracle to produce life.
Something Was Wrong
S23 E1: Built to Birth
I do believe there is room for less hands-on intervention and to allow what is normally considered a natural process to happen under expert guidance and supervision to be safe keepers if things do go wrong. And I think America as a whole needs more of that in their awards. We need more respect for women's autonomy.
Something Was Wrong
S23 E1: Built to Birth
We need to allow women to make choices for themselves by giving them the safest options available to them and talking to them in ways that to help them understand the situations that they're in. Because oftentimes I see women who have gone through birth trauma, which occurs to more than you would think. And it was through an intervention that was necessary, but no one explained what was happening.
Something Was Wrong
S23 E1: Built to Birth
No one was holding her hand while these things were happening and telling her, this is what we need to do to keep you safe. This is how we're going to do it. Can we do this? The way that we talk to women inside of hospital rooms when they're giving birth can be at times dehumanizing. We forget about the woman and
Something Was Wrong
S23 E1: Built to Birth
focus solely on the safety of the baby, which more or less this is what this is about, but it is about the whole. It is about mother and the baby and how they begin to come apart and how we treat her in this process is going to affect everything about the mother that she is.
Something Was Wrong
S23 E1: Built to Birth
And that is kind of the key point of what drives me to tell my story because this misunderstanding and this mistreatment of women is not just happening in hospitals. It happens in out-of-hospital births, and I think that there is a lack of discussion with inside of the midwifery community about what can we be doing to bridge the gap, closing the parameters of risk.
Something Was Wrong
S23 E1: Built to Birth
That is what I'm hoping to incite here, is that I believe in this process. I really do. But I believe in it when it's done safely, when it's done ethically, and when it's done in a way that gives the woman that is taking these services in a way that allows her to see the full picture.
Something Was Wrong
S23 E1: Built to Birth
that isn't swaying her one direction or another is laying out the risk and really letting her understand and decide those things for herself. So that's really what I'm hoping to get here. In no way am I trying to discriminate against the midwifery community or signal that there needs to be an end of midwifery in the United States. What I'm trying to wave here is a red flag that says we need help.
Something Was Wrong
S23 E1: Built to Birth
This field needs help. There's a quote out there that says, at some point, we need to stop pulling people out of the river and travel upstream and discover why they're falling in the first place.
Something Was Wrong
S23 E1: Built to Birth
And I think that's what we need to do as a community, as a whole, as consumers and as midwives, is we need to start looking at why people are falling in the river in the first place and not just writing it off. We cannot write off these instances. For the most part, The community tries to focus on the good because mostly good happens. Mostly pregnancy and delivery go normally.
Something Was Wrong
S23 E1: Built to Birth
But that means people like me are not truly safe. When complications arise and you are in the presence of people with varying degrees of education... Texas has multiple pathways to licensure for midwifery through apprenticeship model or a state-approved course, or you can go to an accredited college, but it's not required. I did not know this. This is what I learned later.
Something Was Wrong
S23 E1: Built to Birth
When you're hiring a midwife, one, you don't know to ask. Two, you don't know what kind of education they received. You don't know what kind of education their preceptor received and what they believe in and how that was passed on and how that's going to affect your care. Abnormalities and complications can happen to anybody. And that is the thing you don't realize as you're walking into care.
Something Was Wrong
S23 E1: Built to Birth
You think it's not going to be you. I was a healthy 20-something-year-old. No prior complications or medical conditions. There was no reason for me really not to have a normal, uneventful pregnancy. But it happened to me. We cannot write off death. We cannot write off morbidity and extreme trauma because I know this personally, you affect a whole generation. Let's be honest.
Something Was Wrong
S23 E1: Built to Birth
What happened to me affected the mother that I am today. In a lot of ways, I felt like the mother that I was supposed to be was stolen from me because of what had happened to me. And I've had to work really, really, really hard to get back to who I thought she would be. I think that I probably would have been a lot less anxious.
Something Was Wrong
S23 E4: Hell House
I started forming this group called Survivors of Origins Birth and Wellness. It was a little quiet at first. Nobody was really saying their stories or anything, but then we started getting multiple responses. to join the group a day. Eventually, Markita responded to me and she joined the group.
Something Was Wrong
S23 E4: Hell House
And then I posted my story in the group and then she posted hers and then other people started to post theirs. Talking about all kinds of different things happening in pregnancy. Failures to address abnormalities and concerns and near misses.
Something Was Wrong
S23 E8: Life and Death
And for a body such as TDLR to be overseeing and determining what kind of education is best, what kind of practices are best, and determining the consequences for if you steer outside of your practice scope, it's laughable.
Something Was Wrong
S23 E8: Life and Death
How this works is that you go to TDLR's website, there's a complaint portal, or you can go to the midwifery licensee section of their website, and then there's an area for you to file a complaint. So you can file a complaint online or written online. I actually didn't know that you could file a complaint online.
Something Was Wrong
S23 E8: Life and Death
So I wrote out my complaint and then submitted it, but then it wasn't getting any traction. Like I didn't hear back from TDLR. So I went back and did that online complaint. And that's kind of when things started rolling. Me and Markita submitted our complaints just a couple of weeks apart from each other, maybe not even that. So how that process works is they accept your complaint,
Something Was Wrong
S23 E8: Life and Death
You get an email or even a mailed in letter stating that we have received your complaint. The next step here is going to be an investigation. An investigator will call you to record details of your complaint. That's what happened. She asked me to recount my story and tell her all the areas where things had gone wrong.
Something Was Wrong
S23 E8: Life and Death
I told her my story top to bottom, including labs and medical discrepancies, things of that nature. She recorded that and then it gets investigated. And during the investigation period, they look at all of the records that you send over to them. They ask you to submit any records that you have pertaining to origins.
Something Was Wrong
S23 E8: Life and Death
And then they will also ask you for a release of medical records so they can contact the facility and the hospital that you were seen at. I'm not sure what entirely goes into the investigation process. I believe that they fact check and then they compare your story to their admin code. There are specific admin codes for midwives that they cannot violate.
Something Was Wrong
S23 E8: Life and Death
And if they violate it, it's a direct breach of TDR's policy. then they will start an internal prosecution for this. Let's say I charted incorrectly. The disciplinary action for that would be $500 and a continued education on proper charting. And that is just an example. That's not a quote directly from the admin code or even from TDLR's rules, which are available on their website.
Something Was Wrong
S23 E8: Life and Death
You can see disciplinary action and its correspondence to the violation that it cites and what those typically look like. From my own story, I mean, some of the violations were like some of the worst things that you can do in terms of violating any of those rules or admin code. I believe this took a few months of investigation. And then finally, it was submitted to prosecution.
Something Was Wrong
S23 E8: Life and Death
Me and Markita began to meet up. We poured over her records and my records. I was trying to understand where legally they had messed up and where they had violated a direct code from their bylaws. And then also trying to help Marquita with that as well, because what happened to her son was absolutely preventable.
Something Was Wrong
S23 E8: Life and Death
My case has been in prosecution for a year now, and there still is no conclusion to what is going to happen. I have reached out to TDLR several times. In regards to new things that I learned about my case, for example, when I found out that the financial director of Origins was balance billing people willingly and knowingly and then refusing to send me my medical records.
Something Was Wrong
S23 E8: Life and Death
I sent a long email to the prosecutor on my case stating that I had a few concerns. My complaint against Jennifer Crawford suggested that she was practicing medicine without a license during the duration of my pregnancy, not just with me, but with every patient that was at Origins Birth and Wellness until 5-22 when Jennifer was licensed by the state.
Something Was Wrong
S23 E8: Life and Death
I had concerns about how TDLR will handle that because practicing medicine without a license in the state of Texas is a felony. You can be jailed for up to 10 years of your life. It's a very serious thing. However, that particular criminal charge is overseen by the Texas Medical Board, and it is used on people who are practicing medicine, such as nurses or doctors, without a license.
Something Was Wrong
S23 E8: Life and Death
Technically, midwives are not in their jurisdictions. There would need to be a thorough investigation of every patient's records from when Jennifer allegedly started working for Origins to determine the severity of the policies in the admin code that she violated. She was seeing many people unattended without her preceptor.
Something Was Wrong
S23 E8: Life and Death
When me and Markito were discovering this, we had a lot of hope in the system that if we made these reports, that the right things would happen and we would receive justice. TDLR spoke to me directly about my case. So this was their response to me. Thank you for your email. I am working on your case right now to answer a few questions that you asked previously.
Something Was Wrong
S23 E8: Life and Death
Our role at TDLR is purely on license violations rather than criminal activity, even though they can be intertwined. I'm aware that there are other state agencies looking into this matter as well. I do not have any details. You are always welcome to contact law enforcement and make a report to them in regards to criminal activity.
Something Was Wrong
S23 E8: Life and Death
We do have subject matter experts that we contract with to help us determine violations when needed. We also have rules relating to billing and medical records, which we will look at when determining any violations. My response to that email was, thank you. From what I read in this email, TDLR is not required to report criminal activity that has been found in complaints, question mark.
Something Was Wrong
S23 E8: Life and Death
Also, are subject matter experts only licensed midwives? Then I stated that seems very strange, such as in my case, I had severe preeclampsia and other high-risk conditions in my pregnancy. Licensed midwives specialized in low-risk pregnancy are not trained to assess high-risk conditions. Therefore, they are not experts. They are not experts in prenatal pathology.
Something Was Wrong
S23 E8: Life and Death
Is TDLR qualified to assess these medical intricacies of maternal and neonatal health? I understand TDLR's purview is to oversee licensing policies, but there is so much at stake in these complaints. My prosecutor's response to that was, based on the limited authority that our agency has, we do not have a requirement to report suspected criminal activity.
Something Was Wrong
S23 E8: Life and Death
However, there is nothing that prohibits you from being able to file a complaint to law enforcement. you are welcome to share that TDLR has an open administrative case as well. We use subject matter experts that are licensed by TDLR as it would be improper to use medical experts with greater education than our licensees.
Something Was Wrong
S23 E8: Life and Death
And I also wanted her to get recourse, knowing that I couldn't get recourse myself criminally or through malpractice insurance. We poured over her records and my records. They went so far as to falsify my records by signing off on my records saying that they were Jennifer's preceptor. I had never met Gina or Caitlin ever. They were never in clinic with me.
Something Was Wrong
S23 E8: Life and Death
We prefer the case to be reviewed by someone with the same expertise and training as our licensees to properly evaluate the standard of care and whether it was violated in this case.
Something Was Wrong
S23 E8: Life and Death
TDLR licensed experts know the applicable laws and rules from the administrative licensing side, whereas using an expert that has a different regulatory agency with different rules and laws than ours would be inappropriate. So it is another licensed midwife who are overseeing these cases. I'll tell you why it doesn't make sense. You have people who do not specialize in
Something Was Wrong
S23 E8: Life and Death
who are not trained or educated in the pathology of these abnormalities associated with maternal or fetal health. Reviewing these cases, reviewing these charts that are often incomplete. My charts are not complete. People who were charting were leaving out symptoms. Even my BP was different in a couple of cases.
Something Was Wrong
S23 E8: Life and Death
And I think it's important to note that per NARM, the North American Registry of Midwives, they state that every midwife has to come up with their own guidelines for their practice. So of these contracted expert witnesses, you have people who by and large have their own standards. There is no standard that they're both looking at together and going, ooh, that is preeclampsia.
Something Was Wrong
S23 E8: Life and Death
Is it preeclampsia to one? Sure. Is it preeclampsia to another? Maybe not. I don't have a lot of trust in that part. And they completely will not hire any doctors or certified nurse midwives or anybody who is an expert in those fields to look at these cases.
Something Was Wrong
S23 E8: Life and Death
I think it is inappropriate to have people who potentially don't understand the pathologies that they're looking at making judgment on these cases. I find that inappropriate and actually unethical because you're not getting true justice here. The midwifery community in Texas is very small.
Something Was Wrong
S23 E8: Life and Death
And the midwives that are on the board that are usually used as expert witnesses, if you're friends with that expert witness and you know that they're an expert witness, is your case being taken seriously? Is that friend just going to push your case along or close it because they were good friends with the midwife that you were complaining against?
Something Was Wrong
S23 E8: Life and Death
We realized that TDLR doesn't have the resources that they need to be able to really investigate these types of cases adequately. We were very disappointed when we found out that TDLR specializes in giving admin fines and things like that for violated terms. They don't charge criminally.
Something Was Wrong
S23 E8: Life and Death
They can send off cases to the OAG or to a law enforcement agency, but they're not required to, from what I was told. So it's up to their discretion to decide what kind of accountability disciplinary actions are adequate for these types of situations. I went through the hoops. I contacted Dallas PD. I contacted the Texas Medical Board. I also tried to connect with the district attorney's office.
Something Was Wrong
S23 E8: Life and Death
I also contacted the OAG's office, all of which said that it is up to the licensing agency to submit reports and to lift these cases up for criminal prosecution. I could not do that myself. The Dallas PD was like, that's not something that we can do for you. The TMB, the Texas Medical Board, said they are not under our jurisdiction. We cannot prosecute midwives because we do not regulate them.
Something Was Wrong
S23 E8: Life and Death
The DA's office said that the report cannot come from a civilian. It would have to come from a law enforcement agency or some sort of licensing entity such as TDLR. So I believe that TDLR has the capacity. They just can choose.
Something Was Wrong
S23 E8: Life and Death
I don't know all the ins and outs of what that looks like and what would prevent TDLR from raising a case like this to people who can prosecute criminally, which I think that's something that needs to be looked at within itself.
Something Was Wrong
S23 E8: Life and Death
I think especially a state entity, if you are presented with a complaint or a case, I think that is your duty to your consumers to report that crime because it leaves people like us civilians with no restitution.
Something Was Wrong
S23 E8: Life and Death
I also discovered that if Jennifer is found guilty of what she did, the maximum disciplinary action she'd receive would be up to a year of revocation of her license and admin fees, however much they decided would be adequate for the situation. So that was very disappointing for us. We really had a lot of hope and stock put into TDLR.
Something Was Wrong
S23 E8: Life and Death
Yes. There was a larger investigation that was opened for all of Origins cases that is ongoing as well right now. And so I think my case may be hung up until that one comes to a resolution as well. I reported Origins for committing Medicaid fraud. I want to say March of last year. Maybe it was a little later than that.
Something Was Wrong
S23 E8: Life and Death
But I contacted the Medicaid fraud unit in Dallas and spoke to one of their sergeants. Essentially, I told them they have been using newborn test kits that are for Medicaid patients only. When you order newborn screening kits, you can order for self-pay and insured patients, and then you can order for Medicaid patients. Medicaid patients are completely free. They were ordering the Medicaid ones.
Something Was Wrong
S23 E8: Life and Death
using them on self-pay and insured clients and then charging insurance and those self-pay clients for those free Medicaid newborn screening kits that they were receiving from the state. He was like, how do you know this? So I told him my story and some of the stories of the people that I know gave information about basically the fraudulent activities that Origins had been part of.
Something Was Wrong
S23 E8: Life and Death
Well, this sergeant wanted to take on the patient negligence and other things and began interviewing several different people who had negative outcomes with origins. But there was a jurisdiction issue where he was only supposed to do investigations on Medicaid fraud. And it was outside of his jurisdiction to also investigate patient abuse and negligence and insurance fraud. So he went to TDLR.
Something Was Wrong
S23 E8: Life and Death
and gave them the case and all the information that he had already garnered and said, hey, this is what's going on. And so TDLR opened up a larger investigation that is still ongoing right now. To the best of my knowledge, Markita's review is still in prosecution as mine is.
Something Was Wrong
S23 E8: Life and Death
Around 2-7-24, I emailed Morgan, an investigative journalist, and I also emailed a whole bunch of other news outlets. Every news outlet in the area, like locally, I sent them a little op-ed. Popular birth center exposed for shady practices was my tagline. Morgan actually emailed me the same day. I was extremely surprised. I didn't expect anybody to reach back out.
Something Was Wrong
S23 E8: Life and Death
We did get a storyline with WFAA. She did reach out to Gina and Caitlin for comment. The first segment, State Investigating Dallas Birth Center and Midwives Following Multiple Complaints from Patients, aired March 29th of 2024.
Something Was Wrong
S23 E8: Life and Death
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Something Was Wrong
S23 E8: Life and Death
���������acacacacacacacacacacacacacacacacacacacacacacacacacacacacac Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac Athlet Athlet Athlet Athlet Athlet Athletahacacac Athletahacacacahacacacahacacacahacacacahacacah cle cle cle cle cleacac Athlet AthletacketketTVketTVketaceniacketTVketac Cl ClacTVketTV Cl ClacTVketTVketaceniacketaceniacketaceniacketacacTV Cl ClacTVketTV ClacacacTVketaceniacketTVacketketTVacketetchachachaTV Cl Clenicha
Something Was Wrong
S23 E8: Life and Death
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. ,,,,,,, ,,,,,,,
Something Was Wrong
S23 E8: Life and Death
This is how they started out their career together. It tells me a lot. There's something so very disturbing about this because they seem to feel they can just get away with it all.
Something Was Wrong
S23 E8: Life and Death
Yes. What we found for midwifery in the state of Texas is that there are many ways to become a midwife. And it's really based off of relying on people's integrity. You're relying on the accountability of the people around you. There is documentation. The preceptor will sign off on the things that you've done throughout your training, but who's to say you actually did those things?
Something Was Wrong
S23 E8: Life and Death
There's no hierarchy there. There's no one checking to make sure that you did what you said you did. The board which prosecuted her then was dissolved. So Gina's probably one of the last cases that they ever made any kind of disciplinary action on. At every point that me, Markita, or Amanda had found something, we brought it to the group.
Something Was Wrong
S23 E8: Life and Death
So if anybody wanted to, those resources were there for you, not that you had to. And I always made that very clear in the post. You don't have to be on this bandwagon to bring justice to origins, but if you want to, here are your resources.
Something Was Wrong
S23 E8: Life and Death
We started sharing information from an ex-employee in the group about how Origins had been stealing from patients, essentially charging them more than what they owed per their insurance and then not giving any refunds. Origins charged globally and you paid all of your fees up front. You paid what they quoted you would be charged through your insurance. And that was it.
Something Was Wrong
S23 E8: Life and Death
So if you were overcharged or you paid more for certain services that you shouldn't have paid for or they messed up the billing somewhere somehow, unless you went back and looked through your verification of benefits, you went through your insurance bill and then compared it to your bill from Origins, you wouldn't know that you'd been overcharged.
Something Was Wrong
S23 E8: Life and Death
In total, I paid over $3,000 to Origins, which was well over the amount that I owed them originally. the financial director for Origins Birth and Wellness. She was a placenta encapsulator. Well, she balance billed people regularly. Balance billing is typically done for out-of-network people.
Something Was Wrong
S23 E8: Life and Death
Balance billing occurs when a health plan doesn't pay the full amount charged by an out-of-network provider, and the provider sends the patient a bill for the remaining amount. What essentially balanced billing is, is you're not allowed to charge a patient more than what their insurance finds them responsible for, even if it's out of network.
Something Was Wrong
S23 E8: Life and Death
No surprise bills, essentially, is what the state of Texas has declared.
Something Was Wrong
S23 E8: Life and Death
I had an anonymous person reach out to me who used to be an employee of Origins. And they knew a lot about insurance and they knew a lot about how Origins operated behind the scenes. And they walked me through how to look at my bill, what information I needed to get from my insurance and from Origins to be able to assess whether or not I had been overcharged.
Something Was Wrong
S23 E8: Life and Death
Also, I have text messages where the financial director, specifically on my case, instructed an employee to balance bill me. Like she uses those words, balance bill it, which I thought was absolutely wild. So I was owed a refund. I sent many emails and left many voicemails
Something Was Wrong
S23 E8: Life and Death
She never responded to me outside of sending me two itemized bills, one which stated the amount that I paid to Origins, and then she sent me another one. After I had asked for insurance audits to see the claims that they filed, she sent me another bill stating that I owed them $400, but they weren't going to pursue it.
Something Was Wrong
S23 E8: Life and Death
They charged me like $350 for an office visit, which was actually a phone call with Jennifer, an unlicensed student. And so in my emails, I was like, you can't charge me $350 for an office visit that was a phone call with an unlicensed, uncredentialed provider. I asked for a meeting with her. I asked to speak with her on the phone. She just point blank did not respond to my emails.
Something Was Wrong
S23 E8: Life and Death
Nobody ever followed up with you about that? No, not at all.
Something Was Wrong
S23 E8: Life and Death
Yes, actually. Everyone started asking for their medical records, which the bookkeeper was proposing a $25 admin fee for people to receive their medical records, which were digital documents, by the way. It wasn't like she was printing and mailing out packets of medical information. Not everybody got the email saying that they would have to pay $25 for their medical records.
Something Was Wrong
S23 E8: Life and Death
And of course, that was circulated around and women who had had bad experiences and women who had had good experiences were like, WTF? This isn't fair. I never received my records. I did ask multiple times and they refused. I would like to point out that my doctor, she gave me the records that were sent to her.
Something Was Wrong
S23 E8: Life and Death
I did file a report with TDI, which is the Texas Department of Insurance for balance billing. TDI is responsible for insurance fraud and stuff like that. Whoever I talked to on the phone, I let them know. I was like, listen, they did this for however long. In the last year alone, they had owed, I believe, $100,000 in refunds. Refunds for overbilling? Yes, overpaying.
Something Was Wrong
S23 E8: Life and Death
And the guy that I talked to through TDI said, that's something that you're going to have to take up with your individual insurance. You're going to have to tell them that they balance billed you. I was like, what is my insurance going to do about that? My insurance isn't going to give me the money that they took from me and didn't refund to me.
Something Was Wrong
S23 E8: Life and Death
So that was kind of a dead end, which was really disappointing.
Something Was Wrong
S23 E8: Life and Death
Texas doesn't have any laws or requirements on what kind of building can be considered a birth center. To open up any business or to even operate a business, you must have a CO or are subject to being shut down. HHS is the body that regulates birth centers.
Something Was Wrong
S23 E8: Life and Death
I filed a complaint with HHS and they did an investigation and there was nothing done, even though there is records of Jennifer operating without a license and things like that. Mostly the state looks for cleanliness and make sure things are labeled the way that they're supposed to. Biological waste is taken care of in the appropriate manner and so on and so forth.
Something Was Wrong
S23 E8: Life and Death
They don't really look into patient negligence and things of that nature.
Something Was Wrong
S23 E8: Life and Death
We started digging into Texas admin code for midwives. I realized that I could report to TDLR, Texas Department of Licensing and Regulation. The same committee regulates sanitarians, barbers, and tow truck drivers, regulate direct entry midwives. It was really shocking because I was an esthetician.
Something Was Wrong
S23 E8: Life and Death
I was licensed by TDLR and the fact that being an esthetician, someone who gives people facials and waxes people, was regulated by the same body who regulates direct entry midwives who are literally in charge of life and death. Being a first-time pregnant person, what I didn't understand was that there are a lot of things that happen to your body.
Something Was Wrong
S23 E8: Life and Death
during the course of your pregnancy, labor and delivery. There's a whole slew of unfathomable things that I could list off to you that can occur during pregnancy, labor and delivery, even if you had a perfectly healthy pregnancy that would put you or your child at risk.
The MeidasTouch Podcast
Trump Blows Up Term Quickly and Throws a Party
Not at all, Kristen. What I'm saying is the American dream is not let them eat flat screens. If American families aren't able to afford a home, don't believe that their children will do better than they are, the American dream is not contingent on cheap baubles they have from China, that it is more than that. And we are focused on affordability, but it's mortgages, it's cars, it's real wage gains.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
Hi, thank you for taking my call. My husband and I have a slight disagreement. I have... Most of what our income is, is rental houses. And in 2023, we purchased four new houses. That puts us up to 24. And we've already paid one of them off. We still have three outstanding mortgages. And the total for all of them combined is right about $420,000.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
And I have a stock portfolio that has $506,000 in it. His idea is that we go cash it out right now and go just pay off the mortgages. I'm like, no, that's kind of my, that was my plan for retirement in case everything else went south. The way things are sitting up, we're scheduled to have all three of these other mortgages paid off by the mid of 2028.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
And I don't see what would be the point of cashing out all of my stock portfolio to pay them off now if we're literally going to have them paid off in the next couple of years.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
For the most part, it's literally, that is mine aside from, I only work 26 hours a week doing home health care. And so then I also manage our 24 rentals. So I only have $7,000 in a 401k of my own, and then he has $22,000 in his 401k. But other than that, that's really... Is this stock portfolio non-retirement?
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
It's in a combination of mutual funds, independent stocks as well. I've had it... Managed by the same gentleman for the last 20, I'm 41. And he's managed it and he gets somewhere between a 13, 14% every year return, even when the market took a crash in 2023. Okay. So you trust this person. He knows what he's doing. Yes.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
And I just, I don't know if it would be worth pulling it out to pick because we bring in If you average, we always have one or two tenants who is either late or misses a month. But we bring in about $21,500 every month on rent. So it's not like if we were to have to worry about something, there's enough to cover.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
The three of them combined, the minimums would be $3,800. We're putting $10,000 a month on the other one, on one of the three.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
Well, our market here has been absolutely nuts. So I have the tax valuation at $4.2 million.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
I would say it's probably closer to $5 million.
The Ramsey Show
Getting Your House In Order Is The First Step To Financial Success
That would be entirely doable.
The Viall Files
E889 Ask Nick - Rebound Rodeo
But I'm not sure what she realistically expects. I'm not sure.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Potentially. Though I think that my husband was already suspicious beforehand, so I think that they could realistically have a conversation that... Yeah, your husband would have to kind of fib and not be like, your wife told my wife and I know what's going on.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Ich denke, dass es wahrscheinlich relativ normal ist, für Menschen, die vielleicht auf dem gleichen Niveau sind, zu hüpfen. Ich denke, dass jeder mit dem Gehirn wahrscheinlich die... Power Dynamics of an upper level resident and applicant.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Und dieser Versuch ist brandneu, also denke ich, er ist wie ein Puppe, der nicht denkt, brandneuer Versuch, ja, los, erste Person, die ich sehe.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Genau. Und ich denke, es war wahrscheinlich ein bisschen auf die gleichen Linien, als er sie anruft. Die Beratung ist bereits passiert, wo sie in Theorie ihre Entscheidung machen, aber sie haben diese Entscheidung noch nicht offiziell gemacht. Diese Entscheidung wird nicht mehr für ein paar Wochen offiziell werden.
The Viall Files
E889 Ask Nick - Rebound Rodeo
So the but at least on paper they have and I don't know, this is closed off information to my husband, of course me. So I don't know what that decision says, but at least in that meeting or the meeting leading up to it that my husband was in along with this upper level resident, he was, you know, advocating for her like.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Yeah, I want my hot new little girlfriend to be here and not thinking through the consequences of that. And I think now he's starting to realize that this could potentially end his career.
The Viall Files
E889 Ask Nick - Rebound Rodeo
So should I just kind of give that advice to my friend?
The Viall Files
E889 Ask Nick - Rebound Rodeo
Good. My name is Kristen. I am 30 years old. And an applicant is sleeping with superiors, including my friend's husband. Should we tell the boss?
The Viall Files
E889 Ask Nick - Rebound Rodeo
Distances himself and then we just hope that if she does end up here at this program, that she doesn't... The good news is, short of her
The Viall Files
E889 Ask Nick - Rebound Rodeo
Right. And I think that even though there is still some risk with that, that's the best case scenario, is that she ends up not here, but she does get a position somewhere else. And like, at least for us and our program and our friends, this is all in the past. I just think that it's looking like that if nothing changes, there is a decent chance that she is going to end up here at our program.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Ja, wenn jemand am Arbeit ist, sieht es so aus, als wäre es schmutzig, aber ja. Wenn seine Frau es den Leuten sagt? Ja, naja, zu Beginn war sie einfach nur gespannt auf das Arrangement und dass ihr Mann sie weniger für Sex interessiert. Und zuerst war sie einfach so, ja, ist das nicht eine interessante, neue, neue Sache? Ich glaube nicht, dass sie zuerst erkannt hat, dass das problematisch war.
The Viall Files
E889 Ask Nick - Rebound Rodeo
So, this is someone applying for the residency program. So, my husband is a surgical resident. So, these are doctors who are in training for their surgical specialties. And they are doing applications for the incoming class of residents.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Okay, but yeah, so I'll just focus on being a good friend.
The Viall Files
E889 Ask Nick - Rebound Rodeo
The one idea that my husband did, like is somewhat seriously considering, is going to the program director and saying like, hey, this applicant told me that their interview process was discontinued at both of the other institutions that They rotated at, I thought that was weird, do you know why?
The Viall Files
E889 Ask Nick - Rebound Rodeo
And just leave it as a, like, I heard this information, I thought it was weird, do you happen to know why? and not directly get involved in what's happening here. But I don't know if even that is... I mean, that's definitely an option.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Part of me, and I just also need to get over this, part of me just feels a little bit guilty as well for the program director that she's potentially stepping in shit and doesn't even realize it.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Yeah. So the boss, so the person who is ultimately in charge of the program. Is a woman. Und ich fühle mich ein bisschen schlecht für sie, wenn sie jetzt in dieser Situation endet, in der sie mit all diesem zusätzlichen Drama in ihrem Programm handeln muss.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Ich glaube, der Applikant wird technisch in ein paar Monaten Doktor werden.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Yeah, I agree. That makes sense. I'll just focus on being a good friend, giving advice to my friend. Let the chips fall where they may with the rest of it.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Wir sind ein sehr festgelegtes Programm. Es ist mein Mann, der tatsächlich in dem Programm ist, aber wir sind alle sehr nahe. Ich bin also sehr gute Freunde mit der Frau eines anderen Besuchers. Sie hat mir mit Ungewissheit gesagt, dass ihr Mann mit diesem Applikanten schläft.
The Viall Files
E889 Ask Nick - Rebound Rodeo
It was like not that big of a deal to her because they had recently decided that they were going to like have an arrangement where they would like be okay with sexual activity outside of their marriage.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Es scheint so zu sein, dass es andere gibt, von denen ich nicht sicher bin, wie viel Informationen jeder in der Gruppe hat. Ich weiß, dass meine, natürlich dieser Freund, ich und ein anderer Freund, wir alle haben all die Informationen. Einige der anderen Leute im Programm fühlen sich einfach ein bisschen ungeheuer mit dem Niveau der Blödsinnigkeit.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Und dann gibt es auch einen Teil davon, dass wir herausgefunden haben, dass sie eine Geschichte davon hat, dass sie mehrere Wehr-Rotationen an verschiedenen Krankenhäusern gemacht hat und dass sie mit hochwertigen Residenzen an all ihren verschiedenen Rotationen schlief. And the other hospitals, they've all like discontinued her application process. I assume because of this revelation.
The Viall Files
E889 Ask Nick - Rebound Rodeo
But here at our program, I guess because it's still within, like this knowledge is still within our small group and hasn't reached higher levels. Like her, she's, you know, still in this application.
The Viall Files
E889 Ask Nick - Rebound Rodeo
His main concern is that he feels like the program is kind of being duped. Like all of these other programs like have their eyes open to what she's been doing, you know, hooking up with all the upper level residents, I guess, to, you know, sleep her way to the top or whatever her intentions are.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Um, but like, yeah, he just feels like our programs being duped maybe. And like, he just, he like feels kind of guilty, I guess that they don't have all of the information just to make like an informed decision.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Er ist definitiv betroffen, dass er Wälder kreiert. Er würde definitiv nicht wollen, dass unser Name daran verbunden ist, wenn wir did kind of warn the residency director about what was happening and or If we kind of went with an anonymous amount of information.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Und das ist genau das, warum ich nicht völlig sicher bin, wie ich es behandeln kann. Weil eine Teil von mir fühlt sich, als wäre es die richtige Sache, um es zu machen. Ja.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Yeah. And I also, this, my close friend, like the one whose husband is sleeping with the applicant, she is really concerned that this could come back and bite them. Like she's worried that he could get fired.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Yes. And so I'm also concerned that I wouldn't want to betray her trust and have her husband end up... How close are you with the friend? We're pretty close. All right.
The Viall Files
E889 Ask Nick - Rebound Rodeo
And that is the point I've made. I think at first they maybe didn't really realize that or think that through. And then, like, I think partially from talking about it a little bit, like maybe not someone like directly that he works with, especially someone who's currently applying and he has a say in their work.
The Viall Files
E889 Ask Nick - Rebound Rodeo
application because he does he has power in this process who has power and so the my friend's husband the upper level resident who the applicant is sleeping with has say in the this upcoming so she's sleeping with a guy who like she's sleeping with her boss in a sense she's she's up for a promotion she's up for a promotion and he has a say in this promotion
The Viall Files
E889 Ask Nick - Rebound Rodeo
He definitely did not think this through. Now the deed's done.
The Viall Files
E889 Ask Nick - Rebound Rodeo
And I think he's making a mistake by advocating for her because if she ends up here at this program, then you've just increased the chances of this information getting out that they were sleeping together during the application process. Who knows if they will continue to. But if she's around, that just increases the chances of this information
The Viall Files
E889 Ask Nick - Rebound Rodeo
So my close friend who's the wife and me and our other close friend. So the three of us ladies and then I told my husband.
The Viall Files
E889 Ask Nick - Rebound Rodeo
And at the very least, many people are suspicious because they see them, you know, being blurtier, at the very least friendlier than you would expect.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Er ist in der Zwischenzeit. Er ist auch ein Resident, aber er ist aktuell ein niedrigeres Resident.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Right. I've been trying to play out like, okay, what's the worst case scenario? And I mean, it's really, it's pretty limited. Like if I really stretched it, she could end up here and continue to cause drama and distraction and potential legal issues. And that would, and if that got out, hurt the reputation of the Ja, ich meine, es klingt mehr wie für dich, wie die Freundschaft. Ja.
The Viall Files
E889 Ask Nick - Rebound Rodeo
Wie gut sind Freunde deinem Mann mit ihrem Mann? They are more like professional level friends.