Menu
Sign In Pricing Add Podcast

Greg Jenner

Appearances

You're Dead to Me

Happy Christmas from Greg and the team!

193.646

Ho, ho, ho! Hello, friends. Greg here. I hope you're having a lovely Christmas season and a great new year is on the horizon for you. I just thought I'd pop in here to remind you of our lovely Christmas specials from the back catalogue. We've got three, of course, to enjoy. If you scroll down in the feed, the first one you'll find is the radio edit of Christmas with Charles Dickens.

You're Dead to Me

Happy Christmas from Greg and the team!

214.65

A bit further down, you'll find the full-length podcast version. Our guests there were Dr Emily Bell and, of course, Mike Wozniak. It's a lovely one.

You're Dead to Me

Happy Christmas from Greg and the team!

247.392

An elephant walking on ice, Mike. Imagine the insurance forms you have to fill in for that. The health and safety risk assessment. They must have had a moment where they thought this is probably not going to be worth it. Surely, lads, come on.

You're Dead to Me

Happy Christmas from Greg and the team!

258.36

And if you keep scrolling, or if you just want to type things into the search box, if that's easier for you, you will find both long and short versions of our medieval Christmas episode with Miles Jupp and Dr. Eleanor Janager.

You're Dead to Me

Happy Christmas from Greg and the team!

279.074

Wow. Miles, could you go to February 2nd? Can you commit to that kind of level of engagement with Christmas spirit?

You're Dead to Me

Happy Christmas from Greg and the team!

306.793

And even further back in the feed, in fact, all the way back to the end of series one, you will find our very first Christmas special, which was about the Victorian Christmas with Dr Fern Riddell and Russell Kane. Again, available in both long, lovely pod form and shorter radio edit.

You're Dead to Me

Happy Christmas from Greg and the team!

322.724

Now, that's the one to listen to if you want to know why on earth we celebrate Christmas with cars, crackers and dragging a tree inside our house, which when you think about it, it's quite a weird thing to do. And if all of that doesn't keep you going until 2025, you might like to tuck into our episode about the history of chocolate while you polish off your Christmas selection box. Delicious.

You're Dead to Me

Happy Christmas from Greg and the team!

341.797

Oh, and finally, I'm delighted to tell you that we are back for a brand new series in the new year. New episodes will be released on Fridays wherever you get your podcasts. But if you're in the UK, you can listen to the latest episodes 28 days earlier today.

You're Dead to Me

Happy Christmas from Greg and the team!

355.686

than anywhere else first on BBC Sounds so just a big warm lovely festive hug to you all I hope to see you in the new year for a brand new series lots of new jokes lots of new facts great guests take care thank you bye

You're Dead to Me

Happy Christmas from Greg and the team!

84.15

We didn't call Celia the bob-haired bandit. We called Celia Grandma.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1005.485

Bring that back. Bring it back. The Hedgehog Clock. Perfect. In 348, a big thing happens to him. The death of Plato, 348 BCE. His tutor, his great intellectual figurehead dies. And again, the idyllic life comes crashing down around him. And you might assume that he gets the gig, teaching at the academy, takes over running the school.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1052.537

Well, you've clearly deduced what happened because he doesn't get the job that he's expecting. The rivals sort of step in and muscle him out and it's a guy called Spew Sippers. Yeah, which means enthusiast for horses. LAUGHTER

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1089.52

So he doesn't get the gig and he instead, he gets an invitation to go to a new place. He does. And this place is called Assos.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

111.881

OK, we'll get into that later. And in Comedy Corner, he's a writer, comedian, presenter, producer and podcaster. He's a polymath. Maybe you've listened to his incredible podcasts. No such thing as a fish. And his new show, We Can Be Weirdos, or his new kids' book, Impossible Things.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1132.781

Which sounds very progressive and modern, doesn't it? So he heads off to Assos. I spent most of my 30s on Assos too, but I was mostly trying to buy skinny jeans. Right.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1145.111

That's appropriate wit, everyone. I bet there was an equivalent joke. So Assos, he goes there and he finds love. He does.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1175.679

Anyway, he marries her and it seems to have been very happy. And they have a daughter together, also called Pythias, because Aristotle apparently, you know, he's run out of names. He's like, well, you know, I've met one.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1197.015

It's only lasted a couple of years. Okay, so he's raising the baby on his own. Apparently. Ah, it's suddenly taken a turn, isn't it?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1209.078

Okay, so he's got some help. He's got a constitution, right? Yes, he has. But they move to the Isle of Lesbos. They do. Which is not far from Assos. And we've got this single dad with his little girl. What do you think they get up to on Lesbos? What do you think Aristotle's going to do? I'm not going to take the bait, buddy. Nice try.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

127.252

And you'll definitely remember him from our episode of You're Dead to Me all the way back in Series 1 on young Napoleon. It's Dan Schreiber. Welcome back, Dan.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1377.1

He's not desperately trying to get his job back.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1394.165

And so when he's there, he describes 500 species of animal. He's looking at plants as well.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1431.2

And extinction as an idea isn't really rediscovered until the 18th century.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1447.282

You think he's got a wristwatch? You think it is?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1452.803

I knew you'd make it weird. I didn't think it would be this far in.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1469.608

No, but you're right. He's extraordinary in every way. And he's not flawless, and we'll talk about some of his flaws later, but I think he's one of the most interesting people in history. So on Lesbos, he is raising his little daughter. It's almost like two men and a little baby. It's like these two brilliant scientists and a little girl. It's like a really charming rom-com.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

148.042

So last time out, Dan, we had you back in 18th century France and Corsica, and we were following the travails of a young man called Napoleone. Yes. How do you feel about ancient Greece? Is this a comfort area for you?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1487.695

Now it feels like a novel. Now it feels more like literary fiction. So he describes 500 species at least. He writes, I think, 10 books on animals, as well as many other things. Theophrastus is writing about plants and they're sort of chatting and comparing notes. So Sappho had been a couple of centuries before. She'd written lyric poetry. Aristotle then invented zoology.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1504.363

So Lesbos, they're both writing about the birds and the bees, but in totally different ways. It's really nice, isn't it? It's like this amazing sort of place. But sticking with Aristotle's scientific work, he gets things wrong. Mini quiz for you, Dan. Here are five myths that were believed in the ancient world. Aristotle believed four of them. Which of them did he disprove?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1523.435

Number one, women have fewer teeth than men. Number two, eels do not reproduce. They spontaneously generate teeth. Three, elephants cannot bend their knees. Four, the Earth is the centre of the universe. And five, a heavier object falls faster than a lighter one. Which of those did Aristotle disprove? I...

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1570.927

Another good novel, Elephants on Lesbos. Yeah. Yeah, remember, he's getting information from other people as well. Later.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1585.717

Oh, really? Yeah, yeah, well done. I mean, process deduction, I guess, because he's interested in animals. But yeah, he disproves that one. He believes the other four. I very much doubt if Aristotle had ever seen an elephant.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1674.452

Because he did anatomy, didn't he? He did dissection. He also did dissection.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1711.279

Yeah, he looks at flies. He really was interested in crustaceans, wasn't he? Crabs, cuttlefish, lobsters, fish. So your podcast is called No Such Thing as a Fish. Yes. He would have had such an argument with you about that. He really would. But he would have loved to hear why you thought that. Because he spent ages trying to work out what is a fish, what isn't a fish. Is lobster a fish?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1733.101

Right. He argued against other philosophers using dichotomy, didn't he? He said that they're too simple in going things with wings, things without wings. He's like, no, no, no, it's way more complex. He invented the spreadsheet, mate.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1792.065

He's on Lesbos. He's doing all this. He's having a great time. He's written stuff. And then suddenly he gets a job offer. Oh, dear. From a man called Philip of Macedon, who's in the king business. And Philip says, I've got a kid over here, a bit of a brat. Could you teach him? And the kid's name is...

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1814.885

The brat. So he's the heir to the throne. He's the son of Philip's fourth wife, Olympias. Complicated court politics, murder, poison, intrigue. Absolutely. You never know you're going to survive through adulthood. And Aristotle gets the gig and he decides to go. Why? Why?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1848.718

So you think he's a threat.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1862.592

So, Dan, what would your curriculum be if you were going to have to educate a sort of tyrant's child?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

190.492

All right, that brings us to the first segment of the podcast. This is the So What Do You Know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And Aristotle is one of the most famous Western philosophers of all time. He's one of the most famous names in all of history. Maybe you're picturing a beardy guy in a robe.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1905.996

It's very Joffrey, Game of Thrones sort of risk, isn't it? It's sort of like slightly a psychopathic teenager.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1929.902

Aristotle doesn't want to raise someone dangerous.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1965.288

Prepare for the workplace. Yeah. Because Alexander is told you don't have to be a philosopher, but please do listen to the philosophers. Which feels like a compromise. Like, OK, all right, you're not going to be a philosopher, I get it, but can you at least listen to them?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

1985.141

So rhetoric is speech-making.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

2076.4

So it's aged 48 that we get Aristotle returning to Athens. And he's lived life by this point. He has written a new constitution. He's fallen in love. He's become a new dad. He's been widowed. He's invented zoology. He's invented marine biology. He's tutored a trust fund brat and survived the most dangerous blaze in the world. And he's gone back home to Athens.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

2093.27

You'd think to take up his job at the academy, but he doesn't, right? He ends up opening a rival school, which I don't know if that's petty. No, it's not petty. He just wanted to run his own show.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

214.051

Maybe he's lecturing a bottle-blonde Alexander the Great because you've seen the movie Alexander where all the Macedonians were Irish for some strange reason. Perhaps you've encountered Aristotelian ethics through the wonderful sitcom The Good Place. You may have seen Aristotelian quotes all over Facebook and Instagram. He's very quotable.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

2141.216

Yes. So the Lyceum is arguably the first teaching university. The academy is a philosophy class. But this has got a library. This feels like it's something different. It is something different.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

230.976

But who was this philosopher who changed intellectual life in the West forever? How did he get to be so brainy and so important? And what do you do when a king orders you to tutor his frat boy son? Let's find out. Right, Professor Edith, let's start at the beginning. Where and when was Aristotle born? What was his family situation like?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

278.476

Yeah. And so what is... What does that mean? It actually means victory in battle. Yeah, because Nike is the goddess of victory. That's the one. And Marcus means war? Fight. Fight. Die. So a GP who's actually pretty hardcore.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

2916.516

63. But when we did the Pythagoras episode, you were able to sort of knock down quite a few myths, but there was still an awful lot of stuff that we really struggled to get to grips with. Yeah, yeah. Here, we've just got so much...

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

2935.891

And we've only got 31 books out of 160. Maybe one day others will show up somewhere.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

2963.328

I would get History of Animals. I would too. I read it this weekend. It's brilliant.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

2982.625

All right, time now for the Nuance Window. This is where Dan and I peripatetically promenade around the Lyceum for two minutes while Professor Edith tells us something that we need to know about Aristotle. My stopwatch is ready. You have two minutes, Edith. Take it away.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3074.452

intellectual history and then we end up with a bum joke that's what should be in his poetics about comedy right yeah

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3104.476

So what do you know now? Time now for the So What Do You Know Now? This is our quickfire quiz for Dan to see how much he has learned. We are fired. So much. I forgot about this. Last time out, Dan, you got 9.5 on Napoleon out of 10, which is really good. I mean, really good score.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3127.805

I'm going to predict three. Let's aim higher than that. Question one. What was the name of the independent Greek state where Aristotle was born? Pass. I have no idea. Do you remember the nickname for it?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3144.723

Was it the admirer, enthusiast of horses? No. The staggering, the dripping place.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3154.073

So that was his hometown. Question two. Which god did a later writer claim Aristotle was descended from? The god of which type of discipline? No, that's gone as well. Asclepius, god of medicine. Okay, question three. Plato had two nicknames for his clever Aristotle student. Can you name one of them? The brain and the walking library. Oh, very good. Well done. Question four.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3174.831

Which scientific field did Aristotle basically invent at the lagoon of Lesbos? Marine biology. It was, yeah. Question five. What name was shared by Aristotle's wife and daughter? Pissy office? Pythias. Yeah, Pythias. Very good. Pythias is correct. Yes, the snake lady. Question six. Why didn't Aristotle take over running the Athenian Academy when Plato died?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3212.187

It's Bucipus, wasn't it? Question seven. Which famous prince did Aristotle tutor?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3220.701

The brat, Alexander the brat. Question eight. Aristotle's book, The Nagamekian Ethics, was dedicated to his son. Simply put, what philosophy does it profess?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3235.418

Yeah, perfect. Was that it? Yeah, that's it. Question nine. Aristotle was 48 years old when he returned to Athens to found which pioneering school with an outreach programme and public lectures? It was called the Lyceum. It was. Very good. Question ten. Can you name one of the provisions in Aristotle's will? That all of his slaves would be free. That's right. Yeah, absolutely.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3255.762

And he also left all his stuff to Theophrastus and his furnishings to Herpilus. Eight out of ten, Dan Schreiber. Wow. You started slightly wobbly and then you got stronger. It was really worrying at the beginning, wasn't it? And then, yeah, confidence took over. Staggerer was hard to remember. That was a tricky question. Well, I mean, we've had a really interesting chat.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3273.836

Are you kind of like on board with Aristotle? Because I think we're both team Aristotle over here.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3320.785

Well, thank you so much, Dan. Thank you, Edith. And listener, for more applied philosophy, check out Edith's previous episode on Pythagoras, which was an absolute hoot. We also did an episode on medieval science. And if you want more Dan in your ears, you can scroll all the way down in the app back to 2019 to the Young Napoleon episode with Dr. Laura O'Brien. It's a really fun one.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3340.445

And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But I'd just like to say a huge thank you again to our guests. In History Corner from the University of Durham, we had the fantastic Professor Edith Hall. Thank you, Edith. Thank you.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3355.983

And in Comedy Corner, we had the brilliant Dan Schreiber. Thank you, Dan. Thanks, Greg. To you, lovely listener, join me next time as we return to the classroom for another lesson from the past. But for now, I'm off to go and rewrite Aristotle's lost volume on comedy. I think it's mostly to do with bums. I mean, how hard can it be? Bye!

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3375.506

This episode of You're Dead to Me was researched by Madeleine Bracey. It was written by Emmy Rose Price Goodfellow, Emma Neguse and me. The audio producer was Steve Hankey and our production coordinator was Ben Holland. It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

3389.537

You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

370.575

So at 13, his sister takes him in. He goes to sort of live with his uncle. Well, it's his brother-in-law. His brother-in-law, sorry. His older brother-in-law. Right. And they're in Turkey. They're in northwest Turkey. So the Greek world as we know it isn't just Athens and Sparta.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

42.791

You're about to listen to You're Dead to Me. Episodes will be released on Fridays, wherever you get your podcasts. But if you are in the UK, you can listen to the latest episodes 28 days earlier than anywhere else. First, on BBC Sounds. Hello, and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

442.899

So at 13, he lives through tragedy. His parents die. He goes to live with his sister. He's a young man. What do you think he does with his time at 13, 14?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

493.701

So you sort of had to keep them out of... We'll get to that later, actually.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

506.732

Yeah, okay, right. So put a pin in that one, come back to me. So yeah, you've gone for sports, and I think that's sort of spot on. The other thing that's interesting about him is supposedly he tries his hand at war and fails. So his dad's had the good warfare name.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

561.282

What's interesting about Aristotle, he doesn't have a kind of rebellious bad boy phase. He's not wearing a leather jacket with his tunic. Okay. It's not really a good look anyway, but, you know, he's not doing that. Instead, he's absolutely excelling everywhere. And so his brother-in-law and his sister spot the talent and go, this kid needs proper training, right? Absolutely.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

628.005

You say fed up. I think they're going, this kid, he should go places.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

63.418

I'm a public historian, author, and broadcaster, and today we are dusting off our philosophy textbooks and going back nearly 2,400 years to ancient Greece to learn all about one of history's greatest beardy chin-strokers, Aristotle. And to help us tell our virtue ethics from our empiricism, we have one top-notch teacher and one very eager pupil.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

645.519

But why is Socrates? So Aristotle rocks up to Plato's Academy in Athens. At 17. Or rather, he's a good boy, so he queues up politely and waits to be let in. But he arrives. He's there. He's going to learn from this superstar philosopher. And Plato had been taught by Socrates. So you're learning from the guy who learned from Socrates.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

673.05

Not as big a name as the other three. So Plato has a couple of nicknames for Aristotle, his new student. Do you want to guess what they are?

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

740.614

Right, okay. Oh, so he's young Sheldon almost. He's like a sort of teenage sensation. So the nicknames we've got, I think, are The Walking Library.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

750.464

Which is quite nice. And just The Brain.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

766.659

And he studies a variety of things at the academy, right? So it's not just philosophy, it's astronomy, natural science.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

82.878

In History Corner, she's Professor of Classics at Durham University and a Fellow of the British Academy. You might have heard her on Radio 4's Natalie Haynes stand-up for the classics or Radio 4's Great Lives. Maybe you've read one of her many books, including Aristotle's Way, How Ancient Wisdom Can Change Your Life, and her most recent book, Facing Down the Furies.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

879.407

So he's the ultimate postgrad because he comes at 17 and he is there 20 years and he's studying stuff he's meant to be studying and he's studying bonus courses. So he writes about lyric poetry. He writes about drama, which is obviously theatre with masks and tragedy, right? You know, sort of Medea and things like that. He writes about epic, which I guess is the Iliad, the Odyssey. Yeah.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

901.238

He writes about comedy, but we don't have it, which is devastating to me because you and I both love comedy. We don't have his book on comedy.

You're Dead to Me

Aristotle: Ancient Greece’s greatest philosopher?

99.571

And you'll know her from our episode on Mr Triangle himself, Pythagoras. It's Professor Edith Hall. Welcome back, Edith.

You're Dead to Me

Sojourner Truth (Radio Edit)

1022.203

Who's the headline act? Is it Frederick Douglass or is it Sojourner Truth?

You're Dead to Me

Sojourner Truth (Radio Edit)

1051.468

I mean, it's fascinating, isn't it? Because we can lift both of these up as heroes and as pioneers. But actually, there's a sort of fractious relationship there. So Jenna Truth does copy one of Douglas's better ideas, i.e. a book. He writes a sort of very, very famous book, sells quite a lot of copies, 4,500. And six months later, Jenna Truth sort of announces that she's going to do a book.

You're Dead to Me

Sojourner Truth (Radio Edit)

107.613

And you'll know her from this very podcast from many, many episodes, including recent highlights, Pythagoras, What a Dude, and the history of Broadway musicals. It's your Dead to Me superstar, Desiree Burch. Welcome back, Desiree. Thank you so much. That's right. You and Michelle have previously covered Harriet Tubman and Josephine Baker.

You're Dead to Me

Sojourner Truth (Radio Edit)

1073.375

What's her book called, Michelle?

You're Dead to Me

Sojourner Truth (Radio Edit)

1125.455

Yeah, put it on the front cover. You must buy this book. It's very important.

You're Dead to Me

Sojourner Truth (Radio Edit)

1134.385

So in the 1850s, with the book out, Sojourner Truth went on a book tour. Is she famous by this point? Is she renowned? Are people flocking to go and see her talk?

You're Dead to Me

Sojourner Truth (Radio Edit)

1182.241

So she's funny, Desiree, and she's 5'11". She's got this deep, strong voice.

You're Dead to Me

Sojourner Truth (Radio Edit)

1196.405

Now, I think we have to get to the most important speech that she is said to have given, which is, of course, the entire woman's speech, Michelle. And this is an iconic speech. Does she say that? What do we know about the speech? Can you give us a potted history of it?

You're Dead to Me

Sojourner Truth (Radio Edit)

123.778

Now, Harriet Tubman, obviously an abolitionist, a very famous woman in American history. What are your emotions when you hear the word Sojourner Truth?

You're Dead to Me

Sojourner Truth (Radio Edit)

1281.178

We'll talk more about it in the nuance window, I know, Michelle. But the thing that follows the speech soon after is the American Civil War. What did Sojourner Truth do in the Civil War?

You're Dead to Me

Sojourner Truth (Radio Edit)

1312.992

She met three presidents in her life, Desiree. She met Abraham Lincoln, but she also met Andrew Johnson and then Ulysses S. Grant as well. So she's, you know, she's moving in high circles. How do you think the meeting went with Abe Lincoln, Desiree? Well, have you ever...

You're Dead to Me

Sojourner Truth (Radio Edit)

1350.919

Michelle, I don't think we know how it went necessarily, but we get a sense perhaps that the person she was with felt that he was rude to her.

You're Dead to Me

Sojourner Truth (Radio Edit)

1397.947

But after the war, was she an important part of the conversations in the rebuilding of America, Michelle? Did Sojourner Truth get her due after the crisis had ended?

You're Dead to Me

Sojourner Truth (Radio Edit)

1450.014

And so the end of her life, I mean, she's already elderly in her 70s. She lived into her 80s. But at the end of her life, how did her life end?

You're Dead to Me

Sojourner Truth (Radio Edit)

1522.563

The Nuance Window! Time now for The Nuance Window. This is where Desiree and I listen in rapturous silence for two minutes while Dr Michelle preaches to us about something we need to know about Sojourner Truth. So my stopwatch is ready. Please take it away, Dr Michelle.

You're Dead to Me

Sojourner Truth (Radio Edit)

158.574

Biopic for me, but yeah, absolutely. Yeah.

You're Dead to Me

Sojourner Truth (Radio Edit)

1629.977

Thank you so much, Michelle. Desiree?

You're Dead to Me

Sojourner Truth (Radio Edit)

1665.006

That's amazing. Listener, if you want more from Desiree and Michelle, check out our episodes on Harriet Tubman and Josephine Baker, both extraordinary women. And for more abolitionist history, why not listen to our episode on Frederick Douglass? And to you, lovely listener, join me next time as we follow in the footsteps of another forgotten firebrand.

You're Dead to Me

Sojourner Truth (Radio Edit)

167.382

I'm biopic. I can't see out of my left eye. Yeah, I don't know.

You're Dead to Me

Sojourner Truth (Radio Edit)

1681.234

But for now, I'm off to go and grow my beard, cover myself in gold and convince my neighbours that I am Jesus Christ. Hello! Bye!

You're Dead to Me

Sojourner Truth (Radio Edit)

173.214

So, what do you know? This is the So What Do You Know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And I think American listeners are going to immediately have a Desiree response of, I know stuff! Hang on, do I know stuff? Do I know anything? Outside of the state, I think probably less familiar name.

You're Dead to Me

Sojourner Truth (Radio Edit)

195.735

She's perhaps most famous for the quote, Ain't I a Woman, which has been used by feminist activists for years, including by bell hooks. for her debut book title. But there are no big movie biopics. Biopics, whatever we're calling it. There are no big TV dramas. If you go on IMDb, you're not getting much back, which is quite surprising. So what was Sojourner's journey?

You're Dead to Me

Sojourner Truth (Radio Edit)

215.588

How did she go from enslavement to crusading campaigner? And was Ain't I a Woman even her line? Let's find out. Right, Dr. Michelle, we'll start at the beginning. When and where was Sojourner Truth born? I'm presuming that wasn't her name at birth.

You're Dead to Me

Sojourner Truth (Radio Edit)

272.16

Desiree, do you know what language Isabella grew up speaking?

You're Dead to Me

Sojourner Truth (Radio Edit)

287.96

Dutch is her primary first language. She's one of 12 or 10. So the parents have been enslaved, the children are enslaved, and the person who enslaves them is Colonel Johannes Hardenberg. And you said he's wealthy. What happened when he died?

You're Dead to Me

Sojourner Truth (Radio Edit)

336.388

It's a horrible, horrible childhood. And she was sold to an English speaking family, the Neelys. And she didn't she didn't speak English.

You're Dead to Me

Sojourner Truth (Radio Edit)

379.098

And then in 1810, Isabella was sold again for $175. Who is she sold to this time?

You're Dead to Me

Sojourner Truth (Radio Edit)

400.118

We get a marriage for Isabella. Who is she married to? And is it her choice? How does this work?

You're Dead to Me

Sojourner Truth (Radio Edit)

424.682

In 1826, Desiree, something important happens in Isabella's life, in many lives, actually. Do you want to guess what it is? Or maybe you know what it is. 1826 in New York's history.

You're Dead to Me

Sojourner Truth (Radio Edit)

448.706

Yeah. I mean, I love the way you figured that out. Bang on. Michelle, 4th of July, 1827, which then comes into act in 28.

You're Dead to Me

Sojourner Truth (Radio Edit)

457.948

4th of July is a good date to do things.

You're Dead to Me

Sojourner Truth (Radio Edit)

465.19

Yeah. Michelle, the state of New York abolishes slavery or what is the definition?

You're Dead to Me

Sojourner Truth (Radio Edit)

477.781

Official Cornell degree for you, Desiree.

You're Dead to Me

Sojourner Truth (Radio Edit)

48.68

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner and I'm a public historian, author and broadcaster. And today we are strapping on our sturdiest walking boots and hiking across America to learn about renowned 19th century abolitionist, orator and civil rights activist Sojourner Truth.

You're Dead to Me

Sojourner Truth (Radio Edit)

547.23

So Isabella takes things into her own hands and she goes on the run. Does she take any of her kids with her?

You're Dead to Me

Sojourner Truth (Radio Edit)

573.249

She's got her daughter Sophia with her, and then she hears that her son Peter has been taken because her husband Thomas has died, Michelle. Peter had been still in enslavement, owned by the Dumonts, and John Dumont had decided to sell him to a slave owner in Alabama. And this is hugely upsetting, and she does something extraordinary, Michelle. Can you tell us what she does in 1828?

You're Dead to Me

Sojourner Truth (Radio Edit)

653.018

The amazing thing really now is that Isabella is free. She goes off to New York and she now goes to work for white families, but wealthy families as a free woman. One family is called the Latourettes, and they're very religious, aren't they?

You're Dead to Me

Sojourner Truth (Radio Edit)

67.905

And to help us, we have two very special guests. in History Corner. She's an assistant professor in African-American history at Cornell University. Her research focuses on black and indigenous histories, including the history of racial formation and identity in America. And you might remember her from our previous episodes of this show about Harriet Tubman and Josephine Baker.

You're Dead to Me

Sojourner Truth (Radio Edit)

722.411

Yeah. Just be like, oh, my wife said, well, it's time to crack it out. Boom. But then she finds someone even more interesting. Someone comes to her door calling himself the prophet Matthias. Desiree, who do you think he claimed to be? I'll give you a clue. He's wearing gold robes. He's got a fancy beard when he shows up at her door.

You're Dead to Me

Sojourner Truth (Radio Edit)

776.487

Michelle, was Isabella convinced by this gold-dressed man, or did she wholly ghost him?

You're Dead to Me

Sojourner Truth (Radio Edit)

816.289

And Isabella is trying to preach, Michelle, but is not allowed to preach in this cult, so that's not ideal.

You're Dead to Me

Sojourner Truth (Radio Edit)

837.722

The commune collapses in 1834, Desiree, so only a year later. But Isabella stays loyal to Matthias. She lends him money. She gets him a lawyer.

You're Dead to Me

Sojourner Truth (Radio Edit)

848.531

Even his own wife hadn't joined the commune, but Isabella is still team Matthias. It's a bit of a red flag, isn't it, when the wife won't join? Well,

You're Dead to Me

Sojourner Truth (Radio Edit)

86.803

It's Dr. Michelle Crestfield. Welcome back, Michelle.

You're Dead to Me

Sojourner Truth (Radio Edit)

897.555

The end. Important thing to say here, Michelle, I think, is that after the collapse of the commune, Sojourner Truth emerges as an identity.

You're Dead to Me

Sojourner Truth (Radio Edit)

93.307

It is. We're sort of series one reunion in some ways. It's lovely. And in Comedy Corner, she needs no introduction. She's a comedian, actor, and writer. You'll have seen her all over the TV on Taskmaster, Frankie Boyle's New World Order, The Horn Section TV show, and Too Hot to Handle.

You're Dead to Me

Sojourner Truth (Radio Edit)

935.282

She's now Sojourner Truth, and soon she was living in another commune, Desiree. Such a hippie.

You're Dead to Me

Sojourner Truth (Radio Edit)

944.569

Loves a guy in a beard and robes. But this one's less problematic, Michelle. This is the Northampton Association for Education and Industry, which sounds like a kind of local government thing. What is this commune?

You're Dead to Me

Sojourner Truth (Radio Edit)

970.107

And Desiree, this is where she meets another very famous American abolitionist. Do you want to guess who? Can it please be Harriet Tubman? Because she's on the Underground Railroad.

You're Dead to Me

Sojourner Truth (Radio Edit)

991.061

Yeah, well done. Yeah, very good. Okay. And Frederick Douglass, we've done an episode on it. Listeners, if you want to check that out, it's a really good one. Douglass is a renowned orator. He's a brilliant speaker and incredibly articulate. You might assume that Douglass and Sojourner Truth get on really well, but there's sort of tension, Michelle.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1000.897

The following year, the community received its official papal permission to become a closed community, Sophie. Benedetta starts living her best life with her BFF, Spot Lamea, and of course, Splenditello the angel. Splenditello.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1014.646

But that official stamp of authority then means presumably the church is then looking more closely at what's happening because suddenly the church authorities show up and go, hang on a second. What? There's a woman preaching, claiming mystic visions. We'd better check this out because we now get an official process of interrogation, Michelle.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1058.415

Oh, so the fear here is that she is being visited by Satan, not by an angel. Yes. Gotcha. Okay. So we get the provost of Pescia, Stefano Cecchi, sort of showing up to physically examine the stigmata, the wounds, starts asking questions, Sophie. It's becoming a bit official. What do you think Bartolomeo does, Sophie, the sort of best friend who's been appointed?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1108.186

And Bartolomea says that she had to put the heart back in.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1137.205

Sophie, have you ever done that for a friend? Have you ever? Have I ever pushed a heart back in?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1153.507

Okay, so Benedetta has a very loyal friend here, and Bartolomeo is going on the record saying, yes, the heart came out, I saw it, I put it back in. So that means Benedetta passes the first interrogation, the first investigation, but there will be another, because obviously we said that woman of ill repute is a phrase that gets used.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1170.495

Why does she pass the first test, but a second one is launched, Michelle? What does she do, Benedetta, that's more provocative or claimed to do?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1199.953

That's all it needs, right? That's all you need. You just need someone. You just need a man to say, get up, come on, sort it out.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1207.537

Not dead. Let's talk about the second investigation because this time around, Sophie, it's not the local authorities who are sort of showing up to have an interrogation. The Pope has sent someone. The Pope! Mr. Pope himself. He sent a nuncio, which is an official figure, a sort of a bunch of officials showing up in 1622. They're there for several months. They're outsiders, right?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1231.763

They're not used to the community. They're not used to her. So they're a bit more interrogative. It doesn't go so well this time, Sophie. They're suspicious.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1311.857

And they find satanic signs around the general locale of the nunnery. Michelle, what is the evidence gathered against Benedetta?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1353.639

So, Michelle, is this... I'm slightly worried where we're going next, but are we going next into sort of, you know, demonic territory of, you know, naughty things?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1376.752

Sophie's back on board.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1386.974

More than that, Sophie, Benedetta is claiming that the angel Splenditello is making them do it.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1401.396

Uh-oh. Yeah. Uh-oh. Wow.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1404.738

So, Michelle, I think the question we have to ask at this point now is, you know, we can all have a laugh about these sort of things, but actually what's quite interesting is there is a sort of moment in that testimony where Bartholomew sort of says she was sort of made to lie on her back, and that brings up ideas perhaps of coercion, perhaps of one person having more power than the other,

You're Dead to Me

Benedetta Carlini (Radio Edit)

1423.969

So is this a standard typical lesbian relationship between two consenting women, or do we have something more problematic here?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1467.992

Yeah, it's definitely a problematic relationship, but it's also problematic for us because it comes to us through the official testimony of nuncio papal legates. It's slightly refracted through. So the phrasing that is used in the official interrogation is called the immodest act. So what is the outcome of this investigation, Michelle, the second investigation from the Pope's man?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1553.852

Oh, Sophie. That's a bit of a vibe shift on the episode there, isn't it?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1570.768

Time now for the nuance window. This is the part of the show where Sophie and I set down our needles and sit in silent contemplation for two minutes while Professor Michelle takes to the pulpit to preach something that we need to know about Benedetta Carlini. So my stopwatch is ready. You have two minutes. Take it away, Professor Michelle.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1768.243

Thank you, Sophie. Thank you, Professor Michelle. Listener, if after today's episode you want more dukkah in your ears, check out our episodes on Atlantis, Ramsey's The Great, Ashanti Garner and the Chevalier de Saint-Georges. What about catalogue? And if you've enjoyed hearing about the Naughty Nun, why not listen to our episode on the profane popes of the early medieval papacy?

You're Dead to Me

Benedetta Carlini (Radio Edit)

1784.65

Those guys were, they were extra. Let's just put it that way. And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But all that's left for me to do is say a huge thank you to our guests in History Corner.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1798.443

We had the magnificent Professor Michelle Sauer from the University of North Dakota. Thank you, Michelle.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1805.989

And in Comedy Corner, we had the sublime Sophie Duker. Thank you, Sophie.

You're Dead to Me

Benedetta Carlini (Radio Edit)

1812.853

Thank you very much. And to you, lovely listener, join me next time as we investigate more historical friendships, in inverted commas. But for now, I'm off to go and offer Satan some of my salami. Bye!

You're Dead to Me

Benedetta Carlini (Radio Edit)

193.042

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are whipping out our wimples and reciting our rosaries as we learn all about the scandalous 17th century nun Benedetta Carlini. And to help us, we have two very special guests.

You're Dead to Me

Benedetta Carlini (Radio Edit)

213.26

In History Corner, she's the Chester Fritz Distinguished Professor in English at the University of North Dakota. She's a specialist in medieval studies, especially medieval religion, women's literature and queer theory. And she's the author of several books. It's Professor Michelle Sauer. Welcome, Michelle.

You're Dead to Me

Benedetta Carlini (Radio Edit)

231.525

Yes, you're very lucky. Sophie's very special. And in Comedy Corner, she is an award-winning comedian, writer and actor, as well as her fabulous stand-up shows. You'll recognise her from TV's 8 Out of 10 Cats Does Countdown, Live at the Apollo, Frankie Boyle's New World Order, but of course you'll remember her from our back catalogue, including episodes on Atlantis and Ramsey's The Great.

You're Dead to Me

Benedetta Carlini (Radio Edit)

248.359

It's Sophie Duker. Welcome back, Sophie. Hey!

You're Dead to Me

Benedetta Carlini (Radio Edit)

253.704

No, no. It was meant to be positive.

You're Dead to Me

Benedetta Carlini (Radio Edit)

260.069

What about Benedetta Carlini? Is this a name that rings any bells?

You're Dead to Me

Benedetta Carlini (Radio Edit)

284.198

You didn't say that.

You're Dead to Me

Benedetta Carlini (Radio Edit)

293.481

It's fine. It's a fantastic insight into your mind there. Yeah, I think sexy nun is probably about fair, but we'll see. So what do you know? This is the So What Do You Know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject.

You're Dead to Me

Benedetta Carlini (Radio Edit)

312.344

And you are probably familiar with Nun Life, you know, from totally true documentaries like Sister Act and The Sound of Music. But you might be less familiar with a small mountain girl called Benedetta Carlini who rose to notoriety in 17th century Italy and then vanished from history until being rediscovered quite recently.

You're Dead to Me

Benedetta Carlini (Radio Edit)

331.217

But who was the real woman who, in quotes, pretended to be a mystic but was found to be a woman of ill repute? Professor Michelle, let's start with her family background. Who was Benedetta? Where was she born? When was she born? What was her family situation please?

You're Dead to Me

Benedetta Carlini (Radio Edit)

368.044

Sophie, I know you speak French. I want to test your Italian now. Do you know what Benedetta translates to in English?

You're Dead to Me

Benedetta Carlini (Radio Edit)

389.542

Okay, so yes, blessed, Michelle. Blessed, why blessed? What was the naming reason for that?

You're Dead to Me

Benedetta Carlini (Radio Edit)

417.455

What age does she start to sort of become none adjacent, Michelle?

You're Dead to Me

Benedetta Carlini (Radio Edit)

446.307

That's very Disney princess to have a bird on your shoulder singing along.

You're Dead to Me

Benedetta Carlini (Radio Edit)

458.656

I mean, they exist. Okay, so Nightingale good. Any bad animal appearances?

You're Dead to Me

Benedetta Carlini (Radio Edit)

481.472

I'm enjoying this. This is fun. Okay, so Sophie, how old do you think the Benedetta was when she was first entering the convent?

You're Dead to Me

Benedetta Carlini (Radio Edit)

503.373

That's a good guess. It's a little bit generous. It was nine.

You're Dead to Me

Benedetta Carlini (Radio Edit)

512.358

So what's the name of the community that Benedetta joined, Michelle?

You're Dead to Me

Benedetta Carlini (Radio Edit)

578.275

Yeah, they've gone to venture capitalists.

You're Dead to Me

Benedetta Carlini (Radio Edit)

584.859

OK, but what else is going on in the convent, do you think, Sophie? If we are imagining Benedetta as a modern influencer living her hashtag nun life, what kind of content are you expecting on the Gramm?

You're Dead to Me

Benedetta Carlini (Radio Edit)

608.109

Doing unboxing videos.

You're Dead to Me

Benedetta Carlini (Radio Edit)

623.458

Michelle, Sophie's painted quite a charming image there. Nun life was quite hard.

You're Dead to Me

Benedetta Carlini (Radio Edit)

651.44

We have a young nun, Benedetta. Her life is sort of on track to be fairly conventional. And then at 23, it changes, Michelle. Why 23?

You're Dead to Me

Benedetta Carlini (Radio Edit)

716.432

Another vision, Michelle, involves quite a sort of Eden-esque vibe.

You're Dead to Me

Benedetta Carlini (Radio Edit)

747.26

And she's also mountain climbing. So it is the sound of music. She's climbing every mountain. She's following every stream. She's following her rainbow. She's going to find her dream. That's beautiful.

You're Dead to Me

Benedetta Carlini (Radio Edit)

762.885

It's all very PG friendly so far, but then Benedetta's visions got quite heavy metal, Sophie. We've got quite a quick mini quiz for you, actually. Which of these visions did Benedetta not claim to have experienced? So five options. Here we go. One, she was pursued by handsome young men in iron chains with weapons. Two, Jesus ripped out her heart and she lived without a heart for three days.

You're Dead to Me

Benedetta Carlini (Radio Edit)

787.608

Three, an angel in a white robe, gold chain, long curly hair named Splenditello brought her a double-edged wand made of flowers and thorns. Four, she married Jesus. Five, an angel told her to go vegan. Which of those is not true?

You're Dead to Me

Benedetta Carlini (Radio Edit)

820.113

OK, you're rejecting Splenditello and his lovely curly hair. I think he's modelled on you, Greg. I would love to be Splenditello. I don't have the looks to pull it off. I've got the curly hair and nothing else. It's actually a trick question, Sophie. All five are true.

You're Dead to Me

Benedetta Carlini (Radio Edit)

836.232

Sorry. That's that's us being very mean there. But we thought maybe it would be fun to see if you could tell them apart. But no. Yeah, she claims all five. So she claims her heart's ripped out for three days. She claims to be going vegan, marrying Jesus. Splenditello comes to her, offers her a double wand of flowers and thorns and pursued by young men who attack her with weapons and chains.

You're Dead to Me

Benedetta Carlini (Radio Edit)

853.625

So quite a quite an array of visions here. Yeah. Michelle, Benedetta also started to have the physical signs of holy interactions, what we might call stigmata.

You're Dead to Me

Benedetta Carlini (Radio Edit)

892.85

These are huge claims to be making. I suppose the obvious question is, were there others in the convent reporting similar things, Michelle? Is she alone in this?

You're Dead to Me

Benedetta Carlini (Radio Edit)

934.441

So Benedetta's having these pretty powerful physical and visual visitations and visions. How do you think her fellow nuns were handling that at the dinner table?

You're Dead to Me

Benedetta Carlini (Radio Edit)

962.54

The thing that's intriguing to me, Michelle, is the community sort of give Benedetta a kind of friend to play with almost. It's a bit like, all right, look, you need someone to keep you company. And they give you a young woman called Bartolomea Crivelli. Is that right?

You're Dead to Me

Benedetta Carlini (Radio Edit)

981.429

Her buddy Bartolomea. And Benedetta now sort of steps it up. She starts preaching from the pulpit, which is a big no-no, isn't it? That's a man's job, right? Huge no-no. Okay. And then in 1619, the other nuns elect her the abbess of the nunnery, Michelle. So then she's not unpopular. She's not unpopular at all.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1014.998

This is 1610, the Hudson attempts this overwintering. It doesn't go well. There are, I think, saying tensions on the ship is underselling it.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1091.483

Listen, as the owner of a really nice coat, I get it. And the upshot is that Henry Hudson is left to die.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1098.085

And they're never seen again. No, I mean, fair play to him for trying. But in fairness, Stu, it's quite embarrassing that the kind of moment of your death is encapsulated in they name it after you. Like there's a sort of awkwardness there.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1121.297

Much like his crew, we have to leave Hudson behind. Sorry, Hudson.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1136.917

Various other explorers kept venturing into these very dangerous waters. Can you chart us a course through these next two centuries of attempts? What are the highlights or lowlights?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1169.147

Because they've heard about Jens Munch, presumably.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1190.117

And so fur is important because it's the warm clothing, right? It's a fabric of desirability. Is it luxurious or is it just practical?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

120.743

Lovely to have you back, Stu. Thank you. I'm clearly giddy with glee today. I know you're interested in climate change as an area of policy and discourse, but also comedy, right? Yes, for sure.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1212.006

And then you'd think people would quit looking for the Northwest Passage because we've had several disasters. But they sort of have another crack. You've got Samuel Hearn in 1770, another fur trader. He tries to locate the Northwest Passage by doing something a bit different. Do you want to guess what he tries doing, Stu? And he finds the Northwest Passage. He's looking for it.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1234.853

Wow, he's thought, hey, if it's a passage that's got edges, I'll find them. Yeah, he walks it. He's basically going to get his 10,000 steps in and then some. Whoa, for charity? Yes, he's going from the Hudson Bay all the way up to the Arctic. It's a huge amount of territory he's traversing with a team, presumably, with assistance. I mean, he's not just a one man on his own, is he?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1295.139

Can we not? Yeah, I mean, we should also mention James Knight in 1715. I mean, do you want to talk us through his... Well, he was an ex-Hudson's Bay Company employee.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1315.806

Oh, really? Wow. They proper sunk. They sunk. Yeah, that's a proper failed mission, isn't it? When your boat is underwater, you're like, OK, we might have to call this one, lads. And we found them in the 90s.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1344.089

Yes. Were they lost or was this the pan all along?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1390.754

Okay, next on the list is Your Dead to Me's previous subject, Captain James Cook. Okay. You must know the name, presumably, Stuart? Of course I've heard of Captain Cook. Yes? Good. Captain James T. Cook. Yes, and his Starship Enterprise. No, no, no, that's something I'm getting off topic. Yeah. He's going the other way. He's trying to do the Northwest Passage from the Pacific.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1410.86

So he's looking for the back door in, which is interesting. Does that work for him? No.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1454.348

So 1779, Cook dies. George Vancouver says, this is just not going to happen. We've got to stop trying this. No one gets the memo because on go the next explorations. So Cook dies, you know, he gets into a big fight with the indigenous peoples and angers them and they kill him. So that's sort of the end of that one. But then we get Sir John Barrow and he's got a plan.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1530.384

Wait for all these ships, and now they're just sitting idle.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1547.791

Pretty close to 1880. I think that's in the ballpark, isn't it? We have a kind of post-Napoleonic change of... of purpose for the Royal Navy, which means now the Navy is no longer private companies. It's now the Navy, the Admiralty. And so Barrow, he's off for his expeditions in 1818, and do they succeed?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1571.514

Right, good. Ditto. I'm getting a lot of ditto on it. It's a lot of like, we found some ice, we went home.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1582.322

I failed to pronounce the North West Passage there, so I can't really... OK, so we've got naval officers sitting around, naval gazing, but they can't get through the ice. Naval gazing!

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1593.208

How would you entertain a ship full of sailors who are sort of hunkered over in the ice? Drag sea shanty. I'm up for that.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1607.242

32 drag artists. Whittle them down.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

161.994

This is where I have a go at guessing what you, our lovely listener, will know about today's subject. And I am guessing everyone knows where the Arctic is. But if you are confused, it's the bit at the top. Think polar bears, not penguins.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1619.916

RuPaul's Northwest Passage Arctic. Vanessa, was Britain alone in organising these Arctic explorations in the kind of 1820s, 30s, you know, that sort of post-Napoleonic time?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1680.469

OK. So we've got various sort of powers and superpowers in the region. But in the 1840s, Britain... Hello, Britain, at last. Launches the most famous Arctic mission of all. In the wind? In the 1840s. So it's pretty, you know, this is kind of peak Queen Victoria era. She came to power in 1837, so we're in the Victorian era. And the Franklin expedition is the big one.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1700.758

It's the one that we're probably going to focus the rest of this episode on. Can you talk us through this Franklin chap? Who is Sir John Franklin?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1779.104

So, Stu, he sounds perfect for an Arctic exploration, but maybe not so good for running a colony.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1794.632

Sounds like the Scooby gang would have a field day with that. So he sounds like he should be top of the list for candidates being drawn up to lead this latest expedition. Is he the kind of number one go-to guy? He's not even close. Really?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1843.527

Oh, that's so wonderfully tense.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

185.791

Wow, I'm leaving. I can't learn anything better than that. OK, so there we go. In terms of the history of Arctic exploration, maybe people have heard of John Franklin's famed 19th century expedition, which recently was fictionalised in a novel, and then the TV series The Terror. God, that was great. Good telly. It also has inspired many novels, a book by national treasure Michael Palin.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1856.516

Okay, so we have an illustrious explorer, but he's had a bit of a bad time of it six years off. He was at the bottom of the list. The other guy wanted the job, was offered the job, but turned the job down out of modesty and is now second in charge. And meanwhile, they've named their ships. Was he Jared Harris in The Terror? He might be. Yeah, I think he was.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1872.947

But they've also named their ships the Terror and Erebus, Erebus being the Greek god of darkness and the underworld.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1882.056

It really is, isn't it? These are not inspiring names. I prefer Discovery. Even Matthew was sort of nice.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1903.208

So Crozier is captaining the Terror, and Franklin is captaining the Erebus and the overall mission. And off they go. And these are not ordinary naval ships. They're naval vessels.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1930.798

So these are ice breaking ships. These are steel hulled. They're no longer sail. I mean, they presumably might have sails. They have sails.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1938.782

But this is the new technology. This is Victorian engineering.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

1978.375

Just relax in the terror. Yeah. So Stephen Goldner is the provisions officer who just sort of basically just sold us 8,000 tins of meat and then goes, it's probably fine. OK, that's great.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2007.898

Yes, you can't just send a memo home saying, you know that food you sent out? Very leady. Very leady. So 129 crew on the two ships. Stu, what food would you pack for an Arctic expedition? You've got 8,000 tins to fill. What are you popping in there? Oh, I could put anything in a tin.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2048.068

Of course, of course. So we need 8,000 tins, 2,000 of which are just lipstick. Yes, perfect, thank you. And that's only one of the reasons I've never been asked to be quartermaster. I was going to say. I don't think the Navy's going to phone you up any time soon.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

205.41

I love him so. And of course, if you're a fan of giant foam skeletons, guitar solos and double denim, you'll know that Iron Maiden also have a heavy metal song called Stranger in a Strange Land about the Arctic. If you're listening from Canada, you might be familiar with the song Northwest Passage by Stan Rogers. But what is the Northwest Passage? Or what was the Northwest Passage?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2063.831

It's probably edible. Okay, fair enough.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2080.436

And to find a scurvy it's going to be citrus fruits.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2094.462

Yeah, that's an awful lot of weight in the steerage, isn't it? But these are steam-powered, well, not quite steam, but sail and steam-powered ships. So they're designed to sort of plough through the ice. They've got some power behind them.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2105.088

All right, so we've got two ships, 129 crew, two captains, one of whom was offered the job and turned it down, one of whom shouldn't have been offered the job but took it anyway. And off we go with our lovely voyage. Talk us through it.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

224.855

Why did so many explorers risk everything to find it? And how was the humble tin can both blessing and a curse? Let's find out. Right, we've called this episode Arctic Exploration, but really we're talking about the Northwest Passage. Which is what? Or which was what? I mean, is it still a thing?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

270.239

Not the official one. So this Northwest Passage is? Yes. Ah, already we're in trouble. And for sort of geography fans, when we say around North America, it's around North America but under Greenland.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

283.922

And then under Russia, so that whole kind of...

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2831.342

It's finally done by Amundsen, who of course later famously is the conqueror of the South Pole, the race to the South Pole. That's it. Northwest achieved.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2875.578

So 1497, John Cabot had tried. 2008 is the first time a ship of that size actually was able to clear those waters and go from one side to the other. God, this is history. Pointless. LAUGHTER

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

288.925

Gotcha. OK. So you're sort of rounding off. Once you go past Alaska, you're clear. You're out.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2890.045

Thanks, Joe. All right, what have we learned since then? Because since then, we've got marine archaeology and sat-nav and geostationary satellites and archaeology.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

2997.148

That's incredible. Me too. 2014, 2016, both ships found and more questions raised. Now, that's a very tragic history, but an extraordinary history. And I suppose the geopolitics were sort of underlining all of that. Science sort of played a role, parts of it, the meteorology, the study and so on.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3040.356

Time now for the nuance we know. This is the part of the show where Stu and I sit quietly in Disco Bay with our drag outfits. With our various drag outfits. Yeah, exactly. For two minutes while Professor Dr Vanessa takes the ship's wheel to tell us something that we need to know about Arctic exploration. So my stopwatch is ready. Take it away, Vanessa.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

306.761

Yeah, and thanks to the climate catastrophe, which you've been trying to mine for jokes. Yes, in a responsible way. And in fairness, it's a very good show. What's quite interesting and perhaps depressing now is you can now comfortably cruise through this Northwest Passage on a lovely luxury liner. Do you know when that was first possible? Which year that became possible?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3204.977

Let's not kill Stu. He's full of ideas. Yeah. I mean, it's extraordinary and a really important point, isn't it? The idea of a team leader is someone who has to be able to get people through the boring Tuesdays as well as through the storms and hurricanes. Yeah, really interesting.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3227.226

So what do you know now? This is our quickfire quiz for Stu to see how much he's learned.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3258.651

Jen Brister took eight pages of notes, so I think you're OK. I think I've done eight pages. LAUGHTER I've got ten questions for you. OK. You're always very good at this. OK. Question one for you, Stu. Yep. Question one. Giovanni di Verrazzano thought he had found the Northwest Passage in 1523, but where was he actually? Where was he actually? Yeah, he was 3,000 miles away in... 1523.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3300.124

Question two. Why did Henry Hudson's crew stage a mutiny against him in 1610?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3315.457

Yeah. That's correct. Question three. Which island did Captain Cook encounter when seeking the Northwest Passage and that is where he died? Hawaii. It was Hawaii. Question four. What were the names of Franklin Expedition's two ships? The Erebus or Erebus and the Terror. Yes, terrible names for ships. Question five.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3332.536

How were indigenous communities able to traverse the Northwest Passage and also later Amundsen? Sleds and mostly sleds. Yeah, and smaller boats. Small boats. Yeah, small boats with animal skins. That's right. Question six. Who was the first woman to be awarded the Royal Geographical Society's Founders Medal in 1860? That was Lady Franklin. It was Lady Jane Franklin. Question seven.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3355.193

What supplies might have contributed to the Franklin crew's eventual death? Well, sort of lead in the tins. Yes, contamination. That's right. Well done. Contamination from lead in the tins. That's right. Question eight. What was the Victory Point note?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3378.596

On King William Island. It was, and it was Franklin's death being reported. But I'll let you have that. Question nine. Which famous novelist denounced the Inuit reports of cannibalism on the Franklin Expedition? Dickens. It was Dickens. And this question turned for nine out of ten. Which Scandinavian explorer finally navigated the passage in 1906? Amundsen. Nine out of ten. Very good, Stu.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3408.706

Off the top of my head. Go on. OK. What was the original name of John Cabot?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3427.549

Yeah, there we go. Yes! Giovan Ciabotto. Ciabotto. I meant Ciabotto. 10 out of 11, Steve Gossett. Yes! 10 out of 11. The legacy continues. Well done, Stu. Thank you very much, Stu. Lovely spending time with you, sort of going through this tricky bit of history. But, I mean, it's fascinating, right? I've enjoyed it enormously.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3446.566

If you want more of that, you can check out our episodes with Stu on Blackbeard and ancient medicine, which are sort of medical and maritime too. For more of Dr Vanessa, or Professor Dr Vanessa... Choose our Victorian bodybuilding episode, which is also about masculinity in the 19th century. Sort of similar themes.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3461.14

And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sounds to hear these episodes first, because they come out a month earlier on BBC Sounds. Switch on your notifications, otherwise you won't be told. I'd just like to say a huge thank you to our guests in History Corner.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3475.57

We had the incredible Dr Vanessa Heggy from the University of Birmingham. Thank you, Vanessa.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3481.394

And in Comedy Corner, we have the stupendous Stu Goldsmith. Thank you, Stu.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3489.417

And to you, lovely listener, join me next time as we navigate another treacherous historical subject. But for now, I'm off to go and bin all my tin food and scrub my kettle.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3504.019

This episode of You're Dead to Me was researched by Matt Ryan. It was written by Matt Ryan, Emmy Rose Price Goodfellow and me. The audio producer was Steve Hankey and our production coordinator was Ben Hollands. It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Nagoose and our executive editor was James Cook.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

3517.487

You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

359.548

Yes. Given how inhospitable this environment would have been, why do you think European explorers were so keen to go and stick their flag up this back passage?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

396.207

I think you did well with the first answer. The second answer started to veer away a bit. I mean, power and war is pretty good.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

442.057

But you're right, money and power and war and the insatiable desire for Chinese porcelain were driving this. And porn as well, that drives everything. Was there any sex in the Arctic? I don't know if there was any sex. Well, maybe.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

459.588

We should say, I mean, it wasn't just Europeans who were exploring Northwest Passage. As always on this show, we have to sort of say it's not just European explorers. I mean, indigenous peoples were already sort of exploring this. They'd already discovered it by being born there. They were living there. Yeah, definitely.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

498.487

Yeah, well, we've done an episode on the Vikings getting to Newfoundland, you know, a thousand years ago. So I guess those interactions continued.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

50.046

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are packing our tins of preserved beef, donning our thermal undies and sailing off in search of the Northwest Passage. And joining me on the good ship, You're Dead to Me, are two very special shipmates.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

515.561

So it's not big, long ships, not huge, not massive battleships. We're talking about a little coracle, a little canoe. Yeah.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

546.313

Blimey. That is absolutely taking my breath away. I'm just looking at the map going, Scotland's not even on the map.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

560.224

So there's a motorway service station in between.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

566.95

OK, so we've done some foreshadowing there because we've talked about the 12th century and indigenous communities. But we need to get on to the Europeans because they're the ones with all the sort of drama and danger. The first European voyager was in 1497. And like you, Stu, he had a Bristol connection. You're a Bristolian now by choice.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

586.609

Do you know who this explorer might have been? 1497, set off from Bristol. Blackbeard.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

601.435

Oh, God. Yeah, OK. Yeah, it was Cabot, who had a variety of names. We call him John Cabot in England, but he was Zwan Caboto because he was Venetian, which is a different dialect. Was he really? I didn't know that. He was a Venetian.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

616.63

Zouane Chabotot. Zouane Chabotot. But also, he was also... Zouane Chabotot. He was also Jean Cabot, to the French, and he was John Cabot.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

635.354

Yeah, that's good. So 1497, Vanessa, he sets off from Bristol. Why? And in what ship? Because he's a Venetian. What's he doing in Bristol?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

683.068

Much colder than we were expecting, am I to say? Yeah. So John Cabot, or Zwan Cabot, was sent off by Henry VII, Henry Tudor, father of Henry VIII, from Bristol, returns to Bristol and says, I found China, job done. There are more expeditions and they're not, they don't go that well, do they, Vanessa?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

69.651

In History Corner, she's Associate Professor in the History of Science and Medicine at the University of Birmingham's Department of Applied Health Science. What a title. You may have read her long-running science column in The Guardian newspaper or her recent book, Higher and Colder, on the history of extreme exploration.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

743.877

Yeah, I mean, there's definitely going to be... You don't want to come back and say, no, it's definitely not China. You probably want to say, could be China. Your Majesty, we've completely failed. You're not going to say that, are you?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

752.304

Yeah. That money you gave me, wasted. It's gone. Threw it in the sea. I've cut my head off in advance. So you're right. So Giovanni de Verrazzano... thinks he's found the Northwest Passage, he's actually found North Carolina, which actually, of course, is where Blackbeard operated. Ah, of course. We're linking back to your earlier episode. So that was 1523.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

770.077

Then we get more explorers heading off to chart Newfoundland's coastline, and then they're competing in this sort of 16th century game show, which we might sort of loosely call Claim That Arctic. It is everyone's racing. So let's talk about Martin Frobisher, because he's next up in the list. So who is Frobisher? He's another Englishman?

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

83.918

And you will definitely remember her from our episode on Victorian bodybuilding. It's Dr Vanessa Heggie. Welcome back, Vanessa.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

849.864

Yeah, I mean, it's a very sad reminder of the sort of cost of these explorations, obviously going out and the danger of it. But also if you're sort of kidnapping people and bringing them back home, that's also pretty cruel.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

858.368

If people want to know more about that, we did an episode with Professor Caroline Dodds-Pennock on the Columbian Exchange, which talks about those sort of movements of people and goods and ideas. But let's get back to slightly cheerier notes. Frobisher found some treasures.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

894.099

Yes, but I think he was very keen on going, it's definitely gold, it's gold, gold, gold. Our next contestant is a man called Henry Hudson. Heard the name? No. Okay, that's fair. He's quite famous.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

91.202

And in Comedy Corner, he's a sensational stand-up and the host of the brilliant The Comedian's Comedian podcast, which I love. You may have seen him on BBC Live at the Apollo recently or on Conan O'Brien's show, but you will definitely remember him from our back catalogue, including episodes on the history of fandom and Blackbeard the Pirate. It's Stu Goldsmith. Welcome back, Stu.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

916.907

You're not far off there, actually, Stu. So he's got a bay named after him, he's got a river named after him. I was going to say, why do you think he went down in history? But falling in a river is a pretty good guess.

You're Dead to Me

Arctic Exploration: the fatal quest for the Northwest Passage

936.5

Methane, permafrost, I've got nothing. I enjoyed the attempt. Vanessa, why is this guy so famous? He gets a bay named after him, he gets a river named after him. That must mean he did something heroic, no?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

103.52

And you'll know her from this very podcast from many, many episodes, including recent highlights, Pythagoras, What a Dude, and the history of Broadway musicals. It's your Dead to Me superstar, Desiree Burch. Welcome back, Desiree.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1033.142

Oh, man. So Isabella takes things into her own hands and she goes on the run. Does she take any of her kids with her?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1080.842

And does she escape or does she get tracked down?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1114.435

She's been taken in by the Van Wagenens. She's got her daughter Sophia with her. And then she hears that her son Peter has been taken because her husband Thomas has died, Michelle. Peter had been still in enslavement, owned by the Dumonts, and John Dumont had decided to sell him to a slave owner in Alabama. And this is hugely upsetting. And she does something extraordinary, Michelle.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1135.697

Can you tell us what she does in 1828?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1252.481

The amazing thing really now is that Isabella is free. She's been assisted by the Van Wageners. She's still called Isabella Van Wagenen, but she goes off to New York and she now goes to work for white families, but wealthy families as a free woman. And one family is called the Latourettes. They sound quite French to me, Michelle. Is she speaking French now?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1277.513

And they're very religious, aren't they?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

133.644

Desiree, you and Michelle have previously covered Harriet Tubman and Josephine Baker. Now, Harriet Tubman, obviously an abolitionist, a very famous woman in American history. Are you excited to be back for more abolitionist history? What are your emotions when you hear the word Sojourner Truth?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1381.595

Boom. But then she finds someone even more interesting. Someone comes to her door calling himself the prophet Matthias. Desiree, who do you think he claimed to be? I'll give you a clue. He's wearing gold robes. He's got a fancy beard when he shows up at her door.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1536.919

Yeah. And we've done a cult already with Pythagoras. So this is our second cult together, Desiree.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1545.367

And Isabella is trying to preach, Michelle, but is not allowed to preach in this cult. So that's not ideal.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1567.202

Yeah. And the commune collapses in 1834, Desiree. So only a year later. But Isabella stays loyal to Matthias. She lends him money. She gets him a lawyer.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1578.775

Even his own wife hadn't joined the commune. But Isabella is still team Matthias. It's a bit of a red flag, isn't it, when the wife won't join? But.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1710.72

Important thing to say here, Michelle, I think, is that after the collapse of the commune, Sojourner Truth emerges as an identity. The woman we, you know, the name of the episode, the woman people have heard of, the person Desiree coloured in at school. How does Isabella Van Wagenen become Sojourner Truth?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1768.212

Oh, she believes the world's going to end.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1791.159

Not going to cut it. She'd gone from Isabella Bumfrey to Isabella Waggonen. She's now Sojourner Truth. And soon she was living in another commune, Desiree.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1804.267

He loves a guy in a beard and robes. But this one's less problematic, Michelle. This is the Northampton Association for Education and Industry, which sounds like a kind of local government thing. What is this commune?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1852.85

And Desiree, this is where she meets another very famous American abolitionist. Do you want to guess who? Can it please be Harriet Tubman?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

187.937

It sounds like an eye condition. I'm biopic. I can't see out of my left eye. Yeah, I don't know.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1873.862

Yeah, well done. Yeah, very good.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1875.643

Yeah, yeah. I mean, Harriet was probably busy sort of, you know... It was busy shooting people.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1892.211

Exactly. And Frederick Douglass, we've done an episode on it. Listeners, if you want to check that out, it's a really good one. Douglass is a renowned orator. He's a brilliant speaker and incredibly articulate. You might assume that Douglass and Sojourner Truth get on really well, but There's sort of tension, Michelle.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1921.882

Who's the headline act? Is it Frederick Douglass or is it Sojourner Truth?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

195.171

So what do you know? This is the So What Do You Know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And I think American listeners are going to immediately have a Desiree response of, I know stuff! Hang on, do I know stuff? Do I know anything? Perhaps it's a childhood memory coming back.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

1984.32

I mean, it's fascinating, isn't it? Because we can lift both of these up as heroes and as pioneers. But actually, there's a sort of fractious relationship there. So Jenna Truth does copy one of Douglas's better ideas, i.e. a book. He writes a sort of very, very famous book, sells quite a lot of copies, 4,500. And six months later, Jenna Truth sort of announces that she's going to do a book.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2006.427

What's her book called, Michelle?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2058.51

Yeah, put it on the front cover. You must buy this book. It's very important. Like, seriously, you guys, buy this book. So it's published in 1850. So it takes four or five years or so to actually get this book down. And it's an autobiography with two voices, which is a slightly unusual idea. But there is a PR strategy in that The Journal of Truth quite cleverly gets a celebrity endorsement.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2077.503

She gets the endorsement of Harriet Beecher Stowe. Do you know Harriet Beecher Stowe, Desiree? Uncle Tom's Cabin?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2084.109

Yeah, okay. Huge, huge bestseller. Another abolitionist. By getting an endorsement, that sells copies. And later, Michelle Stowe publishes an article about meeting Sojourner Truth. It's an interesting document, but it's tricky.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

217.245

Outside of the States, I think probably less familiar name. She's perhaps most famous for the quote, Ain't I a Woman, which has been used by feminist activists for years, including by Bell Hooks for her debut book title. But there are no big movie biopics, biopics, whatever we're calling it. There are no big TV dramas. If you go on IMDb, you're not getting much back, which is quite surprising.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2178.7

Yeah, you want that endorsement, you just have to sort of cringe your way through it, I guess. In 1852, just the year before that kind of big interview with Harriet Beecher Stowe, or that big moment with Harriet Beecher Stowe, in 1852, Sojourner and Frederick Douglass clashed again

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2193.37

Because Douglass was starting to sort of suggest that taking up arms might be necessary for the emancipation of African-Americans and that perhaps God had abandoned them. And Sojourner manages to shut him up in public in front of an audience by saying, Frederick, is God dead? What a line.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2237.688

He's literally silenced by this line, Desiree. Can you imagine her with hecklers in a comedy club? So Jonah, truth, live and loud.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2274.785

So in the 1850s, with the book out, Sojourner Truth went on a book tour. Her name means traveling, so she's living up to her name. She's traveling. And she's fighting for women's rights as well as an abolitionist, which is a really important distinction. And she meets Michelle William Lloyd Garrison. She meets a British MP, George Thompson.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2293.349

So there's an international movement here, which is interesting. Is she famous by this point? Is she renowned? Are people flocking to go and see her talk?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2353.9

So she's funny, Desiree. And she's 5'11". She's got this deep, strong voice.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

238.351

So what was Sojourner's journey? How did she go from enslavement to crusading campaigner? And was Ain't I a Woman even her line? Let's find out. Right, Dr. Michelle, we'll start at the beginning. When and where was Sojourner Truth born? And I'm presuming that wasn't her name at birth.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2413.114

There we go. Now, I think we have to get to the most important speech that she is said to have given, which is, of course, the entire woman speech, Michelle. And this is an iconic speech. Does she say that? What do we know about the speech? Can you give us a potted history of it?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2567.209

We'll talk more about it in the nuance window. I know, Michelle. But the thing that follows the speech soon after is the American Civil War. What did Sojourner Truth do in the Civil War?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2631.628

She met three presidents in her life, Desiree. She met Abraham Lincoln, but she also met Andrew Johnson and then Ulysses S. Grant as well. So she's, you know, she's moving in high circles. How do you think the meeting went with Abe Lincoln, Desiree? Well, have you ever...

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2670.379

So you think she played Sojourner Truth or Dare with the president? She was, you know, a bit of a risky game. Yes, and he was like, dare. Dare, yeah. Michelle, I don't think we know how it went necessarily, but we get a sense perhaps that the person she was with felt that he was rude to her.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2714.727

Yeah, I suppose for Sojourner Truth, her saying he was amenable to me, that works in her favor. So maybe she wants that meeting to be well received.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2750.78

So like Douglas, Sojourner Truth used photography very carefully, very cleverly to sort of disseminate her image. But after the war, was she an important part of the conversations in the rebuilding of America, Michelle? Did Sojourner Truth get her due after the crisis had ended?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2826.075

When you say land for African-Americans, are you saying that she wanted to create like reservations almost for people who'd been freed?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2895.094

And so the end of her life, I mean, she's already elderly in her 70s. She lived into her 80s. But at the end of her life, how did her life end?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

2968.457

But sometimes the greats need a rival to push them further on. Of course. So 1883, 86 years old. It's a long, long, extraordinary life. It's been quite the sojourn we've had, Desiree. Any final thoughts before we do our nuance window?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3031.857

Beautifully summarized. And also, I just love the fact that she had a Dutch accent. You just don't imagine that, right?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3056.673

Time now for the nuance window. This is where Desiree and I listen in rapturous silence for two minutes while Dr. Michelle preaches to us about something we need to know about Sojourner Truth. So my stopwatch is ready. Please take it away, Dr. Michelle.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3157.657

Thank you so much, Michelle. Desiree?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3193.455

That's amazing. And also, I think sometimes we don't always know what people said exactly in speeches, but you can sort of see the effect they had on people. It's almost like you can see where the ripples are in the water and the pebble is gone, but the ripples are still there.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3207.483

And that's quite nice that with Sojourner Truth, maybe she didn't say, ain't I a woman, but she definitely communicated that concept to people. So it's still amazing. So what do you know now? So time now for our quiz. This is the So What Do You Know Now? This is for Desiree to see how much she has learned. And Desiree, I mean, at this point, we know that full marks is guaranteed with you.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3249.067

I mean, I'm sure you'll get most of them, but let's see if 10 is doable.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3258.251

Fine. We'll start with an easy one. Question one. What was Sojourner Truth's first language? Oh, Dutch. Very good. Okay. Question two. What did Sojourner Truth do when a cult leader, Matthias, appeared at her door saying he was Jesus Christ?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3289.833

Question three. What was the name of Sojourner's son whose freedom she successfully sued for in a court of law?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3298.658

Question four. Why did she adopt the name Sojourner Truth? What did it mean to her?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3308.326

Very good. Question five. Which fellow abolitionist and longtime rival did Truth first meet at the Northampton Association?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3324.931

Question six. What is unusual about Truth's autobiography?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3337.856

And it's Olive Gilbert. Question seven. What famous line from a speech given by Sojourner Truth at the Ohio Women's Rights Convention might have been misquoted?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3354.964

And maybe with a Dutch accent too.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3357.065

So there we go. Question eight. What technology did Sojourner Truth use to disseminate her image?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3368.275

Question nine. What was notable about Sojourner Truth's appearance and physicality?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3382.372

And question 10. This for a perfect 10. So Jenna Truth met three U.S. presidents. Can you name two of them?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3393.657

Perfect. Well done. Desiree Birch, never in doubt, 10 out of 10. Well done.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3417.703

Listener, if you want more from Desiree and Michelle, check out our episodes on Harriet Tubman and Josephine Baker, both extraordinary women. And for more abolitionist history, why not listen to our episode on Frederick Douglass, who was a very important and interesting man.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3440.342

Exactly that. I'm a big Douglas fan. But yes, I think there was genuine rivalry and respect. I think they're in a relationship with Sojourner Truth. But anyway, listen to that one too. And to you, lovely listener, join me next time as we follow in the footsteps of another forgotten firebrand.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3455.956

But for now, I'm off to go and grow my beard, cover myself in gold and convince my neighbours that I am Jesus Christ. Hello. Bye. This episode of You're Dead to Me was researched by Madeleine Bracey. It was written by Madeleine Bracey, Emmy Rose Price Goodfellow, Emma Neguse and me. The audio producer was Steve Hankey and our production coordinator was Ben Hollands.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

3476.447

It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook. You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

388.9

That's fascinating. Desiree, do you know what language Isabella grew up speaking?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

408.954

Dutch as her primary first language. And you said 10 siblings, possibly 11 siblings. We're not sure. She's one of 12 or 10. So the parents have been enslaved. The children are enslaved. And the person who enslaves them is Colonel Johannes Hardenberg. And you said he's wealthy. What happened when he died?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

44.585

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner and I'm a public historian, author and broadcaster. And today we are strapping on our sturdiest walking boots and hiking across America to learn about renowned 19th century abolitionist, orator and civil rights activist Sojourner Truth.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

530.273

It's a horrible, horrible childhood. And she was sold to an English speaking family, the Neelys. And she didn't she didn't speak English. Were they dicks about it, though? I imagine they weren't hugely supportive being a slave owning family.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

63.815

And to help us, we have two very special guests. in History Corner. She's an assistant professor in African-American history at Cornell University. Her research focuses on black and indigenous histories, including the history of racial formation and identity in America. And you might remember her from our previous episodes of this show about Harriet Tubman and Josephine Baker.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

635.262

And then in 1810, Isabella was sold again for $175. Who is she sold to this time?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

699.035

So, I mean, that's a strange dynamic, I suppose, that she's there for nearly 18 years and she's fond of the man who's enslaved her. That's complicated stuff, Desiree, isn't it?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

748.517

Who is she married to? And is it her choice? How does this work?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

805.638

In 1826, Desiree, something important happens in Isabella's life, in many lives, actually. Do you want to guess what it is? Or maybe you know what it is. 1826 in New York's history.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

82.705

It's Dr. Michelle Crestfield. Welcome back, Michelle.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

843.93

So yeah, yeah. Bang on. Michelle, 4th of July, 1827, which then comes into act in 28th.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

860.596

Michelle, this state of New York abolishes slavery or what is the definition?

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

873.005

Official Cornell degree for you, Desiree.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

89.229

It is. We're sort of series one reunion in some ways. It's lovely. And in Comedy Corner, she needs no introduction. She's a comedian, actor, and writer. You'll have seen her all over the TV on Taskmaster, Frankie Boyle's New World Order, The Horn Section TV show, and Too Hot to Handle.

You're Dead to Me

Sojourner Truth: American abolitionist, suffragist, preacher

939.795

That's heartbreaking. And also, presumably that means the children could be taken away from her still.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1033.292

That's why they're extinct.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1051.223

So it's a protein-rich diet. You can see why they need those toilets plumbed in. So what other non-meaty foods were going into the lunchtime meals?

You're Dead to Me

The Indus Civilisation (Radio Edit)

1072.797

We've also got a building called the Granary. I hear, do you know what the granary was for? This is going to be one of your annoying ones.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1099.906

Du bist bei uns. Das Granary war nicht ein Granary, Danica?

You're Dead to Me

The Indus Civilisation (Radio Edit)

115.059

He's very busy and you'll definitely remember him from our Julius Caesar episode. It's Ahir Shah.

You're Dead to Me

The Indus Civilisation (Radio Edit)

126.101

Heute gehen wir weit zurück in das alte Vergangenheit, also weit über Julius Caesar, um ein Thema mit viel niedrigerer Namenwahrnehmung zu erforschen. Was weißt du über die Indische Zivilisation, Ahir?

You're Dead to Me

The Indus Civilisation (Radio Edit)

1272.084

Eine Bohnenhaus. Ja, ja. Das ist, wo du Bohnen nachdem Menschen gestorben sind, aber sie alle zusammengefasst werden. Richtig. Okay, aber in Bezug auf Beweise von Stratifikationen, es könnte Beweise von Rich und Poch sein, oder?

You're Dead to Me

The Indus Civilisation (Radio Edit)

1330.02

Die Indische Zivilisation. Eine der großen Fragen ist, warum endet sie? Und es endet vor ungefähr 4.000 Jahren. Und hier haben wir eine Mini-Quiz für dich, also habe ich vier Optionen. Welche dieser vier hat nicht als Grund für den Ende der Indischen Zivilisation vorgeschlagen? Nicht vorgeschlagen, verstehe. Nicht vorgeschlagen. Also der erste. Invasion und militärische Zerstörung.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1349.544

Der zweite wäre wirtschaftliche Schäden und Klimawandel. Der dritte wird ein Meteor-Impakt sein. Und der vierte wird eine erhöhte Population sein, die zu Ressourcenexhaustion führt. Welcher von diesen wird nicht als Grund von Archaeologen erwähnt?

You're Dead to Me

The Indus Civilisation (Radio Edit)

1383.733

I like your answer. I prefer it to the actual answer. The actual answer is meteor because I made that up. It's a double trick. I double, double, double. Yeah. But Danica, these are all reasons that have been given. Do we have any sense of which of them might be more true or they are equally true? How are we making these assumptions? Yes.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1441.823

Und dann wirst du dich wirklich dumm fühlen, Greg. Es war die Revenge der Dinosaurier. Der Meteor hat sie rausgezogen. Sie kamen zurück und sagten, wir haben eine Wendung auf den Indus.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1462.01

Danica, was passiert mit den Szenen in den 1920er-Jahren? Sind sie exkubiert? Wer exkubiert sie? Was ist dann das Prozess?

You're Dead to Me

The Indus Civilisation (Radio Edit)

1571.884

This is where Ahir and I put down our trowels and we listen to Danica for two uninterrupted minutes while she tells us something we need to know. So my stopwatch is ready and if you are ready, Dr. Danica, please take it away.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1712.793

Alright, well thank you so much, Ahir. Thank you so much, Dr. Danica. And listener, if you want to explore more ancient archaeological mysteries, then why not listen to our episodes on China's Terracotta Army or Stone Age Çatalhöyük in Turkey. Or if South Asian history is your thing, then check out our episode on the Mughal Empire. You'll find them all and more on BBC Sounds.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1730.678

And remember, if you've enjoyed this podcast, please leave a review, share the show with friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But it's now time for me to say a huge thank you to our guests in History Corner. We have the amazing Dr. Danica Parik from the University of Cambridge. Thank you, Danica.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1747.423

Und in Comedy Corner hatten wir den tollen Ahir Shah. Danke, Ahir. Absolut mein Vergnügen. Es ist immer so ein Vergnügen, das zu machen. So interessant. Danke. Und zu Ihnen, liebe Zuschauer, folgt mir nächste Woche, als wir mehr faszinierende historische Nuggets entdecken. Aber für jetzt bin ich weg und recordiere mein Archäologie-inspirtes Heavy-Metal-Album Mound of the Dead.

You're Dead to Me

The Indus Civilisation (Radio Edit)

176.937

Great! Well, that brings us to the first segment of the podcast, the So What Do You Know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And I'll bet you've heard of Troy, the subject of Homer's epic poem, The Iliad, as well as the slightly dodgy film with Brad Pitt.

You're Dead to Me

The Indus Civilisation (Radio Edit)

1797.737

I am your spy expert.

You're Dead to Me

The Indus Civilisation (Radio Edit)

197.586

And we've previously regaled you about the glories of Ramesses the Great and ancient Egypt and the New Kingdom and all that. But these mighty cities came centuries after the Indus people were doing their thing. And yet, the Indus civilization doesn't get anywhere near as much coverage in modern films or books or television or whatever.

You're Dead to Me

The Indus Civilisation (Radio Edit)

214.399

Maybe you've seen the Hindi-language film set in the city of Mohenjo-Daro. It stars Bollywood-Heartthrob Hrithik Roshan. Or maybe you've read Vineet Bajpai's trilogy of thriller novels. But for most of you, I reckon you're coming into this episode feeling pretty blank. So, wer waren die ältesten Menschen der Inder und was hatten sie zu essen? Und wo gehen sie in die Toilette?

You're Dead to Me

The Indus Civilisation (Radio Edit)

232.433

Und wie wissen wir alles über sie? Und was hat das mit Unikornen zu tun? Lass uns herausfinden. Danica, lass uns mit den Grundlagen anfangen. Wann und wo war die Inder-Zivilisation und wie lange her sind wir zurück?

You're Dead to Me

The Indus Civilisation (Radio Edit)

320.928

Harappa is the modern name. What does Mohenjo-Daro mean?

You're Dead to Me

The Indus Civilisation (Radio Edit)

329.156

Sick! Ahia, what's your favourite heavy metal band?

You're Dead to Me

The Indus Civilisation (Radio Edit)

365.029

Ich meine, ich denke, was wir tun können, ist, euch ein aeriales Foto der größten Stadt Mahenjo-Daro zu zeigen. Oh wow, okay. Also auf der linken Seite haben wir unsere aeriale Sicht und dann auf der rechten Seite haben wir eine Reconstruktion, wie die Stadt aussehen könnte, als die Menschen in ihr lebten.

You're Dead to Me

The Indus Civilisation (Radio Edit)

418.544

Excellent. GCSE Geography flooding back into my brain there.

You're Dead to Me

The Indus Civilisation (Radio Edit)

472.968

Seals balancing beach balls on their noses. What is a seal in an archaeological sense? It's a kiss from a rose seal.

You're Dead to Me

The Indus Civilisation (Radio Edit)

52.875

Hallo und willkommen zu You're Dead to Me, dem Radio 4 Comedy-Podcast, der die Geschichte ernst nimmt. Mein Name ist Greg Jenner, ich bin ein öffentlicher Historiker, Autor und Broadcaster. Und heute gehen wir zurück in die Bronze-Zeit und fahren den Indus-River, um alles über die Archäologie von Toiletten, Terrakotta, Ornithenien und sogar Unikornen zu lernen. Ja, es ist die Indus-Zivilisation.

You're Dead to Me

The Indus Civilisation (Radio Edit)

547.984

So, let's talk about daily life in the city. And I want to get down and dirty, I hear, and I want to talk to you about the toilet situation. In fact, I'm going to ask you, having been to Pompeii, what do you think the toilet situation would have been comparably 2,000 years earlier in South Asia?

You're Dead to Me

The Indus Civilisation (Radio Edit)

569.909

Vielleicht etwas wie das. Das ist ein sehr guter Wunsch. Danica, ich denke, wir können... Ich werde es hier sagen. Die Indischen waren ziemlich beeindruckend, wenn es um Sanitätsinfrastruktur ging. Sie sind Turdnerde. Sind wir nicht alle hier?

You're Dead to Me

The Indus Civilisation (Radio Edit)

631.12

Ich bin schon beeindruckt von Indien. Ich meine, die Größe der Stadt, wir sprechen zumindest vor 4.000 Jahren. Im gleichen Zeitpunkt in der Geschichte haben wir ältere Ägypten, wir haben ältere Mesopotamien. Also ist da Interkonektivität nicht nur zwischen den Indiener Städten, sondern auch außerhalb ihres Empires, um es modern zu nennen?

You're Dead to Me

The Indus Civilisation (Radio Edit)

679.415

Meluha, that's nice. So there's a lot of animal imagery, and yet the Indus is sometimes dubbed the faceless civilization. Do you want to guess why?

You're Dead to Me

The Indus Civilisation (Radio Edit)

699.767

That's a sensible guess, but I don't think that's quite right. So Daniko, why is faceless used as an adjective?

You're Dead to Me

The Indus Civilisation (Radio Edit)

72.502

Und um uns diese gerettete Geschichte zu entdecken, haben wir zwei sehr besondere Gäste mit uns. In History slash Archaeology Corner. She's a postdoctoral fellow at University of Cambridge Museums and postdoctoral research associate at Pembroke College, Cambridge. Her research includes the archaeology of the Indus Civilization of South Asia, as well as empire and race in museum collections.

You're Dead to Me

The Indus Civilisation (Radio Edit)

756.495

They don't sound very faceless to me.

You're Dead to Me

The Indus Civilisation (Radio Edit)

758.876

Why are they called faceless? We don't have the specificity of individual names and identities, perhaps. But there are these two very famous figurines. One's called the Priest King. He sounds fancy. And the other is called Dancing Girl. Feels like there's a bit more presumption there. But Danica, why are they called Dancing Girl and Priest King? And do we think that's valid?

You're Dead to Me

The Indus Civilisation (Radio Edit)

778.849

And where are these figurines now?

You're Dead to Me

The Indus Civilisation (Radio Edit)

896.425

Ja, ich meine, die Geschichte ist politisch. Wir haben über die faceless Zivilisation gesprochen, von der wir dann entschieden haben, nein, das ist nicht fair. Ich meine, Mohenjo-Daro bedeutet Mound of the Dead. Das bedeutet, dass sie vermutlich tot sind, oder? Es müssen menschliche Erinnerungen sein, die Archäologen ausgesucht haben. Was wissen wir über die Menschen durch ihre Erinnerungen?

You're Dead to Me

The Indus Civilisation (Radio Edit)

90.372

And she's a founding member of the European Society of Black and Allied Archaeologists. It's Dr. Danica Parik. Welcome, Danica.

You're Dead to Me

The Indus Civilisation (Radio Edit)

922.116

Aber wir haben einige Böden und natürlich archäologische, moderne wissenschaftliche Techniken, die ziemlich spannend sind. Strontiumanalysen, Isotopanalysen und solche Sachen. Und du kannst herausfinden, was die Leute gegessen haben und so weiter. Warte, was? Oh ja, lange nachdem du weggegangen bist, werde ich wissen, was du für den Mittagessen hattest.

You're Dead to Me

The Indus Civilisation (Radio Edit)

961.694

In terms of the science available now, we can tell where people grew up from the soil quality and water quality, I think. There's all sorts of things, aren't there, Danica?

You're Dead to Me

The Indus Civilisation (Radio Edit)

99.496

I'm excited to dig in. Oh, an archaeology pun. Well done. Congratulations. Secret handshake for you. And in Comedy Corner, he's a stand-up comedian, writer and podcast regular. You might have seen his stand-up special Dots on HBO Max or heard him on Radio 4 or seen him on Mock the Week or Have Got News for You or Live at the Apollo or MASH Report.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1000.43

Yes. So Henri is dead. The king is dead. Long live the king. Her son is now king.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1006.232

Right. So Mary, queen of Scots, is now queen of France. Francois is king of France, but he's only 15. Shappi, you've got a teenage boy.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1019.422

How would he do at ruling the country?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1028.809

So what level of power does the king have compared to the mother, Catherine de' Medici, who's now really running the show?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1046.4

So the Guises, G-U-I-S-E-S.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1103.254

There's also another family who are jockeying at court. So we've got the Guises family. So that's Mary's uncles. They're pretty scary blokes. There's also the Bourbons who make delicious biscuits. They're led by Antoine, king of Navarre, which is Spain or sort of near Spain, Navarre.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1129.85

So Antoine and his brother Louis Condé. So you've got the Bourbon family, you've got the Guises family. They're on opposite sides politically and religion-wise because the Bourbons are the Protestants and the Guises are Catholics.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1147.858

Then more bad news. Francois II suddenly becomes very unwelshappy.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

115.055

And we even come up with our own criminal nicknames. Cunning Crone. Luce the Noose. Luta Lucy and Robber Roz.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1151.92

And Catherine, having seen her or seen many people in her life die, knows what's about to happen.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1158.023

Yeah. Yeah. And she has to pull the emergency sort of parachute button and prepare the next one. She's sort of saying goodbye to Wild King and trying to prep the next one.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1166.871

He's nine years old.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1170.435

Well, OK, so your 15-year-old, your teenage boy would plan town centres. What would a nine-year-old do? Ask his mummy. Exactly. OK.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1184.789

Which son is this then?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1196.281

We do now have the French wars of religion.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1199.439

And these are incredibly serious. And we are a comedy show, so we can't be too flippant here. But they kill over two million people.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1210.245

Three decades short, but millions of people die in these wars of religion between Catholic factions and Huguenots. And Catherine's... sort of reign. I mean, she doesn't reign, but she's ruling.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1222.977

We have to now put this into the context of the time, right? So we have this horrible series of wars that last for 30 years, but they don't initially last for 30 years. They last for one year initially, and then there's a peace treaty.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

124.978

Our guest detective team is expanding too. This season, we're joined by broadcasters, barristers, authors, activists, a psychologist and even an artist.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1251.904

Yeah, it's expensive, it's terrifying, you can't trust who's on your team. Exactly. You don't want wars ever. So we have a horrible massacre in 1562 at Vassy.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1282.034

The Duke of Guise is then assassinated on Orléans in 1563. There's a peace treaty, the Edict of Amboise.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1289.301

And then that treaty does not last at all. And this war continues until 1598. So from 1562 to 1598. This is the political context in the middle of Catherine's rule is horrifying wars between... And her sons, yeah.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1303.854

Yeah, yeah. So it's expensive, it's devastating, it's horrific. The horrifying event, the key event, is called St Bartholomew's Day Massacre. It's in 1572.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1313.682

Catherine is often blamed for this.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1347.769

Because he'd been assassinated.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1395.014

There's no one in the 16th century who is a nice person in power. Like, you have to be cruel. You have to be ruthless. You have to be ruthless. To survive. Yeah. 1574, King Charles dies. Her son dies again. She's now on to her third son.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1410.121

Another Henri.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1411.922

So you've got Henri. He's having his go as king. Luckily, he's already had some useful work experience. Shappi, do you know why?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1428.337

No, weirdly, he was king of Poland for a bit.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1435.617

It's like the Duke of Edinburgh Award. So, Estelle, can you tell us about Henri, the new, new, new king of France?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

144.751

We tried to understand these women.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1464.726

So, Henri is now ruling. Catherine is still sort of reigning a bit because she's still mother of the king. But she still finds time to meddle in the love life of her fourth remaining son, Hercule, who gets renamed François, Duke of Anonçon. But Francis Hercule sadly dies aged 29 in 1584 after a bungled military campaign in the Netherlands.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1485.393

So Catherine is marrying off the daughters as well, which means she's sort of the grandmother of Europe.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1490.715

She's sort of, you know, she's arranging all these marriages and, you know.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1500.123

And Spain is a superpower at this time, isn't it? Absolutely. France and Spain are superpowers.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1508.05

And what about her final years, Catherine? I mean, she's quite old by this point, not like elderly, but she's lived a life by this point. So what's life like for her in the mid-1850s or so?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

153.76

We relate to them.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1592.546

Yeah, he's assassinated, isn't he?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1595.446

So she dies aged 69. France still ripped apart by a religious war. Her son is murdered. And the question, I suppose, is how does France cope without her stabilising influence? But she's not managed to stabilise everything, obviously. So what happens to the Valois line, her dynasty?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1624.21

It's a life and a half, isn't it, Chappie?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1626.352

We've gone through that.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

165.293

Join me for the second season of Lady Swindlers, where true crime meets history with a twist. Available now. Listen on the BBC app or wherever you get your podcasts.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1677.604

Well, there we go. That was quite wise of me. That was very wise. Very wise. I felt like we should just leave it there. Bye. The Nuance Window! No! Right, it's time now for the nuance window. This is the part of the show where Shappi and I sit enraptured in our throne room while Estelle holds court for two minutes, tells us something we need to know about Catherine de' Medici.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1700.801

My stopwatch is ready. Take it away, Dr Estelle.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1767.082

Thank you very much. Beautifully said. That was really beautiful.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1779.628

OK, well, thank you so much, Estelle. Thank you, Shappi. And listener, if you want to hear more of Shappi, you can check out our episodes on Justinian and Theodora, another fascinating royal rags to riches tale. Or, of course, the ancient Olympics episode, if you want to get your Olympics nostalgia vibes on.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1794.775

And for more quality queens, we have episodes on Emma of Normandy and Eleanor of Aquitaine. And remember, if you enjoyed the podcast, please leave us a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. And I'd just like to say a huge thank you to our guests.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

18.973

Join me and my all-female team of detectives as we revisit the audacious crimes of women trying to make it in a world made for men. These were women who traded in crime, but who were ahead of their time. History calls them criminals. Society calls them frauds. But here on Lady Swindlers, we call them ordinary women who lived extraordinary lives. And we're still talking about them today. MUSIC

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1809.121

In History Corner, we have the excellent Dr Estelle Perronc from Northeastern University, London. Thank you, Estelle.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1818.104

And in Comedy Corner, we had the sensational Shaparak Korsandi. Thank you, Shappi.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

1822.686

It's been fab. And to you, lovely listener, join me next time as we crown another historical subject. But for now, I'm off to go invent the Giza biscuit to rival the Bourbons. Bye!

You're Dead to Me

Catherine de’ Medici (Radio Edit)

193.188

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I am a public historian, author and broadcaster. And today we are grabbing our crowns and galloping back to the 16th century to learn all about the famous French queen Catherine de' Medici. And to help us, we have two very special guests.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

211.054

In History Corner, she's Associate Professor in Early Modern History at Northeastern University London. She's an expert on royal and diplomatic studies in 16th and 17th century Europe, especially queenship. And luckily for us, she's also the author of The Incredible Blood, Fire and Gold, the story of Elizabeth I and Catherine de' Medici. It's Dr Estelle Perronc. Welcome, Estelle.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

234.063

And in Comedy Corner, she's an award-winning comedian and author. You'll have seen her on all the TV, on such shows as Live at the Apollo, Michael McIntyre's Comedy Roadshow, Have That News For You. Maybe you've read one of her brilliant books, including her recent exploration of living with ADHD, Scatterbrain.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

247.948

And you'll definitely remember her from our episodes on Justinian and Theodora, the ancient Olympics and the Battle of Salamis. Welcome back to Chaparral, Sandy.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

278.063

You are intelligent. You're a very intelligent person.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

286.41

Okay. We've never had a sort of job swap before on the podcast.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

294.357

I'm sorry. Okay. Well, neither can I. Do you know the name Catherine de' Medici? She's quite famous from history.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

318.832

She is Italian. Well, half Italian, half French. We'll get to that. So, what do you know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And Catherine de' Medici has popped up on TV screens quite a few times in recent years, most recently played as a Machiavellian operator by Samantha Morton in The Serpent Queen.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

342.805

Maybe you will remember her as the scary mother-in-law in the wildly inaccurate but distinctively costumed Netflix series Reign, all about Mary, Queen of Scots. Or if video games are more your thing, you might know her as one of the leaders in Civilisation VI. But what about the real story of Catherine's life? Was she really as scheming as the TV dramas make out?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

360.697

And what's it like to have a pope as your uncle? Let's find out. Right, Estelle, we'll start at the beginning. Actually, let's start before the beginning. You've heard of the Medici family, Chappie, actually. The name rang a bell, but you weren't sure on the pronunciation.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

411.156

Yeah. And Florence is their home.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

419.761

So Catherine was born Caterina. Yeah. So your question, Shappi, about Catherine.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

453.52

And then saying you now need to move into that house.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

465.199

They're into the second Florentine Republic. He's given this land that he has to go and fight for. He marries the French noble who is royal.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

48.846

Meet a swindler with ever so many names.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

491.69

So we can imagine that her childhood, Katerina's childhood, would be... Amazing. Amazing, luxurious, glamorous. Not the case, Estelle.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

534.969

They're not a very robust family, are they?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

544.322

Her great uncle, isn't it?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

551.967

Pope Clement VII.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

565.596

So, how do you think the Pope, her uncle, Clement VII, secures her future? She's a young woman, she's 11, 12 years old. What do you think the Pope does to make sure she's got a backup plan?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

594.713

To marry off?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

611.187

His name is Henri, right? Henri, yeah. OK, all right. I'm not going to honk my problematic marriage collection. Sorry. But I am going to say, 14 is very young, just psychologically and developmentally. But at the time, I understand.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

628.868

OK, all right. We can perhaps update the name because she was Caterina de' Medici. But now she's Catherine.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

638.252

Okay, okay. No, that's fine. That's fair. Catherine. Okay, so we have teenage newlyweds, Catherine and Henri. They're first set up by the Pope. Already a very dramatic episode of Married at First Sight. But then the drama really ramps up because another woman enters the marriage. It's all very Lady Diana. Indeed, Diana is appropriate because this lady is Diane, Diana de Poitiers.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

674.324

Well, she's 19 years older.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

688.553

And the problem, of course, from a dynastic point of view, and this is where it gets sad, is that there's a fertility problem, that Catherine is not conceiving a child, so she can't provide the air that is needed. And so that's the pressure as well.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

78.069

But deep down, all she really wants is her dream home. And you don't have to just take our word for it.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

812.031

And they have how many children?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

816.276

Yeah. So the ten children, we'll have to rattle through them because we haven't got all day. So the ten children, the sons, so seven survive. The sons are François, Charles, Henri, Hercule.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

826.728

Yeah. And then the daughters are Elizabeth, Claude and Margaret, who marries Henri of Navarre, which will become important in the future. And Elizabeth will marry Philip II of Spain, also important in the future. So she's done her dynastic duty, Shappi. Ten kids, seven survive. But in 1547, King François I died. So the kind of the king who had sort of taken under his wing and taught her to ride.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

850.244

Yeah, that's it. But she is elevated. Her husband is now the king of France. So she is the queen of France.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

858.55

Ah, come on. I know. Is this where we find Catherine de' Medici, Queen Consort of France? Is this where she learns the game of politics?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

876.345

Henri marries off his son, Dauphin Françoise, to the Duke of Guise's niece. And her name is famous to history. She's Mary, Queen of Scots. Her daughter-in-law is Mary, Queen of Scots. Catherine.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

89.715

This season, we're chasing fake mediums, a lady burglar and the infamous Yorkshire witch from England and Scotland to the US and beyond. Our Lady Swindlers are truly international. She moved from Scotland to England to Italy, later to New York to New Zealand and Australia. As always, we're travelling back in time with our in-house historian, Professor Rosalind Crone.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

891.967

But we'll do Mary another day. Different episode.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

898.232

Catherine is now learning about oratory. She's learning about politics. She's also learning about another O, the occult. Shappi, have you ever heard of Nostradamus?

You're Dead to Me

Catherine de’ Medici (Radio Edit)

907.179

Nostradamus was one of her advisors.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

918.07

Yeah, he does feel very medieval.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

922.334

But he's banging around at the French court for some reason.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

931.683

History? Yeah.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

937.507

Nobby. In 1555, Nobby Nostradamus prophesies to his queen. He says, the young lion will overcome the old. In a field of combat, in a single fight, he will pierce his eyes in a golden cage, two wounds in one. He then dies a cruel death. Now, I'm not saying Nostradamus is true. He might have just, you know, cold reading, whatever. But supposedly Catherine also dreamed of it.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

964.241

So supposedly she has a nightmare vision that her husband's going to die in a joust. And she begs him not to go in the joust. He goes in the joust against Montgomery, who injures the king in the first joust.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

980.333

Yeah. The lance goes through his visor, through his face, through his eye, splinters into the brain.

You're Dead to Me

Catherine de’ Medici (Radio Edit)

986.541

Henri, her husband, is dead, which means Diane de Poitiers... Out?

You're Dead to Me

Cuneiform: the world’s first writing system

1011.426

But Assyriology is named after the fact that there's this incredible library, which dates to when roughly? The 7th century BC, so the 600s. Amazing. And so Nineveh, the royal library was discovered in what we now call Mosul in Iraq. 30,000 cuneiform tablets, which is amazing. They were brought to the British Museum, the home of Iraqi history. Yes.

You're Dead to Me

Cuneiform: the world’s first writing system

1038.121

But this wasn't the first time the massive collection of ancient cuneiform tablets had been put in a museum, right? Because this is what the library is. This was already a collection of knowledge by someone saying, this stuff's old.

You're Dead to Me

Cuneiform: the world’s first writing system

1080.481

Wow. So this is from about 650 BCE. So it's very late in the grand sweep of Mesopotamian history, but it is earlier than, like, it's earlier than Socrates.

You're Dead to Me

Cuneiform: the world’s first writing system

1091.844

So, you know, when we say ancient, it's ancient, but it's really late in...

You're Dead to Me

Cuneiform: the world’s first writing system

1098.286

So it's kind of, I'm doing, I'm slightly struggling to work out how to frame that. But yeah, we've got Ashurbanipal. I like to call him Ashurbanishampal. I don't know why. I always imagine him in my head.

You're Dead to Me

Cuneiform: the world’s first writing system

112.269

I highly recommend it. And you will remember her from our episode on the ancient Babylonians. It's Dr. Moody Al-Rashid. Welcome, Moody. Thank you. Thank you so much for having me. Delighted to have you back. And in Comedy Corner, he's a fantastic comedian, actor and author. You'll know him from Dastmaster, Live at the Apollo. Have a news for you from his two Netflix comedy specials.

You're Dead to Me

Cuneiform: the world’s first writing system

1126.946

I'm going to have to say it again just to make sure people understand, but this is a Neo-Assyrian king saying, this stuff belongs in a museum. It's 2,500 years old. So it's an ancient person going, this is archaeology.

You're Dead to Me

Cuneiform: the world’s first writing system

1140.697

Or this is knowledge. That's mad for us, right?

You're Dead to Me

Cuneiform: the world’s first writing system

1166.372

So the Library of Nineveh was this incredible compilation of all the knowledge, 2,500 years worth, put into one place, and then in the year 612 BCE, it was destroyed. Oh, no. Along came some baddies who sacked the city, and that was fantastic news for you, Moody.

You're Dead to Me

Cuneiform: the world’s first writing system

1181.59

Do you know why? Hmm.

You're Dead to Me

Cuneiform: the world’s first writing system

1196.12

Because they set the building on fire and it baked the clay.

You're Dead to Me

Cuneiform: the world’s first writing system

1214.073

So yeah, so the next episode of Great British Bake Off, that's what we want to see.

You're Dead to Me

Cuneiform: the world’s first writing system

1222.355

OK, so we know how cuneiform was deciphered and we know how it was preserved. The library burned down baking the knowledge, which is extraordinary. Let's now discover how cuneiform was first invented. Phil, you've already mentioned the alphabets. We know it has letters in it. Cuneiform isn't phonetic.

You're Dead to Me

Cuneiform: the world’s first writing system

1238.519

But in the very, very, very late old Persian, there was a tiny element of phonetic in there, a little bit, a little bit alphabetic, a little bit. That's right. So just right at the end, it changed a tiny bit. But the system is not phonetic. Is that right?

You're Dead to Me

Cuneiform: the world’s first writing system

130.205

Two, count them. Maybe you've read his side-splitting book, Sidesplitter, which I loved on audiobook. But you'll definitely remember him from our previous episodes of You're Dead to Me. Most recently on the Terracotta Warriors and the History of Kung Fu, which sounds like a film title but isn't. Returning for a triumphant fifth appearance in...

You're Dead to Me

Cuneiform: the world’s first writing system

1304.719

How many characters are there in cuneiform? If you were to be a scribe and train, how many would you have to learn?

You're Dead to Me

Cuneiform: the world’s first writing system

1346.866

Yeah. Can we see, can we show Phil some?

You're Dead to Me

Cuneiform: the world’s first writing system

1351.329

We haven't smuggled anything out of a library because it's probably too valuable. So we've got some pictures on an iPad. The iPad is stolen. Just add the facade.

You're Dead to Me

Cuneiform: the world’s first writing system

1361.836

So we have a tablet on a tablet.

You're Dead to Me

Cuneiform: the world’s first writing system

1481.104

more complicated characters but for those first three it is just like just marking yeah just marking but that was some very good philology phil well done oh thanks i feel like you really like you've just brought the level of the podcast up there i think everyone's very impressed um you know we're now talking about a technology that's 5350 years old the obvious question is why clay why you know the why is clay the technology

You're Dead to Me

Cuneiform: the world’s first writing system

1530.024

More people, more stuff means you need to write things down. Mm-hm. So the invention of writing is an accounting system. It's like a software for keeping track of your receipts. Exactly. And then it turns into literature. Is that fair? That's exactly right. OK.

You're Dead to Me

Cuneiform: the world’s first writing system

156.847

Phil, together we've tackled mighty military matters. We've done the Borgias. We've done Genghis Khan. We've done the Terracotta Warriors and Kung Fu. Today we're going quite nerdy. What does the word cuneiform mean to you? Spiritually. Emotionally.

You're Dead to Me

Cuneiform: the world’s first writing system

1645.151

We should talk about who can read this. I'm assuming most people are not literate. We've got multiple societies here. It's very generic to just say Bronze Age Mesopotamia, but who can read and write cuneiform? Is it a very highly skilled thing? Can you have basic functional literacy if you're an ordinary fisherman? Who's got that knowledge?

You're Dead to Me

Cuneiform: the world’s first writing system

1742.733

Keep it to the masses. This is just us. You said we have women scribes. The most famous one, I suppose, would be the daughter of King Sargon. So Sargon the Great of Arkady is a very famous sort of

You're Dead to Me

Cuneiform: the world’s first writing system

1756.984

He's around like 4,000 years ago. But his daughter is the first woman author in history?

You're Dead to Me

Cuneiform: the world’s first writing system

1788.665

The earliest named author in history is a princess writing 4,300 years ago. Exactly. Wow. That's really cool. It's very cool.

You're Dead to Me

Cuneiform: the world’s first writing system

1810.247

The tune is Sean Paul. It's Ashurbanipal's Sean Paul, yeah. That would actually be fantastic. Okay. And so how do you, like, can you send messages? Are there letters? Is there a postal system? Can you communicate with tablets and cuneiform, I suppose, is the question?

You're Dead to Me

Cuneiform: the world’s first writing system

1891.564

So in the 19th century, when you get the invention of telegraphy and you'd go to the telegraphy office and you dictate your thing and someone would put into Morse code and then someone else would translate it for them. And it's the same thing in, but 4,000 years ago. So you're dictating it. So it's like, hey, Siri, but instead it's, hey, scribe. Describe. Putting the Siri in a Siri.

You're Dead to Me

Cuneiform: the world’s first writing system

1913.065

I didn't catch that. I'm sorry, I did not hear. Please say that again. What kind of things do you think people were dictating in their tablets, Phil? In the letters to each other. Yeah, what kind of stuff do you think is getting jotted down?

You're Dead to Me

Cuneiform: the world’s first writing system

1953.843

Actually, yeah. There must have been loads. The Hymn to Nankazi is one of the earliest things ever written down, and that's a song to a goddess about beer. And I know that one of the earliest ever Kineoform tablets we have is about beer. Mm-hmm. That's right. It's amazing. I feel like nothing has changed. Can you tell us about this ancient, is it one tablet? Is it fragments? What have we got?

You're Dead to Me

Cuneiform: the world’s first writing system

196.955

I mean, Moody, I don't want to give him too many sort of stars early on, but I feel that was quite good.

You're Dead to Me

Cuneiform: the world’s first writing system

2018.673

So he's a beer magnate. He's like... He's like, Mr. Heineken, he's in charge of all of the beer of the city.

You're Dead to Me

Cuneiform: the world’s first writing system

2028.863

Yes, because beer is a currency, almost.

You're Dead to Me

Cuneiform: the world’s first writing system

203.2

And the font for old is just like a really big font.

You're Dead to Me

Cuneiform: the world’s first writing system

2088.441

So Kashim might be one of the first named people in history.

You're Dead to Me

Cuneiform: the world’s first writing system

2092.942

And he's a beer brewer.

You're Dead to Me

Cuneiform: the world’s first writing system

2095.884

That's great. So cool. Okay. So there we go. So beer is the history. The history of the world is beer, basically. Beer and writing. Slightly drunk texting. So we have hundreds of thousands. I was a medieval historian by training, and I used to complain that we had too many documents. But you have hundreds of thousands of Kinoform tablets. So you haven't read them all.

You're Dead to Me

Cuneiform: the world’s first writing system

2121.719

That's extraordinary because that gives us such a window into daily life.

You're Dead to Me

Cuneiform: the world’s first writing system

2189.46

Which is arguably the first great story. It's the earliest great literature in human history that's recorded. And we have it because of cuneiform.

You're Dead to Me

Cuneiform: the world’s first writing system

2196.726

And do we have it in complete form, the Gilgamesh?

You're Dead to Me

Cuneiform: the world’s first writing system

221.243

This is where I have a go at getting what you, our lovely listener, might know about today's subject. And, well, I think Phil has outclassed us all. You might remember a mention of cuneiform on our Babylonians episode we talked about before with Moody and Kay Curd. Maybe you've seen some cuneiform tablets in the British Museum or in the Ashmolean Museum in the States. I think Paris has some.

You're Dead to Me

Cuneiform: the world’s first writing system

2211.91

Something we do have, which is really charming, I think, and quite interesting, we have a series of letters between a wife and a merchant husband who are in different cities and they're writing to each other. What do you imagine they're writing to each other, Phil?

You're Dead to Me

Cuneiform: the world’s first writing system

2249.613

So who are our protagonists? Is it Anaya?

You're Dead to Me

Cuneiform: the world’s first writing system

2311.619

Yeah. I feel like they might need couples therapy.

You're Dead to Me

Cuneiform: the world’s first writing system

2344.184

Well, as I said, a Kinnear film was developed as an accountancy system early on, but it becomes just a way to communicate everything and anything that people want to say to each other, which means literature, letters, language, astronomy, petty complaints, legal trials, presumably.

You're Dead to Me

Cuneiform: the world’s first writing system

239.961

More likely, you've seen something resembling cuneiform, well, probably as a prop in a video game or in a movie. But to be honest, I don't think cuneiform is something that most people are visualising. I think, Phil, you did really well, because you then mentioned hieroglyphs. I think people go to hieroglyphs when they think of old scripts.

You're Dead to Me

Cuneiform: the world’s first writing system

2396.787

Like making, you know... And they're not getting the money back. Yeah, and they're doing a lot of work, so kind of... Meanwhile, Inaya is in Turkey having a great time.

You're Dead to Me

Cuneiform: the world’s first writing system

2405.911

I was going to say, he's probably got a second family, hasn't he? He's like, who's this woman writing to me? I'm trying to play with my new kids. So how did scribes learn all these systems? Do we have evidence of their training?

You're Dead to Me

Cuneiform: the world’s first writing system

2487.02

So that might have just been an honest mistake. It's just a very hungry student.

You're Dead to Me

Cuneiform: the world’s first writing system

2496.668

Oh, cool. I feel like the teeth marks justifies my earlier Great British Bake Off joke. Oh, yes. I feel like clay bake, tray bake. That's the third week in the series. That's Prue Leith trying out one of the things. Yeah, exactly. Just breaking a tooth on it. That's been overproofed, I think, yeah. So we've got schoolboys doodling.

You're Dead to Me

Cuneiform: the world’s first writing system

2514.039

We've got a doodle of a man sitting down with a long stick and we think it's the teacher.

You're Dead to Me

Cuneiform: the world’s first writing system

2537.39

What language do they speak and what language are they writing in if they're training to be scribes?

You're Dead to Me

Cuneiform: the world’s first writing system

2557.073

So it's like a Victorian schoolboy learning Latin so that he'd go and become a lawyer.

You're Dead to Me

Cuneiform: the world’s first writing system

257.052

Yeah, but you knew triangle stuff, so that's kind of cool. So anyway, the questions we have to answer. What exactly was cuneiform? What do all these clay tablets actually tell us? What do they say? And who first figured out how to decipher it? Let's find out. Right, Dr Moody. Can we start with some quick basic definitions? Because I'm feeling very basic. What is cuneiform?

You're Dead to Me

Cuneiform: the world’s first writing system

2581.544

Is Aramaic derived from Akkadian and then Aramaic is the father of several languages? I think is that sort of the chain, is it maybe?

You're Dead to Me

Cuneiform: the world’s first writing system

2600.395

Yeah, so the Neo-Assyrian period. And then Persian comes in and then you're like, oh, there's a whole other language.

You're Dead to Me

Cuneiform: the world’s first writing system

2605.599

But they're still learning Sumerian scribes as kids. You're learning a dead, dead language by that point. It's like so dead.

You're Dead to Me

Cuneiform: the world’s first writing system

2621.047

The scribes are sort of, they're also being used in religion, right? So religion is also important. And we talked about some of this when we did our Babylonians episode with Kay, but I think we just probably reiterate for Phil's benefit. What does cuneiform teach us about sacred texts and the understanding of gods and monsters, ghosts, planets and stars?

You're Dead to Me

Cuneiform: the world’s first writing system

2703.336

Would you take that? Would you mean two months living as a king if you know you're going to die at the end?

You're Dead to Me

Cuneiform: the world’s first writing system

2753.404

And there's also divination. So telling the future by using sheep. Phil, how would you go about telling the future with sheep?

You're Dead to Me

Cuneiform: the world’s first writing system

277.501

Am I pronouncing it right? Yeah. How did it get its name? What does its name mean?

You're Dead to Me

Cuneiform: the world’s first writing system

2787.168

Yeah, it's the liver, isn't it? They're looking at the liver. But what I find really interesting is that writing is still very important in this process. Can you tell us why?

You're Dead to Me

Cuneiform: the world’s first writing system

2849.224

So you said that kinetic form is quite a stable technology. We had the earliest technology at 3,350. Mm-hmm. The absolute latest we go to is in the Roman era, right? The latest cuneiform is like, what, 79 CE?

You're Dead to Me

Cuneiform: the world’s first writing system

2869.072

Which is the year Vesuvius erupted.

You're Dead to Me

Cuneiform: the world’s first writing system

2873.213

Coincidence. I was going to say, maybe the volcano erupted in one night. I feel like this is a sign. Let's just put down the G'day everyone.

You're Dead to Me

Cuneiform: the world’s first writing system

2891.18

Okay, so that's amazing. So it's a stable technology. It changes a little bit over the time in terms of the font, in terms of how it's written, but you can still read it through that time.

You're Dead to Me

Cuneiform: the world’s first writing system

2903.566

And so Akkadian then is followed by Aramaic, followed by Persian, followed by other languages, and off we go. There's one more thing to mention. Phil, as our expert philologist here, what do you think the cruciform monument of Manish Tushu was? Oh, no. I was just reading about this. You're sick of hearing, aren't you?

You're Dead to Me

Cuneiform: the world’s first writing system

2961.044

The reason I've asked is because it's a forgery? Yeah. It sort of gets to the heart of what's quite interesting about cuneiform, it's that this is a deliberately new thing that's meant to look old.

You're Dead to Me

Cuneiform: the world’s first writing system

3013.452

It's a forgery. It's basically saying we've always been here. So it's a Christian cross.

You're Dead to Me

Cuneiform: the world’s first writing system

3026.786

It's sort of the era of kind of the Persian, it's the 6th century B.C. So it's in the 500s B.C. And it's them claiming Fake ancestry saying, no, no, we've been here for like 1,800 years. And it's a brand new... It's like dipping it in like when you were a kid and you had to make an old document and you dipped it in tea to make it look old. It's that.

You're Dead to Me

Cuneiform: the world’s first writing system

3063.206

Fantastic. So there you go, Phil. 3,500 years of technology, of script, a very impressive history. You had to impress it. Yeah, it was really good. I got it. Yeah, so you now know about cuneiform. Yeah, I can speak cuneiform. No, no, you can't speak it.

You're Dead to Me

Cuneiform: the world’s first writing system

3100.538

This is where Phil and I sit quietly in the classroom and we carve our clay tablets for two minutes while Dr. Moody tells us something we need to know about cuneiform's history. Take it away, Dr. Moody.

You're Dead to Me

Cuneiform: the world’s first writing system

3221.916

Beautiful. Thanks so much.

You're Dead to Me

Cuneiform: the world’s first writing system

3223.878

So what do you know now? This is our quickfire quiz for Phil to see how much he's learned. I should have written more notes. I've just written Sumerian. I have to say, there's not many triangles on that page. How are you feeling? Confident?

You're Dead to Me

Cuneiform: the world’s first writing system

3255.063

We've got ten questions. Historically, you're very good at these quizzes. I believe in you. Okay, question one. Cuneiform gets its name from the Latin word for which shape? Triangle. It is. Triangle or wedge shape. There we go. We're off to a flyer. Question two. Where in the world was cuneiform developed and used? Mesopotamia. It is, absolutely. Between the two rivers. Question three.

You're Dead to Me

Cuneiform: the world’s first writing system

3275.958

The rock-carved inscriptions at Behistun about Darius the Great were transcribed and translated by which English soldier, commonly known as the father of Assyriology? Rawlinson. It was Henry Rawlinson. Well done. Well remembered. Question four, what are the earliest surviving cuneiform tablets about? Our earliest named person in history, possibly. Oh, a brewer, a beer maker.

You're Dead to Me

Cuneiform: the world’s first writing system

3298.413

Yeah, that's it, beer, absolutely. 135,000 litres of beer. I'm doing my best. It's a lot of beer. Good night. Question five, why was cuneiform needed during ancient sheep liver divination rituals?

You're Dead to Me

Cuneiform: the world’s first writing system

3315.303

With a yes, no question, which has to be written down. Yes. Well done. And the liver was also the tablet of the gods, wasn't it? That was a lovely line. Question six. What doodles have been found on a schoolboy's cuneiform tablet?

You're Dead to Me

Cuneiform: the world’s first writing system

332.301

You said it was developed over 3,000 BCE, so it's over 5,000 years old.

You're Dead to Me

Cuneiform: the world’s first writing system

3332.777

The child was hungry. Question seven. Can you name one of the languages written in Kineiform? Akkadian. Very good. We could have Sumerian, Old Persian, Alamite, Hittite, Hurrian. You went with Akkadian, which I think is a good one. Question eight. What is the cruciform monument of Manistushu? Oh.

You're Dead to Me

Cuneiform: the world’s first writing system

3355.556

Yeah, to say we've been here much longer than we claim to be. You're absolutely right. Question nine. The Royal Library of Nineveh was created by King Ashurbanipal Shampo to house 30,000 clay tablets. What happened to it? It was burned. It was. Burned down. And everything was taken to the British Museum. And question ten. When was the last known cuneiform inscription created? 79 or 80 CE. Amazing.

You're Dead to Me

Cuneiform: the world’s first writing system

336.943

Possibly even older than that, like 5,300 years old, give or take.

You're Dead to Me

Cuneiform: the world’s first writing system

3381.475

10 out of 10, Phil Wang.

You're Dead to Me

Cuneiform: the world’s first writing system

3387.777

That's fantastic. Well done. Oh, well done, Moody, for teaching him. Yes, thank you. That's some technical stuff we've covered there, but just so interesting.

You're Dead to Me

Cuneiform: the world’s first writing system

3417.797

It's a husband and wife arguing, it's a mum trying to get her kids back, it's a boss saying, where's my order? It's not end time. It's really, it's proper human life.

You're Dead to Me

Cuneiform: the world’s first writing system

3430.226

Well, thank you so much for sharing that with us today. And thank you also, Phil, for your knowledge and wisdom and comedy. Oh, thanks for having me. It's been fascinating. Yes, we're great. And after today's episode, you want more Mesopotamia with Moody, check out our episode on the ancient Babylonians.

You're Dead to Me

Cuneiform: the world’s first writing system

3443.572

And to hear more from Philly Philly Wang Wang, listen to his episodes on the Borgias, Chinggis Khan, the terracotta warriors, and the history of Kung Fu. We've given you quite a weird curriculum so far, haven't we, Phil? Yeah, it's a varied curriculum. I feel like we're training you for some sort of purpose. An enormous battle. Yes, exactly.

You're Dead to Me

Cuneiform: the world’s first writing system

3461.441

And remember, if you've enjoyed the podcast, please share the show with your friends, subscribe to You're Dead to Me on BBC Sounds, where you will hear the show a month before it arrives on other platforms. So there we go. There's a bonus for you. And switch on your sounds notifications too, so you never miss an episode. I'd just like to say a huge thank you to our guests in History Corner.

You're Dead to Me

Cuneiform: the world’s first writing system

3478.313

We have the marvellous Dr Moody Al-Rashid from the University of Oxford. Thank you, Moody.

You're Dead to Me

Cuneiform: the world’s first writing system

3483.476

It's been a pleasure, and in Comedy Corner, as ever, we have the fantastic Philology Wang. Thank you, Phil. Thank you for using my full name. It's been a pleasure. And to you, lovely listener, join me next time as we decode another message from the past.

You're Dead to Me

Cuneiform: the world’s first writing system

3495.931

But for now, I'm off to go and carve an emoji inscribed Rosetta Stone to help future archaeologists, and it's going to involve an awful lot of rude emojis.

You're Dead to Me

Cuneiform: the world’s first writing system

3505.643

This episode of You're Dead to Me was researched by Hannah Cusworth and Matt Ryan. It was written by Emmy Rose Price Goodfellow, Emma Neguse and me. The audio producer was Steve Hankey and our production coordinator was Ben Hollands. It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook.

You're Dead to Me

Cuneiform: the world’s first writing system

3521.542

You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Cuneiform: the world’s first writing system

379.655

And then they're like, guys, triangles.

You're Dead to Me

Cuneiform: the world’s first writing system

406.844

Sumerians, Akkadians, then Babylonians, then Elamites, Hittites, Neo-Assyrians, and then Persia.

You're Dead to Me

Cuneiform: the world’s first writing system

415.329

Someone needs to do a song. There needs to be like a kind of... Like an alphabet song. Like an alphabet song. Like, if only Sesame Street could just do this for us, that'd be great. The Neo-Sumerians. The Neo-Assyrians. Neo-Assyrians.

You're Dead to Me

Cuneiform: the world’s first writing system

444.482

Phil, we're going to mix things up here. We're going to go to modern history now. We're going to start with only a couple of hundred years ago when they deciphered Kineiform. Can you guess the nationality of the man who deciphered this ancient Near Eastern technology? Oh. Nationality for us, please, Phil. French. French. It's a good guess. His name was Henry Rawlinson. Okay.

You're Dead to Me

Cuneiform: the world’s first writing system

465.019

And he was from England, as all the best people are. That's what I wanted to say.

You're Dead to Me

Cuneiform: the world’s first writing system

472.868

It's usually an Englishman or Frenchman, in fairness, in this period in history. Moody, what was an Englishman doing in Iran? Was he doing a classic bit of Empire? Hello, I've just come to do a bit of Empire.

You're Dead to Me

Cuneiform: the world’s first writing system

495.009

So he was invited in by the Shah of Persia.

You're Dead to Me

Cuneiform: the world’s first writing system

498.571

Normally it's a sort of invasion thing. So that's quite nice. They actually said, welcome, please. Phil, the study of languages is called philology.

You're Dead to Me

Cuneiform: the world’s first writing system

505.652

And your name is Phil. Yeah. I feel like therefore you have an innate skill in this.

You're Dead to Me

Cuneiform: the world’s first writing system

519.295

How would you go about decoding an ancient script? Because you're an engineer, right?

You're Dead to Me

Cuneiform: the world’s first writing system

522.195

So you think laterally. Yeah, sure. And you're Henry Rawlinson. How do you start decoding that?

You're Dead to Me

Cuneiform: the world’s first writing system

568.996

Moody, it sounds like Rawlinson used the Phil Wang technique.

You're Dead to Me

Cuneiform: the world’s first writing system

619.256

Are you besmirching an Englishman's name, Moody?

You're Dead to Me

Cuneiform: the world’s first writing system

625.658

He kicked it out of the line. He showed up and said, I've got this, lads. Thank you very much. Is Behistun sort of the Rosetta equivalent that Phil mentioned? Is that like the key discovery?

You're Dead to Me

Cuneiform: the world’s first writing system

679.184

And this inscription at Behistun talks about a very famous king called Darius of Persia. Darius the Great, have you heard of him? No. No, he's a sort of big name in video games. I thought maybe you'd sort of fought him on Total War at some point. He's a couple of hundred years before Alexander the Great. And he was a big conqueror and he fought 19 battles to crush rebellions.

You're Dead to Me

Cuneiform: the world’s first writing system

698.831

And this inscription says... I, King Darius of Persia. I guess. Of, I guess.

You're Dead to Me

Cuneiform: the world’s first writing system

705.868

Did some crushing. And I'm going to stick it up here in Elamite and Persian and Akkadian.

You're Dead to Me

Cuneiform: the world’s first writing system

714.875

Okay. And Henry Rawlinson decoded it with help. Yes.

You're Dead to Me

Cuneiform: the world’s first writing system

728.026

It's like on a cliff or something. It's like really high up.

You're Dead to Me

Cuneiform: the world’s first writing system

74.603

Hello and welcome to Your Dent to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we're bouncing back to the Bronze Age with our styluses and clay tablets to learn all about the first ever writing system or script called cuneiform.

You're Dead to Me

Cuneiform: the world’s first writing system

740.811

Of course he did. Yes.

You're Dead to Me

Cuneiform: the world’s first writing system

755.356

You've already qualified that he wasn't necessarily the sole most important man in this story. So who else should be added to the checklist?

You're Dead to Me

Cuneiform: the world’s first writing system

806.692

Right. Phil, how do you think Henry Rawlinson took to Hinks's work? Do you think he welcomed this other man coming along with new ideas?

You're Dead to Me

Cuneiform: the world’s first writing system

822.409

Yeah, you think they might rap songs about each other.

You're Dead to Me

Cuneiform: the world’s first writing system

827.171

I think you're bang on, right? I mean, Moody, he tries to crush his career, right?

You're Dead to Me

Cuneiform: the world’s first writing system

858.705

Have you ever been tempted to crush your rival comedian's career? I mean, you're the only Phil in comedy, right?

You're Dead to Me

Cuneiform: the world’s first writing system

871.193

So Rawlinson and Hinks were squabbling, and in 1857, so 20 years after Rawlinson first went out to Persia, I suppose that's what it would have been called at the time, the Royal Asiatic Society... I don't know what they are, but they sort of intervened and said, right, OK, we're going to officially declare that cuneiform has been decoded. They announced this how, Moody?

You're Dead to Me

Cuneiform: the world’s first writing system

896.809

OK. Phil, how do you think the competition was judged? What kind of... Talk me through the rounds.

You're Dead to Me

Cuneiform: the world’s first writing system

92.572

And to help us decipher the ancient story, we have two very special guests. In History Corner, she's an honorary fellow at Wolfson College, University of Oxford. She's an Assyriologist who researches and teaches on the history of Mesopotamia, Cuneiform and the Akkadian language. She has a wonderful brand new book that I loved called Between Two Rivers, Ancient Mesopotamia and the Birth of History.

You're Dead to Me

Cuneiform: the world’s first writing system

922.679

How did this competition work? Is it live translation spelling bee, as Phil has suggested, which I'd love to see.

You're Dead to Me

Cuneiform: the world’s first writing system

954.236

And this is the Akkadian language now.

You're Dead to Me

Cuneiform: the world’s first writing system

956.68

So the three languages were Elamite, Akkadian and Old Persian. All three languages have been decoded.

You're Dead to Me

Cuneiform: the world’s first writing system

973.635

And this invents a new discipline of which you are a practitioner.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1007.406

And Henri gives it to Diane.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1035.779

I mean, Henri would sit on Diane's lap at court and play the guitar.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1048.908

Yeah, not her on his lap. He would sit on her lap and strum his guitar. Fascinating. Like a sort of emo kid.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1058.374

And he would touch her breasts in front of people. Like he was touching her up and playing his guitar. He was strumming away.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1065.859

And the problem, of course, from a dynastic point of view, and this is where it gets sad, is that there's a fertility problem that Catherine is not conceiving a child. So she can't provide the air that is needed. And so that's the pressure as well.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1113.827

Yes, quaffing donkey piss is not really going to set the mood, is it?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

112.248

And you'll definitely remember her from our episodes on Justinian and Theodora, the ancient Olympics and the Battle of Salamis. Welcome back to Chaparral, Sandy.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1120.951

And I can only say the first half. So something we haven't said actually is Henri is not the dauphin. Dauphin means the heir. The dauphin is the person who's going to inherit the throne. He is the spare. He is the Prince Harry.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1133.805

His older brother, François, is the Prince William, the kind of the heir to the throne, the dauphin.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1142.071

No. So he's the backup prince until suddenly he isn't.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1150.05

Francois died tragically, suspiciously, Chappie.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1200.52

The Italian secretary is the one who takes the fall.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1203.681

Because he's got a book on toxicology in his library. He's got a book called How to Poison People 101.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1220.974

So the Italian guy is called Monte Caccioli, I think.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1223.976

And so that's Francois as the secretary. So his death is pretty dramatic, Chappie. Do you know how he is executed?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1243.577

I mean, that's certainly a nice way to go if you have to. No, he's ripped apart by horses.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1251.49

It's pretty horrible. Catherine not ripped apart by horses, which is good because it'd be a short podcast. So she doesn't go down for the crime, but there are people who believe that she might be implicated, but they can't prove it.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1276.425

Go for it because I think it's really interesting. The Pope dies. Yeah. Which is interesting. So Pope Clement VII dies, her great uncle.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1364.334

She was. She invented side saddle or she pioneered?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

142.356

You are intelligent. You're a very intelligent person.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1456.213

You should film this podcast.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1476.763

Like a fluffer. Like a fluffer, yeah.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1484.249

And drinking donkey piss, of course.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1487.793

Not just donkey piss, but also wearing cow dung poultices all over the body as well. And grounding up stag antler horn as well.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1499.504

You grind it up and you drink it. Disgusting.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

150.699

Okay. We've never had a sort of job swap before on the podcast.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1506.57

And they have how many children? Ten. Ten.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1539.955

So the ten children, we'll have to rattle through them because we haven't got all day. So the ten children, the sons, so seven survive. The sons are François, Charles, Henri, Hercule.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1550.567

Yeah. And then the daughters are Elizabeth... Elizabeth. Claude and Margaret. Yeah. Who marries Henri of Navarre, which will become important in the future. And Elizabeth will marry Philip II of Spain, also important in the future. So she's done her dynastic duty, Chappie. Ten kids, seven survive. But in 1547, King François I died.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1570.48

So the kind of the king who had sort of taken under his wing and taught her to ride.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1575.462

Yeah, that's it. But she is elevated. Her husband is now the king of France. So she is the queen of France.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1587.691

Yeah, OK. So is this where we find Catherine de' Medici, Queen Consort of France? Is this where she learns the game of politics?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

159.081

Okay. Well, neither can I. Do you know the name Catherine de' Medici? She's quite famous from history.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1647.615

And Diane's also getting older. And famously, Diane died in a very interesting way, which has been proven by toxicology. She drank gold. She believed it was the eternal youth serum. And so she literally guzzled gold and they found it in her bones.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1669.947

Anyway, so Catherine has reclaimed Calais from the English, which is a great humiliation for the English in 1558. Henri marries off his son, Dauphin Françoise, to the Duke of Guise's niece, and her name is famous to history. She's Mary, Queen of Scots. Her daughter-in-law is Mary, Queen of Scots. Catherine...

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1692.649

But we'll do Mary another day. Different episode.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1698.99

Well, they didn't like each other that much. There was a tension. There was a push-pull.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1719.235

Catherine is now learning about oratory. She's learning about politics. She's also learning about another O, the occult. Shappi, have you ever heard of Nostradamus?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1727.304

Nostradamus was one of her advisors.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1739.052

Yeah, he does feel very medieval.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1743.133

Yeah, but he's banging around at the French court for some reason.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1758.498

Nobby. In 1555, Nobby Nostradamus prophesies to his queen. He says, the young lion will overcome the old. In a field of combat, in a single fight, he will pierce his eyes in a golden cage, two wounds in one. He then dies a cruel death. Now, what do you think that sounds like, Shappi?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1783.799

It does. It's a jousting injury. And that literally happens. Now, I'm not saying Nostradamus is true. He might have just, you know, cold reading, whatever. But supposedly Catherine also dreamed of it. So supposedly she has a nightmare vision that her husband's going to die in a joust. And she begs him not to go in the joust.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1801.129

He goes in the joust against Montgomery, who injures the king in the first joust.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1810.955

Yeah, the lance goes through his visor, through his face, through his eye, splinters into the brain, and he... He died in ten days. Henri, her husband, is dead, which means Diane de Poitiers... Out?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

183.05

She is Italian. Well, half Italian, half French. We'll get to that. So, what do you know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And Catherine de' Medici has popped up on TV screens quite a few times in recent years, most recently played as a Machiavellian operator by Samantha Morton in The Serpent Queen.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1901.226

So Henri is dead, the king is dead, long live the king. Her son is now king.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1906.567

Right, so Mary, queen of Scots, is now queen of France. Francois is king of France, but he's only 15. Shappi, you've got a teenage boy.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1919.131

OK, how would he do at ruling the country?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

1929.56

So what level of power does the king have compared to the mother, Catherine de' Medici, who's now really running the show?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2003.971

There's also another family who are jockeying at court. So we've got the Guises family. So that's Mary's uncles. They are pretty, pretty scary blokes. There's also the Bourbons who make delicious biscuits. They're led by Antoine, king of Navarre, which is Spain or sort of near Spain, Navarre.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2031.949

So Antoine and his brother Louis Condé. So you've got the Bourbon family, you've got the Guises family. They're on opposite sides politically and religion-wise.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2047.316

And the Guises effectively kidnapped François. Yeah. They sort of sweep into the palace and they sort of stick him in a cupboard and kind of rule for him.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

206.986

Maybe you will remember her as the scary mother-in-law in the wildly inaccurate but distinctively costumed Netflix series Reign, all about Mary, Queen of Scots. Or if video games are more your thing, you might know her as one of the leaders in Civilisation VI. But what about the real story of Catherine's life? Was she really as scheming as the TV dramas make out?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2064.45

Yeah. OK. OK, so the Guises and Catherine are sharing power at court. Catherine doesn't have that much power. But the Guises renege on their loans. They cut their pensions. They don't pay the soldiers. They are not good at running the country. People don't like them, right? They send troops off to Scotland because of Mary, Queen of Scots.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2080.641

So the French are starting to go, hang on a minute. But they also, of course, they're cracking down on the Protestants because the Boardmans are the Protestants.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2086.084

And the Guises are Catholics. Then we have more bad news. Francois II suddenly becomes very unwell, Shepi.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2091.947

And Catherine, having seen her, or seen many people in her life die, knows what's about to happen.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2098.069

Yeah. And she has to pull the emergency sort of parachute button and prepare the next one. She's sort of saying goodbye to one king and trying to prep the next one.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2110.454

Well, OK, so your 15-year-old, your teenage boy would plan town centres. What would a nine-year-old do? Ask his mummy. Exactly.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2123.482

Yeah. Which son is this then?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2136.149

We do now have the French Wars of Religion.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2139.312

And these are incredibly serious. And we are a comedy show, so we can't be too flippant here. But they kill over 2 million people.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2150.122

Three decades short, but millions of people die in these wars of religion between Catholic factions and Huguenots. And Catherine's... sort of reign. I mean, she doesn't reign, but she's ruling.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2162.852

We have to now put this into the context of the time, right? So we have this horrible series of wars that last for 30 years, but they don't initially last for 30 years. They last for one year initially, and then there's a peace treaty.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2196.316

Yes. It's expensive. It's terrifying. You can't trust who's on your team. Exactly. You don't want wars ever. But we have a horrible massacre in 1562 at Vassy where the Huguenot worshippers... It's the Guises who are going to kill the Huguenots for worshipping.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2226.81

It's horrific in France. It's devastating. But also foreign powers get involved. So Philip the King of Spain sends 13,000 soldiers to the Catholic side. Elizabeth of England sends 6,000 men to defend the Huguenot and Prince Condé. The Duke of Guise is then assassinated on Orléans in 1563. There's a peace treaty, the Edict of Amboise. And then that treaty does not last at all.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

224.879

And what's it like to have a pope as your uncle? Let's find out. Right, Estelle, we'll start at the beginning. Actually, let's start before the beginning. You've heard of the Medici family, Chappie, actually. The name rang a bell, but you weren't sure on the pronunciation. Oh.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2249.934

And this war continues until 1598. From 1562 to 1598. So let's just sort of park that there and say, this is the political context in the middle of Catherine's rule is horrifying wars between... And her sons, yeah.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2265.144

Yeah, yeah. So it's expensive, it's devastating, it's horrific. But let's do something funny because it's a comedy show.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2273.29

Okay, let's try and perk you up. Shappi, what do you think Queen Catherine's flying squadron was like?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2290.82

They did have pigeons. So you're thinking what, carrier pigeon?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2300.113

They're preying on people, but they're not birds of prey.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2303.838

Well, I mean, maybe the geysers would call them birds, but no.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2309.866

It's a sort of spy network of hot ladies.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2387.153

So that was our fun detour. Now back to the wars of religion.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2391.616

Sorry. Thanks for that. Sorry, Shafi. I mean, the horrifying event, the key event is called St. Bartholomew's Day Massacre. It's in 1572.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2402.182

Catherine is often blamed for this.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2436.438

Because he'd been assassinated.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2483.942

There's no one in the 16th century who's a nice person in power. Like, you have to be cruel. You have to be ruthless. You have to be ruthless.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2492.107

Yeah, that's how power works in the 16th. I mean, people have often commented she's very Cersei Lannister. That's the very Game of Thrones. I disagree with this. I know you do. And I think this is the thing. Catherine is often seen through the lens of other people from history. And it's an interesting legacy. 1574, King Charles dies. Her son dies again. She's now on to her third son. Yes.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2523.466

He's Hercule, isn't he? And so you've got Henri, he's having his go as king. Luckily, he's already had some useful work experience. Shappi, do you know why?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2542.846

No, weirdly, he was king of Poland for a bit.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2550.102

It's like the Duke of Edinburgh Award. So, Estelle, can you tell us about Henri, the new, new, new king of France?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2610.655

Yeah, he's a good-looking fella.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2620.604

Sorry, chaps. Loved being king of Poland. Gotta go.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2702.113

But he describes his poo. He keeps a poo diary.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2718.101

So, Henri is now ruling. Catherine is still sort of reigning a bit because she's still mother of the king. But she still finds time to meddle in the love life of her fourth remaining son, Hercule, who gets renamed François, Duke of Anonçon.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2733.796

And he's being dangled in front. In fact, Catherine is doing the dangling. She's dangling him in front of someone for marriage. Do you know who that would be?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2751.474

Who's single and ready to mingle on the marriage market?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2768.208

Yeah. So he's a young lad. Lizzie, Lizzie, Lizzie. And he's being sort of pushed in front of Queen Elizabeth, who's much older.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

279.105

Yeah. And Florence is their home.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2790.173

Her nickname for him is Frog.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2796.836

Yeah, yeah. Yeah, she was. Yeah, he's in his late teens.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2859.127

Well, he doesn't marry her, of course, because she remains the Virgin Queen. But Francis Hercule sadly dies aged 29 in 1584 after a bungled military campaign in the Netherlands. So Catherine is marrying off the daughters as well, which means she's sort of the grandmother of Europe.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2873.791

She's sort of, you know, she's arranging all these marriages and, you know.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2883.174

And Spain is a superpower at this time, isn't it? France and Spain are superpowers.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2891.103

And what about her final years, Catherine? I mean, she's quite old by this point, not like elderly, but she's lived a life by this point. So what's life like for her in the mid-1580s or so?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2992.864

Yeah, he's assassinated, isn't he?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

2995.707

So she dies aged 69, France still ripped apart by a religious war. Her son is murdered. And the question, I suppose, is how does France cope without her stabilising influence? But she's not managed to stabilise everything, obviously. So what happens to the Valois line, her dynasty?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3024.576

It's a life and a half, isn't it, Shappi?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3040.074

Yeah, I'd just go to Chinonso and just make myself a cocktail and just read a book.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3045.258

Yeah, just play volleyball in the garden.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3086.013

Well, there we go. That was quite wise of me. That was very wise. Very wise. I felt like we should just leave it there.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3098.442

Right, it's time now for the nuance window. This is the part of the show where Shappi and I sit enraptured in our throne room while Estelle holds court for two minutes, tells us something we need to know about Catherine de' Medici. My stopwatch is ready. Take it away, Dr. Estelle.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

310.033

I'm so sorry. Not the Kardashians.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

315.459

So Catherine was born Katerina, right? So your question, Shappi, about Catherine.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3211.539

Thank you very much. Beautifully said.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3224.086

What an extraordinary life. And as we say, her childhood was so sad. Just to come back from that alone is impressive. So what do you know now? This is our quickfire quiz for Shappi to see how much she has learned. We've done an awful lot of Henri's and Françoise's and all sorts of names. Are you feeling confident? I mean, you've been taking great notes.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3250.677

I don't think he's in the quiz, but maybe we'll get lucky. But we've got ten questions. Here we go. Question one. Which family member acted as Catherine's guardian for much of her childhood from his fancy palace? It was Pope Clement. It was Clement VII. Well done. Question two. How did the French court unconventionally celebrate Catherine's marriage to Prince Henri in 1533 when they went to bed?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3278.881

They did. It was an orgy. Classic, absolutely. The dipping of the nipping. Yes. Question three. Why was Catherine a suspect in the death of her husband's older brother in 1538? Because his death meant that she would be queen. That's right. And he suddenly keeled over playing tennis. It was very suspicious. Question four. Who was Diane de Poitiers?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3310.131

No. Question five. Can you name three of Catherine's ten children?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3316.936

Yes. Hercule. Yes. And Henri. Very good. Question six. What allegedly was Catherine's flying squadron? Not monkeys.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3334.131

Very good. Question seven. How did her husband, King Henri II, die rather horribly? He died in a jousting incident. Question eight. What was the name of the devastating conflict that lasted from 1562 to 1598 in France?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3357.501

Oh, yeah. Yes, I'll let you have that. That's well done, yeah. So it's called The Wars of Religion and the St Bartholomew's Day Massacre. Well done, well remembered. OK, and question nine. Which powerful Catholic family did Catherine have to contend with during her time as regent and queen mother?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3375.249

And you did it beautifully. And this for a perfect 10 out of 10. Shafi Korsandi. Wow. Question 10. Which title did Catherine give herself that had never been used before in France?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3391.402

The queen mother, mother of the country. Mother of France. I'm giving you 10.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3401.49

And you did so well because we had so many random Henri's and Francoises just bouncing around.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3415.834

OK, well, thank you so much, Estelle. Thank you, Shappi. And listener, if you want to hear more of Shappi, you can check out our episodes on Justinian and Theodora, another fascinating royal rags-to-riches tale. Or, of course, the ancient Olympics episode, if you want to get your Olympics nostalgia vibes on.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3429.601

And for more quality queens, we have episodes on Emma of Normandy and Eleanor of Aquitaine. And remember, if you enjoyed the podcast, please leave us a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. And I'd just like to say a huge thank you to our guests.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3443.648

In History Corner, we had the excellent Dr Estelle Paranc from Northeastern University, London. Thank you, Estelle.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3452.81

And in Comedy Corner, we had the sensational Shaparak Korsandi. Thank you, Shappi.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3458.652

And to you, lovely listener, join me next time as we crown another historical subject. But for now, I'm off to go and crash a wedding and dip my nips in everyone's glasses. This episode of You're Dead to Me was researched by Hannah Cusworth. It was written by Emmy Rose Price Goodfellow, Emma Neguse and me. The audio producer was Steve Hankey and our production coordinator was Ben Hollands.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

3479.124

It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook. You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

350.707

And then saying, you now need to move into that house.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

361.874

They're into the second Florentine Republic. He's given this land that he has to go and fight for. He marries the French noble, who is royal.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

383.699

I'm doing my best, all right? You're telling my mum.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

437.713

No, it's the Pope who sets them up.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

441.696

So you've got your classic Nepo baby thing. You know, Lorenzo's uncle is the Pope. That's always nice. Very handy. And then you've got the combination of two illustrious houses, the Medici, French royal family... So we can imagine that her childhood, Katerina's childhood, would be... Amazing. Amazing, luxurious, glamorous. Not the case, Estelle.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

496.976

They're not a very robust family, are they? No, no. I mean... It's tragic. It's tragic. And then on the third one, it starts to become almost funny because the third time around, you're like, how many people? I mean, seriously. That's really sad.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

57.23

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I am a public historian, author and broadcaster. And today we are grabbing our crowns and galloping back to the 16th century to learn all about the famous French queen Catherine de' Medici. And to help us, we have two very special guests.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

572.648

Very affordable rates. As a historical consultant. So how do you think the Pope, her uncle, Clement VII, secures her future? She's a young woman. She's 11, 12 years old. What do you think the Pope does to make sure she's got a backup plan?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

619.152

Normally on this show, I have to honk my problematic marriage klaxon. This time around, I'm going to honk my kind of sad marriage klaxon, but sort of like they're both so young.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

664.876

His name is Henri, right? Henri, yeah. Yeah, OK.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

683.908

Okay, all right. I'm not going to honk my problematic marriage collection. I'm going to revoke the honking, but I am going to say 14 is very young. Just psychologically and developmentally. But at the time, I understand.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

708.359

But at this stage, I think we can perhaps update the name because she was Caterina de' Medici. But now she's Catherine.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

717.682

OK, OK. No, that's fine. That's fair. Catherine. OK, so planning the wedding, Shafi. Yeah. What big entertainment would you lay on if you were the wedding planner for this big, grand festivity? Now, the King of France is laying on a wedding. François, he's laying on a wedding for Henri and for Catherine. What's going to be at that party?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

75.356

In History Corner, she's Associate Professor in Early Modern History at Northeastern University London. She's an expert on royal and diplomatic studies in 16th and 17th century Europe, especially queenship. And luckily for us, she's also the author of The Incredible Blood, Fire and Gold, the story of Elizabeth I and Catherine de' Medici. It's Dr Estelle Perronc. Welcome, Estelle.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

753.921

I wish. That would be my dream wedding, I think, zorbing and pick and mix.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

774.069

I love the way you're trying to lay the groundwork for defence here. We haven't even said it yet.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

798.015

She wasn't that shocked, which is remarkable. I love it.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

809.223

It was the after party, but the party continues. And what happens is that professional ladies dip their boobs into wine glasses and then everyone licks off the wine and then it turns into an orgy.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

836.781

Yeah. I mean, it's likely, isn't it? I think we can call it, what, a nipple-tipple? I don't know. Do you know what?

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

845.226

Good luck, Mark. OK, so we have teenage newlyweds, Catherine and Henri. They're first set up by the Pope. Already a very dramatic episode of Married at First Sight. But then the drama really ramps up because another woman enters the marriage. It's all very Lady Diana. Indeed, Diana is appropriate because this lady is Diane, Diana de Poitiers.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

911.124

Well, she's 19 years older.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

964.323

So Diane de Poitiers would be the Camilla in this story.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

973.953

And so Henri is wearing her colours, the black and white. Absolutely. So in front of court, he's wearing her official uniform.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

98.384

And in Comedy Corner, she's an award-winning comedian and author. You'll have seen her on all the TV, on such shows as Live at the Apollo, Michael McIntyre's Comedy Roadshow, Have I Got News For You. Maybe you've read one of her brilliant books, including her recent exploration of living with ADHD, Scatterbrain.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

988.256

So that's like making her minister for culture. Exactly, yeah.

You're Dead to Me

Catherine de’ Medici: the real Serpent Queen of France

999.631

And Catherine really, really wants a castle, a beautiful chateau called Chenonceau. It's a very beautiful castle to visit.

You're Dead to Me

History of Broadway (Radio Edit)

1038.007

So you're standing at the front of the stage singing to the audience, even though you're talking to your colleague on stage who stood to your side. In the 60s, firstly, we get electrified instruments, so guitars and drums. But that also means that kids are listening to rock and roll now. They don't want to go to the theatre. They want to listen to the Stones. So does the theatre change again?

You're Dead to Me

History of Broadway (Radio Edit)

1097.428

There are some duds, Hannah. Oh, yeah. Nice.

You're Dead to Me

History of Broadway (Radio Edit)

1103.111

Desiree, if I say to you 1972's classic Via Galactica...

You're Dead to Me

History of Broadway (Radio Edit)

1132.409

You're doing really good. Hannah, do you want to tell Desiree what the... The technology was?

You're Dead to Me

History of Broadway (Radio Edit)

1149.538

Bring it back. That's what I say.

You're Dead to Me

History of Broadway (Radio Edit)

1156.945

Bang, bang. Saying that, I would love to, if anyone would like to produce the Van Halen musical, jump with me. I know where to get some trampolines. Let's do this. The 1970s was a time of a bit of crisis in New York. It's not great. There were sort of big campaigns to try and get New York up and running again, bring Broadway back.

You're Dead to Me

History of Broadway (Radio Edit)

1174.742

But also you then get the arrival of Andrew Lloyd Webber and the mega musical. What do you think of as a mega musical in your head?

You're Dead to Me

History of Broadway (Radio Edit)

1203.143

So werewolves, stunts.

You're Dead to Me

History of Broadway (Radio Edit)

1212.286

So obviously you've got Les Mis, Miss Saigon, Starlight Express, Cats. We get Lloyd Webber coming in and fixing the show. Nothing changes. You can perform it a thousand times in every city in the world. It's never going to be different. Yeah.

You're Dead to Me

History of Broadway (Radio Edit)

1286.497

It is, isn't it? It is quite an American tradition. Well, I mean, I don't want to speak on behalf of America.

You're Dead to Me

History of Broadway (Radio Edit)

1305.03

Exactly. I mean, it's called show business, right? And I mean, ticket prices soar in this time, don't they?

You're Dead to Me

History of Broadway (Radio Edit)

1334.339

The 90s, obviously, is where we get the Disney Corporation saying, well, we've got some musicals.

You're Dead to Me

History of Broadway (Radio Edit)

1340.421

Let's see what we can do here. Spectacles? you got it you got your huge hits Beauty and the Beast and The Lion King obviously mega smashes again but then of course you know the 20th 21st century rather the millennium brings the horrors of 9-11 of course but also kind of a different era again how is Broadway adapting to that 20 years ago or so

You're Dead to Me

History of Broadway (Radio Edit)

1383.003

That's really interesting because I think people often assume they're kind of very cynical, modern cash cows for musical artists like ABBA or whatever, where you're just cashing in on your back catalogue.

You're Dead to Me

History of Broadway (Radio Edit)

1453.771

And then obviously Wicked is a massive hit as well.

You're Dead to Me

History of Broadway (Radio Edit)

1462.396

I was going to say, 1902 we started.

You're Dead to Me

History of Broadway (Radio Edit)

1491.953

What? Not hunting her, like, literally. That'd be amazing. Like The Running Man, but with Dorothy.

You're Dead to Me

History of Broadway (Radio Edit)

1544.037

Desiree, final thoughts. You send your regards to Broadway. Have we convinced you of the joys of singing?

You're Dead to Me

History of Broadway (Radio Edit)

1572.207

Yeah. There's nothing new under the sun. Often on this show, we're always like, yeah, history, we've done it before.

You're Dead to Me

History of Broadway (Radio Edit)

1584.784

OK, well, it's time now for the nuance window. This is where Desiree and I enjoy our intermission ice creams. And Dr. Hannah gets two minutes on stage to sing us something we need to know. Take it away, Dr. Hannah.

You're Dead to Me

History of Broadway (Radio Edit)

1731.357

Lovely. Thank you so much. Desiree, any thoughts on that?

You're Dead to Me

History of Broadway (Radio Edit)

1773.32

Listener, for more musical chat with Desiree, check out our episodes on Paul Robeson, Josephine Baker, and also Pythagoras, because we talked briefly about his octave stuff. For a rousing encore on black American culture, we've got a lovely episode on the Harlem Renaissance, which I really enjoyed.

You're Dead to Me

History of Broadway (Radio Edit)

1787.89

And remember, if you've enjoyed the podcast, please leave us a review, share the show with your friends. Subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But I'd just like to say a huge thank you to our guests in History Corner. We have the wonderful Dr Hannah to Risingham Robbins from the University of Nottingham. Thank you, Hannah. for having me.

You're Dead to Me

History of Broadway (Radio Edit)

1804.321

And in Comedy Corner, we had the brilliant Desiree Birch. Thank you, Desiree.

You're Dead to Me

History of Broadway (Radio Edit)

1811.705

Hey, if people want to sing their reviews, I'm open to it. And to you, lovely listener, join me next time as we stage a revival of another forgotten historical masterpiece. But for now, I'm off to go and perform a one-man version of Frozen in my garden shed until the Disney lawyer shut me down. Bye!

You're Dead to Me

History of Broadway (Radio Edit)

1860.245

LAUGHTER Yes, exactly. LAUGHTER This is how we investigate cybercrime.

You're Dead to Me

History of Broadway (Radio Edit)

193.003

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are collecting our costumes and can-canning into the chorus line as we learn all about the history of Broadway. And to help us, we have two very special theatrical stars in History Corner.

You're Dead to Me

History of Broadway (Radio Edit)

212.262

They're an associate professor in popular music and the director of the Black Studies Department at the University of Nottingham. They're an expert on musical theatre and research race and gender identity in popular culture. They've published on everything from The Wizard of Oz to Hamilton and my favourite, Frozen. No, you let it go. It's Dr Hannah to Risingham Robbins. Welcome.

You're Dead to Me

History of Broadway (Radio Edit)

232.202

Delighted to have you here. And in Comedy Corner, she needs no introduction on this show, but I do still have to do one. So she's a comedian, actor, writer. You'll have seen her on all the telly. Taskmaster, Frankie Boyle's New World Order, the Horn Section TV show Netflix is too hot to handle.

You're Dead to Me

History of Broadway (Radio Edit)

246.254

And you'll know her from our many, many episodes of this very podcast, including recent highlights, The Columbian Exchange and Pythagoras. It's your Dead to Me's leading lady, Desiree Birch. Welcome back, Desiree.

You're Dead to Me

History of Broadway (Radio Edit)

260.205

I think you've done enough episodes now that maybe... I'm learning my British slang.

You're Dead to Me

History of Broadway (Radio Edit)

264.712

This is under the test. Are you a fan of musical theatre? Do you go to Broadway when you're maybe back home and to the West End?

You're Dead to Me

History of Broadway (Radio Edit)

275.558

Are we about to hear something?

You're Dead to Me

History of Broadway (Radio Edit)

325.256

This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And we've all watched a musical, haven't we? Whether it's a classic like West Side Story or My Fair Lady, a Lloyd Webber wonderpiece like Phantom of the Opera, a modern smash like Wicked or Hamilton. Most of us have seen a stage musical at some point. Plus there are the film adaptations as well.

You're Dead to Me

History of Broadway (Radio Edit)

344.211

Catherine C. Jones in Chicago. You might have swooned over Hugh Jackman in Les Mis. What about the history of the mega popular art form that we call Broadway? How have Broadway shows changed over the years and just who was Imogen the Cow? Let's find out. But I'm going to start with the basic question. What is a Broadway musical?

You're Dead to Me

History of Broadway (Radio Edit)

425.69

Is the West End just Broadway but in London, or is that a different thing?

You're Dead to Me

History of Broadway (Radio Edit)

453.271

Oh! LAUGHTER Push down moment. Okay. This American theatrical tradition, there are words I want to chuck at you. Vaudeville, burlesque, theatre, musical, minstrel shows. Are those all the same thing?

You're Dead to Me

History of Broadway (Radio Edit)

484.395

Quite literally tap in and out.

You're Dead to Me

History of Broadway (Radio Edit)

523.102

Let's get to 1902 when Broadway gets going, I think, Desiree, and one of the first productions was The Wizard of Oz. Quite an unusual musical. Do you know why?

You're Dead to Me

History of Broadway (Radio Edit)

539.059

No songs. OK, yeah. No music. I mean, or some music, but not a score.

You're Dead to Me

History of Broadway (Radio Edit)

573.575

We won't do that bit.

You're Dead to Me

History of Broadway (Radio Edit)

576.116

The production also changed a couple of other things about The Wizard of Oz, Desiree. They changed a major character from the book and the later film. Do you want to guess which character did not appear in 1902's... Dorothy? That would be amazing. LAUGHTER It's just some bloke called Rob.

You're Dead to Me

History of Broadway (Radio Edit)

593.261

We need to sell these tickets. No, Toto the dog was replaced by Imogen the cow. Oh, there we go. There we go. Let's talk about the development of increased visibility of these black performers, you said. Minstrelsy, obviously racist and an unfortunate problematic history, but it created perhaps a culture whereby black performers could get work.

You're Dead to Me

History of Broadway (Radio Edit)

658.433

Because this is 1903.

You're Dead to Me

History of Broadway (Radio Edit)

716.204

They blocked traffic. We've got to fly through the 20th century.

You're Dead to Me

History of Broadway (Radio Edit)

723.048

In the 1920s, there was a new entertainment phenomenon that showed up. Desiree, what happened in Hollywood in 1927 that had a major impact on Broadway?

You're Dead to Me

History of Broadway (Radio Edit)

744.819

Yeah, yeah. You've got the coming of the talkies. And it's the jazz singer, which is the first talkie, which actually really brings us back to Broadway, doesn't it? It's a musical. And this hurt the popularity of theatre simply because, I guess, cinema was offering a brand new experience, right? You could go for a much cheaper ticket to go and listen to songs, listen to dialogue.

You're Dead to Me

History of Broadway (Radio Edit)

762.384

You don't need to go to the theatre anymore.

You're Dead to Me

History of Broadway (Radio Edit)

809.078

So the 1940s is where the American economy is sort of supercharged by World War II. And by the 50s, obviously, it becomes the kind of dominant superpower. And that's also where we get the golden age, inverted commas, of the Broadway musicals. Desiree, do you know who the famous writing duo were who kind of dominated that decade?

You're Dead to Me

History of Broadway (Radio Edit)

828.083

It is, yeah, very good, yeah.

You're Dead to Me

History of Broadway (Radio Edit)

888.891

And Oklahoma, I mean, 43, middle of the war, America, you know, it's sort of feel good.

You're Dead to Me

History of Broadway (Radio Edit)

895.318

Yeah. Oh, what a beautiful morning. Yeah. This is where we're getting the characters singing their feelings.

You're Dead to Me

History of Broadway (Radio Edit)

921.771

They're driving the actual plot. Yeah, absolutely. The I want song or whatever. Yeah, yeah, yeah.

You're Dead to Me

History of Broadway (Radio Edit)

966.61

They must be so bored of it by now. Yeah, and My Fair Lady is another one to shout out, which is Lerner and Lowe, isn't it? So we've got other double acts coming in. We've got other creative teams. West Side Story is Bernstein and Sondheim, who are both giants. Yes. Let's talk about the actual sound being made, because we get the arrival of microphones and amplification.

You're Dead to Me

History of Broadway (Radio Edit)

986.577

But prior to the mics, how are these performers getting through a two-hour show and hitting the back rows with their vocal techniques?

You're Dead to Me

Georgian Courtship (Radio Edit)

101.05

I was going to say, this is a reflex for you, right? I mean, Ostentatious, a brilliant improv comedy troupe. That means I'm guessing you're already an expert on Georgian social mores.

You're Dead to Me

Georgian Courtship (Radio Edit)

1030.518

Beautifully done. I love the switch midway through.

You're Dead to Me

Georgian Courtship (Radio Edit)

1046.923

Yeah, so he's writing a sort of list of things he's looking for in his wife. So he's a bit pushy, really. It's not really courting so much as here are the criteria you've got to meet if you want to land a man like me.

You're Dead to Me

Georgian Courtship (Radio Edit)

1069.127

I mean, Sally, what is the value of poetry? Why send a poem? What are you hoping to achieve?

You're Dead to Me

Georgian Courtship (Radio Edit)

1104.884

And we've been talking about Barnaby and Lydia, but I mean, the obvious question here, Sally, is do we have evidence of LGBTQ relationships of, you know, ladies who fancy ladies and gents who fancy gents? Because there are dangers and there are perils there, genuine perils, but there must have been. those sorts of relationships? What do we know of them?

You're Dead to Me

Georgian Courtship (Radio Edit)

1216.65

Well, we've got Barnaby and Lydia before he takes her up the aisle. Wink, wink, nudge, nudge. Before they walk up the aisle. We, I guess, need to talk about one of these sort of really fascinating facts that historians of the 18th century know quite well, but I think people are quite surprised to hear. Let's see if you know this one.

You're Dead to Me

Georgian Courtship (Radio Edit)

1233.614

Cariad, what percentage of Georgian brides were pregnant on their wedding day?

You're Dead to Me

Georgian Courtship (Radio Edit)

1242.69

What would you think is a sort of normal guess that people might say?

You're Dead to Me

Georgian Courtship (Radio Edit)

1249.653

Yeah, I think that's about right. It's just over a third, isn't it? It's a good guess. But what would happen if the marriage did not take place?

You're Dead to Me

Georgian Courtship (Radio Edit)

125.804

So, what do you know? This is where I have a go at guessing what our lovely listener will know about today's subject, and I'm willing to bet quite a lot listeners will have at least watched one Jane Austen adaptation. They get blooming everywhere.

You're Dead to Me

Georgian Courtship (Radio Edit)

1303.604

So Lydia could sue Barnaby even if she were not pregnant?

You're Dead to Me

Georgian Courtship (Radio Edit)

1314.721

I mean, the settlements issued by the courts were big. I mean, they're quite a lot of money, aren't they? I mean, they're 250 quid, which was probably two years earnings for a middling person. That's a lot of money to cough up at once.

You're Dead to Me

Georgian Courtship (Radio Edit)

1352.021

The sort of Miss Havisham effect.

You're Dead to Me

Georgian Courtship (Radio Edit)

1354.364

Let's assume Lydia and Barnaby have not thrown it all away. Love has won out in the end. Hooray!

You're Dead to Me

Georgian Courtship (Radio Edit)

1361.19

What's the wedding going to look like, Cariad?

You're Dead to Me

Georgian Courtship (Radio Edit)

141.916

Maybe you swoon over Rickman and Winslet in Sense and Sensibility, or Colin Firth and his sexy see-through shirt in Pride and Prejudice, or perhaps you're one of the

You're Dead to Me

Georgian Courtship (Radio Edit)

1417.247

And what about honeymoons, Sally? Do you go on a big honeymoon? Do you go to Paris? Do you take two weeks off to go and tour the counties?

You're Dead to Me

Georgian Courtship (Radio Edit)

1459.426

So what do you know now? This is where Cariad and I fan ourselves flirtatiously and binge on bonbons. And Sally's going to tell us something we need to know for two uninterrupted minutes. And without much further ado, Dr. Sally, can we have the nuance window, please?

You're Dead to Me

Georgian Courtship (Radio Edit)

148.619

astonishing 82 million people who watched Bridgerton or the slightly fewer number of people who were charmed by Mr Malcolm's List still a very nice movie or maybe you fell for Anya Taylor-Joy's Emma or Dakota Johnson's sort of Fleabag style mugging in Persuasion there's Love and Friendship my favourite with the very funny Kate Beckinsale basically there's loads and loads of stuff this is one of the most romanticised eras in British history and I say romanticised in both meanings of the word but what were the real rules and rituals of courtship

You're Dead to Me

Georgian Courtship (Radio Edit)

1559.028

Amazing. Thank you so much. Carrie, any final thoughts on that?

You're Dead to Me

Georgian Courtship (Radio Edit)

1583.897

And listener, if after today's episode you're desperate for more gorgeous Georgians, why not listen to our episode on the experiences of black people in Georgian England or our election special as well. And if you want more chaotic romances of the romantic poets, check out our episodes on Lord Byron and Mary Shelley. They're both very messy drama queens. You'll find them all on BBC Sounds.

You're Dead to Me

Georgian Courtship (Radio Edit)

1602.831

And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends. Make sure to subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But all that's left for me to say really is a huge thank you to our guests. In History Corner, we had the amazing Dr Sally Holloway from Oxford Brookes University. Thank you, Sally.

You're Dead to Me

Georgian Courtship (Radio Edit)

1620.779

And in Comedy Corner, we had the fabulous Cariad Lloyd. Thank you, Cariad.

You're Dead to Me

Georgian Courtship (Radio Edit)

1630.982

And to you, lovely listener, join me next time as we form the perfect union of comedy and history with another whirlwind historical engagement. But for now, I'm off to go and launch my new dating app, The Look of Love, where you can only post tiny miniatures of your eyes.

You're Dead to Me

Georgian Courtship (Radio Edit)

177.839

In Georgian Britain, what did a man of good fortune do when in want of a wife? Well, today we are going to lay out a how-to dating guide. So we're going to crack on, and Dr Sally, basics first for our listeners who aren't entirely familiar with the Georgians as an era. Who, what, when, why, how? What are the Georgians?

You're Dead to Me

Georgian Courtship (Radio Edit)

220.26

If we're going to have a dating guide, we need to have a couple. So let's imagine our typical middle-class London living singleton, Cariad, what's his name?

You're Dead to Me

Georgian Courtship (Radio Edit)

230.879

Mr. Barnaby Sykes. And Barnaby is thinking of finding a wife. It's that time. And what do you think his motivation is for joining the marriage market, Cariad?

You're Dead to Me

Georgian Courtship (Radio Edit)

24.986

And to help us navigate this topic with sense and sensibility, we have two very special guests. In History Corner, she's a Vice-Chancellor's Research Fellow in History and History of Art at Oxford Brookes University, where she studies the history of gender and emotions in 18th and 19th century Britain.

You're Dead to Me

Georgian Courtship (Radio Edit)

312.377

But there is that line from Matthew Bolton, don't marry for money, but marry where money is.

You're Dead to Me

Georgian Courtship (Radio Edit)

332.026

How old do you think our bachelor, Mr. Barnaby Sykes, is? And what's the age range of ladies that he is seeking to match with?

You're Dead to Me

Georgian Courtship (Radio Edit)

356.857

So our young romantic hopeful, Barnaby Sykes, has decided to fall in love. But how does he find a date?

You're Dead to Me

Georgian Courtship (Radio Edit)

40.112

Indeed, she's the author of The Game of Love in Georgian England, Courtship, Emotions and Material Culture. Perfect for us is Dr Sally Holloway. Welcome, Sally.

You're Dead to Me

Georgian Courtship (Radio Edit)

425.637

We've got our Barnaby Sykes. The lady he's chatting to is rather boring, but he spots a hot young lady on the other side of the room, and she is called Cariad.

You're Dead to Me

Georgian Courtship (Radio Edit)

446.636

All right. So we've got Barnaby and Lydia. They've met across a crowded room and their families are willing to drift them in. But what's the next stage of Georgian dating then?

You're Dead to Me

Georgian Courtship (Radio Edit)

470.72

You've gone big there, Carrie.

You're Dead to Me

Georgian Courtship (Radio Edit)

498.186

Sweets is one option, but that can backfire. Cariad's brooches, is that a bit too fancy or is brooch good?

You're Dead to Me

Georgian Courtship (Radio Edit)

50.538

Welcome back, Cariad.

You're Dead to Me

Georgian Courtship (Radio Edit)

579.082

So two hearts next to each other and then a bit of hair to make it creepy.

You're Dead to Me

Georgian Courtship (Radio Edit)

588.955

Barnaby and Lydia have not had a smooch yet. Are they holding hands at this stage?

You're Dead to Me

Georgian Courtship (Radio Edit)

599.081

Oh, OK. And Cariad, we're going to show you some specific types of love tokens that were gifted by wealthier individuals. And we're going to show you some images now and you can describe them for us.

You're Dead to Me

Georgian Courtship (Radio Edit)

6.593

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are channelling our inner Colin Firths and emerging soaking wet from the lake of history to bring you a special guide to love and courtship in Georgian Britain.

You're Dead to Me

Georgian Courtship (Radio Edit)

650.325

And then the lips are for kissing. Do you kiss the locket?

You're Dead to Me

Georgian Courtship (Radio Edit)

667.125

Lovely. All right, so we've got various gifts you can give, but let's move on to another tool of courtship rituals. And this is a really big one. This is very important, actually. Cariad, if you really fancy someone and you're trying to lock them down and make this legit, what do you do next?

You're Dead to Me

Georgian Courtship (Radio Edit)

683.619

It's a gift of sorts. I'm thinking more of communicating your thoughts.

You're Dead to Me

Georgian Courtship (Radio Edit)

688.243

Yeah, a love letter.

You're Dead to Me

Georgian Courtship (Radio Edit)

696.51

Sorry. After the gift giving, or perhaps parallel to the gift giving, is the writing your thoughts and feelings and declaring your love on paper?

You're Dead to Me

Georgian Courtship (Radio Edit)

752.277

The increase of the letters importance is also to do with rising literacy rates. This is an era where more people can read and write.

You're Dead to Me

Georgian Courtship (Radio Edit)

820.526

All right, so we've got quite a sort of important script of dating here. Where are they learning how to do this? Are mum and dad explaining it? Are they reading it in books?

You're Dead to Me

Georgian Courtship (Radio Edit)

846.176

Hot, absolutely, yeah.

You're Dead to Me

Georgian Courtship (Radio Edit)

867.371

And the other thing to mention here, Carianne, is these letters, they're not private.

You're Dead to Me

Georgian Courtship (Radio Edit)

915.53

Oh, wow. So it's not even secure communication, right?

You're Dead to Me

Georgian Courtship (Radio Edit)

922.713

Wow. The lack of security on the old sending back your message is a bit worrying.

You're Dead to Me

Georgian Courtship (Radio Edit)

938.568

The next thing we were going to talk to you about, Cariad, was poetry. That's another huge element of the courting here is the either writing your own or... quoting your sort of favourite poets, quoting bits and bobs. And actually, we've got a cotton trader called Joseph Strutt, where he's not even really trying to woo the lady he loves.

You're Dead to Me

Georgian Courtship (Radio Edit)

954.92

He's just sort of listing the virtues he's demanding in a wife. He's like, this is what I'm looking for. You must meet all these criteria, wisdom, virtue, modesty, prudence, all the hot ones. But Cariad, we thought maybe you'd like to read us Mr. Joseph Strutt's poetry.

You're Dead to Me

Georgian Courtship (Radio Edit)

977.748

He's probably quite comfortably well off.

You're Dead to Me

Georgian Courtship (Radio Edit)

980.869

But this is his poetry.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1008.192

There's also another amazing... We've had some amazing names. We've already had Thomas Cobden Sanderson, who gave us the phrase Arts and Crafts Movement. But now I have to present to you Miss Eglantine Jebb.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1027.207

So Mrs. Eglantine Jebb is the... Eggie Jebb. Oh, I love Eggie Jebb. She sets up the Home Arts and Industries Association.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1085.994

So we get the broadening out of the movement, the ethos, beyond the arts and crafts movement of William Morris' control. It gets into Edinburgh Social Union in 1885. It's in Ireland by the 1890s. It's really gone beyond his control, but in a good way. He's not trying to hold it.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1104.209

Yeah, which is amazing. There's one question I suppose we should address is that although there's the sort of democratic element of recruiting the boys from the school for the destitute and trying to bring women in, all of the artists we've met so far. Amen. Well, no, we've had good, really cool, but I'd say they're of a certain class.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1124.123

They shop at Waitrose, I think.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1127.085

Yeah, a little bit. So I'm just I'm wondering if they walked the walk as well as talking the talk when it came to genuinely changing who could be an artist and who could buy this stuff. Is it middle class people for middle class people?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1190.716

So a heart in the right place, I think, Cariad. Yeah.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1224.313

And women in the movement, were they given equal weighting? Were they given equal respect, stature? I mean, we've heard lots of names, but they're often the wives of or daughters of famous men.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

126.202

He'd love to be Elizabethan.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

130.144

So, what do you know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And I imagine most people will have heard of the big dog of the arts and crafts movement, William Morris. His floral designs are still printed on curtains, wallpaper, notebooks, pencil cases, even on football kits.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1335.436

How does the arts and crafts movement finish? I mean, do people just go, that's enough. Thank you.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1345.219

We need to eat on this table.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1387.545

It's back in fashion. Maybe it never left.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1392.57

The nuance window! time now for the nuance window. This is where Cariad and I recline in our drawing room with our embroidery samplers while Dr Isabella has two minutes to tell us something we need to know about the arts and crafts movement that we haven't heard already. So my stopwatch is ready. Take it away.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

151.726

What's more, modern homeware brands like Cath Kidston owe a huge amount to the arts and crafts movement, and we see the design legacy in TV shows like Grand Designs and Queer Eye. But the wider history of the movement is perhaps more hidden. Beyond the cutesy curtains, what was arts and crafts really about? Why did traditional manufacturing methods have a resurgence in Victorian Britain?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1564.078

But ironically, it's back to mass production again, isn't it?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1567.121

Yeah, it's this sort of memification thing.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1595.766

Listener, if after today's episode you want more Cariad Lloyd in your life, you can check our episodes on Mary Wollstonecraft. Well, craft. Arts and Wollstonecraft. Yeah, baby.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1606.213

And if you want to hear more about British artistic movements, why not listen to our 100th episode on the Bloomsbury Group. And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But I'd just like to say a huge thank you to our guests.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1620.222

In History Corner, we had the incredible Dr Isabella Rosner from the Royal School of Needlework. Thank you, Isabella.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1629.067

And in Comedy Corner, we had the cracking Cariad Lloyd. Thank you, Cariad.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1636.369

And to you, lovely listener, join me next time as we reupholster another neglected historical subject. But for now, I'm off to go and teach myself ceramics and maybe blow up my house. Bye!

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

1677.348

LAUGHTER Yes, exactly. LAUGHTER This is how we investigate cybercrime. We look for the yachts.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

172.889

And what is a strawberry thief? Let's find out. Right, Dr Isabella, where do we start our story?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

227.205

Not for Victorians.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

257.026

There is a quote by Morris in an 1877 lecture.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

27.885

In History Corner, she's curator of the Royal School of Needlework and a research consultant at Whitney Antiques. She's an art historian of the material culture of the 17th to 19th centuries. You might have listened to her podcast, So What? It's a pun. It's Dr. Isabella Rosner. Welcome, Isabella.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

300.135

Oh, have you read the script?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

377.894

We have then a movement that comes along that's reacting to the trauma of the Industrial Revolution. It is a trauma, right?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

384.076

These artists are responding in a way that feels like they're looking for escapism. And they go hunting for escapism in the past. They're interested in Elizabethan, but it's the medieval world that they're particularly drawn to.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

421.812

we should probably mention Ruskin. Do you know Ruskin?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

428.117

Try another man's name from the period.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

433.442

You get there in the end. I've heard of him. He's an extraordinary figure in the 19th century. He's slightly debated these days. Everything.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

44.949

We're delighted to have you here. And in Comedy Corner, she is a comedian, actor, improviser, writer and podcaster. You may know her from her podcast, Griefcast, an award-winning show. It's spin-off book, You Are Not Alone, her many TV appearances, her Weirdos Book Club podcast with lovely Sarah Pascoe, or her new children's book, The Christmas Wishtastrophe.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

440.668

Absolutely everything. Architect, critic, painter, writer, philosopher, poet.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

445.332

And he's kind of an inspiration for the arts and crafts movement.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

483.789

Let's move on to William Morris. We've name-checked him already. I think many people would recognise a William Morris print. Who was William Morris? Where was he educated? How did he get his start?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

536.9

Too busy. William Morris is an interesting fella. And much like the Bloomsbury group that we spoke about in our 100th episode, the arts and crafts movement, again, is a bunch of university pals going, hey, I'm a bit posh and fancy like you, and we are all friends.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

62.942

And you'll definitely remember her from our episodes about Agrippina the Younger, Georgian Courtship. It's the wonderful Cariad Lloyd. Welcome back, Cariad. Hello.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

7.193

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are packing our William Morris book bags and heading back to the 19th century to learn all about the arts and crafts movement. And to help us spin this story, we have two practitioners of very different arts.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

730.14

Amazing. Cariad, we're used to artists being useless at the basic.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

737.604

No, this goes really well. They expanded to bigger premises near Wimbledon.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

745.268

I'm going to be an agent provocateur here, Isabella, because as a historian, I'm going to have to say, one of the reasons the company flourishes is because of the Industrial Revolution. Mm.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

757.876

I mean, come on. I mean, they're rejecting it.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

762.541

I know I'm being annoying, but we have to be true about it. The Industrial Revolution creates a middle class.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

78.272

You're an expert in the Regency period.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

807.679

Yeah, and that's always the case, right? You can have grand lofty ambitions, but the economics are always going to underpin, does this work or not? There's another artist we should mention, actually, because she's slightly different in that she went outside. Gertrude Jekyll.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

82.154

No, you're very good. You're very good. But today we're in the Victorian era.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

820.167

Who did interior, but she also did gardens.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

835.677

Yeah, I mean, there's quite a lot of good names in this episode.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

844.081

What's interesting about Morris, he's obviously self-taught, as we've heard, all these things he's picking up. He's also getting other people to teach themselves. He's inspiring others. We know of an artist called William de Morgan. He teaches himself ceramics. He has a minor mishap.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

85.416

And even into the early 20th century. So what do you know of the arts and crafts movement?

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

858.469

Do you want to guess what happens? Does he blow up a kiln? Yes, he does.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

866.896

It's like his house is on fire.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

908.886

The thing that I find quite interesting is the arts and crafts ethos moves beyond Morris' control. You see that in music, you see that in comedy.

You're Dead to Me

The Arts and Crafts Movement (Radio Edit)

920.056

But we get a sense of an arts and crafts movement out of England into Scotland, into Wales, into Ireland, maybe internationally, I don't know.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

100.844

And you'll definitely remember her from our episode on Emma of Normandy, an absolute classic. It's Jen Brister. Welcome, Jen. Oh, Greg, it's an absolute pleasure. We had a lot of fun last time in medieval England trying to remember that everyone was called Elfgivu.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1020.593

The age old trade. Can you go and trade, please? And bring lots of swords. Yeah. And where is he going?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1037.983

And Yucatan is the peninsula of eastern Mexico, right? Yes, yes. I've been there on holiday. It's lovely.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1075.25

So we said promotion, but is this Velázquez sending Cortés off to his death?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1155.149

Once more with feeling. I've got a really good... I reckon this time they'll welcome us, yeah?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1212.208

And he founds Veracruz, the first Spanish town in Mexico. He immediately divorces Velázquez from his sort of chain of command, right? He's just like, I founded a town and I answer to the Spanish king and Velázquez is dead to me and everything's fine.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1255.5

I actually left my wife and children back there, actually.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1400.052

Once you've done one crime, you can't go back and go, I'm so sorry.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1409.198

We know he's ambitious. So he's obviously trying to feather his own nest. Tiny bit of trivia that's completely unrelated to the history, but I love it, is that the actor who voiced Cortez in the Road to El Dorado animation also was the voice of Winnie the Pooh.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1423.84

I'm just hearing the voice of Winnie the Pooh whenever Cortez speaks. Of course, Winnie the Pooh craves pots of honey. Cortez is after pots of money. So he's off. He's off seeking gold and glory in 1519. And he is going to meet... Melintzin, finally we get our meet cute, except it's not a meet cute, it's a meet yuck, because she is enslaved and he is arriving as a conqueror.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1472.104

Cortez has shown up, obviously not able to speak any of the languages spoken by the indigenous people he's meeting. He's like, you know, hola. And they're like, what? So that's not going to work. So how does the translation work then? You know, if Cortez wants to say something to the Maya...

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1548.303

Does she become Marina then and there?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1604.093

And Cortés is presumably using charm and violence, those two lovely combinations.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

174.994

This is the So What Do You Know, where I have a go at guessing what you, our lovely listener, might know about today's subject. I'm guessing you've heard the name Cortez, the Conquistador. I feel like it's a name that's in the ether. He's appeared in all kinds of TV shows and films, most notably as the big baddie in the DreamWorks animation The Road to El Dorado.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1776.875

We're talking an army of 600 Spanish soldiers. It's not a huge army.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1790.216

So we have to conquer Tenochtitlan. Well, we're not going to do it. Cortes is going to do it. A vast, vast citadel, an incredibly sophisticated, huge city. Yeah. And 600 Spaniards show up and some allies.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1813.945

And they just, what, ring the doorbell and say, hello, we've come to conquer you?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1837.493

I should take that title. That's my job.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1874.187

They found out about things that were... OK, so Cortez is about to step on various booby traps.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1881.291

No, that's not a fruit. That's a grenade.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1914.117

And so we know that Moctezuma meets Cortes.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1918.46

And then suddenly the city falls. I mean, that's very truncated.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

192.611

But unless you are Mexican or maybe American, I suspect Melintzin, I imagine she's perhaps a lot less familiar as a name. She's the subject of several Spanish language plays, operas and books, and appears in some famous murals, one painted by Diego Rivera. In Mexico City, he was the husband of Frida Kahlo.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

1961.203

He would have controlled the narrative.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2026.498

We forgot about Velasquez, didn't we?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2080.628

Yeah, Cortés races off to face them down.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2086.393

Yeah, here's all the gold I've got. Come get some gold.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2092.258

Meanwhile, Pedro de Alvarado has left back in the city of Tenochtitlan. He then goes, oh, I've just heard the Aztecs are threatening to kill us all. We'd better kill them first. Yes, basically.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2124.625

He's not going to leave any evidence of his complicity, is he? He knows what he's doing.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2130.048

Yeah. And so Moctezuma appears on a terrace to convince his people to sort of calm down. Yeah. And then somehow he dies.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

215.366

Now, Melintzin has also been confusedly conflated with the Mexican folk tale of the wailing woman, La Llorona.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2164.397

So that's the end of Montezuma. Cortes is now in control, I think we can say.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2190.091

Cortes then continues and Mexico is conquered by Spain and it becomes part of the Spanish Empire and sends home all the silver and gold back to Spain. So that's sort of the conquest story. And then Melintzin at this point has kind of done her job. No. Could she not just go, all right, job done, thanks very much, I'm off?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

222.591

Thank you. A vengeful ghost who drowns her own children. Yeesh, you don't want that in a children's movie, do you?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2223.362

I mean, they have a kid together, don't they?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2233.045

But she doesn't marry Cortés because he's married, so she's with Cortés, but she then marries another Spanish woman.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2264.365

The interesting thing about Meliton is that's sort of where the story ends. She dies quite young. She dies in 1529 when she's only... She's barely 30 yet, if that. So that's quite sad. And that's where we leave her in the story, apart from perhaps in your nuance window. But what about Cortez? Does he then say, oh, big thanks to Melinda?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2282.732

Is there a sort of like in memoriam section where he's like, she, you know, I really needed her? Or does he just sort of pretend she never really did anything important?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2299.315

So she got enslaved workers too?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2327.614

Right, so they're legitimate there.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

233.602

No, no. But was the real story of Cortez and Melintzin its own different horror story involving ghosts and stabbings, maybe? How have their reputations changed over time? And what exactly is Moctezuma's revenge? Let's find out. Today, we're doing a bit of a buy one, get one free biography. We'll start with Cortez, purely because he happened to be born first. So, Amy, who was he?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2330.495

Cortez does downplay her a bit in his letters, but other writers sort of put her back into the picture at the time.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2388.377

Yeah, yeah, it does feel very saintly.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2515.593

This brings us to my next question, actually, Amy, because for so long, Cortez has been on the run. from the Spanish authorities. People have been sending armies after him. But he finally conquers Mexico, which means presumably he gets to go to the King of Spain. Hello, this is yours because of me. So do you want to let me off and give me a job? I mean, does he get a reward?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

255.762

Is he an aristocrat? You know, when he's born, is he rich?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2563.894

He can't just settle for something and go, this is fine, this is enough.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2620.797

So, yeah. So the king appoints an investigator, Ponce de Leon, to come after him. Strips him of his governorship in 1526. Yeah. And Cortes does the classic apprentice candidate thing of banging on the boardroom door saying, let me in. Come on, I've got to, you know. And then Cortes is accused of poisoning Ponce de Leon. Yes.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2648.808

What are they dying from? I think they're dying from Cortez. We are.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2699.083

And then, obviously, we mentioned Catalina very early in the episode. His lovely wife, who he left behind. 1522, he'd left her behind. She comes out to see him at last. And they have a party, and then she's found dead. There's reports of finger marks on her throat.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2828.105

Pure coincidence, Amy. What are you talking about? I mean, honestly, the way...

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2862.779

Well, I mean, he's constantly investigated, isn't he? They're constantly trying to investigate him for murder, for embezzlement, for not following orders. He is ruthless. He is avaricious. Even the Spanish think that. But he gets away with it.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2889.304

Because he's got the legal training. He knows how to slow down the court case. OK, how does he die in the end? Does Mox Azuma get his revenge, as the famous idiom would have it?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

2922.21

Because he was a shed and he deserved it. OK, so pleurisy is probably what killed him, but dysentery probably didn't help. OK, so there you go, Jen. Hernán Cortés and Melintzin. It's quite the story, isn't it?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3005.151

time now for the Nuance Window. This is the part of the show where Jen and I machete our way through the jungle for two minutes while Amy tells us something we need to know about Melinsin. So my stopwatch is ready. You've got two minutes. Take it away, Dr. Amy.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

304.424

Fernando Hernando Cortes y Monroy Ipizarro Altamirano is a great name. That does sound quite noble.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

312.267

It is. It's greedy. And what about his childhood?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3165.902

Great. Well, time now for the So What Do You Know Now? This is our quickfire quiz for Jen to see how much she's learned. I was going to say, Jen, are you feeling confident?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3179.429

You have taken some fantastic notes.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3185.932

Eight pages of notes, listener. Jen's written her own Cortez letter.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3194.475

Let's see what we can do. All right, let's have a go. Ten questions. Question one. Where does the name Melintzin come from?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3208.479

Yeah, it's from her Spanish name.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3210.703

That's right, well done, yeah. Plus the honorific suffix, I've seen that at the end, so well done. Question two. On Cuba, why was Hernán Cortés thrown in jail by his boss, Velázquez?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3228.055

He had, absolutely. Catalina, he refused to marry her. Catalina, that's it. And then he was like, all right. Question three. What was legally very dodgy about Cortés leading his conquering expedition to the Yucatan Peninsula of Mexico? What was... What had Velázquez said to him?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3259.238

That's right. He's on the run, basically.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3263.541

Yeah, well done. Question four. How did Malintzin and Cortez first meet?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3278.773

Question five. The Tlaxcalans were crucial allies in the conquest of Tenochtitlan. Without them, how many Spanish soldiers would Cortes have had? 600. It is 600. Well done, yeah. Question six. What happened to Cortez's first wife, Catalina, in 1522?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3297.345

Or died of natural causes and was caught by the neck.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3304.509

What a bastard. Question seven. What was the encomienda system?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3309.331

It was, but technically not slavery.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3315.294

But it turns out you can. But they did. Question eight. What was the name of both Cortes' dad and his son with Malintzin? Martin. It was Martin. Question nine. Who was the Aztec emperor based at Tenochtitlan who ultimately died at the hands of Cortes?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3330.121

Yeah, very good. And this for a perfect ten. How did Cortez die in 1547? He died from pooing out of his bumhole. And or pleurisy. He did. Both of those two things. Ten out of ten, Joan Brister.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3346.536

Only consulted the notes once. Well done, Joan. Thank you. And of course, thank you, Amy, as well. Listener, if you're bursting for more Brista, check out our episode on Emma of Normandy with all the elf-givus.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3360.127

For more Mexican history or famous interpreters, you can do the Aztecs episode, series one, the Sacagawea episode, or the Colombian Exchange episode, which is about Columbus and after that fact.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3371.537

And remember, if you've enjoyed the podcast, please share the show with friends, subscribe to You're Dead to Me on BBC Sounds, and also make sure to switch on your notifications so you never miss an episode. I'd just like to say a huge thank you to our guests. In History Corner, we had the amazing Dr Amy Fuller from Nottingham Trent University. Thank you, Amy. Thanks for having me.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3388.34

It was great fun. And in Comedy Corner, we had the brilliant Jen Brister. Thank you, Jen. Oh, what a delight. I've really enjoyed it. And thank you, Amy. I've learned a lot. And to you lovely listeners, join me next time as we translate another overlooked historical story. But for now, I'm off to write a long letter to the King of Spain, blaming someone else for all of my failures. Bye! Thank you.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

340.635

So there's an element of him telling his own history that he wants people to know. Oh, very much so, yes. Fair enough. But in 1492, do you know what happened in 1492, Jen? Oh my gosh, don't ask me.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

3485.045

It's like I'm reading from a sheet or something, but no, I haven't.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

362.341

Yeah, well, more broadly in history, what do you think is happening in terms of Spanish history or global history in 1492? Some kind of war. I mean, there are a lot of wars, but it's Columbus.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

378.088

Hernán Cortés is seven years old. Columbus sails on behalf of the Spanish king and queen in search of India and bumps into what's called the New World, inverted commas. It's obviously not new to the people who live there. So what makes Hernan Cortes decide he wants to follow in Columbus's wake? Because soon after, like 10, 12 years later, he's on a ship.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

44.613

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. Today we are sharpening our language skills and sailing across the Atlantic to 16th century Mexico to learn all about the conquistador Hernan Cortes and his indigenous translator Malintzin.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

509.111

We should probably turn to Melintzin. In 1504, Cortes is 19 years old. Melintzin is...

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

555.157

And we don't even know her real name, right? We know her by a later...

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

577.976

Oh, OK. So you say she was kidnapped, sold into slavery by the Maya, who were different people entirely from the Aztecs, who were different people entirely from the Nahuatl.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

617.327

And you've mentioned the Aztecs. In our heads, I guess over here in the UK, we know the Aztecs as like the dominant superpower of the region.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

63.761

And to help us understand this pair, we have a pair of very special guests. In History Corner, she's Senior Lecturer in the History of the Americas at Nottingham Trent University. Her research focuses on early modern Spain and Mexico, specifically religion, identity and empire. It's Dr Amy Fuller. Welcome, Amy. Thanks for having me. Delighted to have you here and in Comedy Corner.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

636.216

Yeah, this is the same time as Henry VIII.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

661.552

It's a franchise? Is it like Starbucks?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

679.786

If listeners want to know more about the Aztecs, we did them in series one. So scroll all the way down in the app to the very, very beginning. But that's the political powder keg that is awaiting the Spanish spark, Jen, as you've pointed out, actually, that we've got all these different sort of power bases. But let's get back to Cortes. He's in Hispaniola. So he's not got to Mexico yet.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

697.884

And he is, well, we've already heard he's doing horrible things to the indigenous peoples. He's trying to get cash, but he's got a job.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

755.678

OK. Yes. So forced labour that the Spanish crown is allowing to happen. Yes.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

762.481

So the encomienda system is obviously being cooked up to exploit the indigenous peoples. But the relationship with Velazquez, who's sort of his boss, sort of his patron, sounds quite tense, Jen. It sounds quite... Competitive? Competitive, yes. Why do you think they fell out? What do you reckon the spark was?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

800.595

I mean, that's certainly the conventional way, but actually there's a woman involved. There's a lady involved.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

806.697

And it's not a love triangle. No. It's a love rhomboid. It's a sort of weird... Yes.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

828.667

So you were sort of right there, Jen. He tries to strike out on his own.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

84.235

She's a stand-up comedian, actor and writer. You'll have seen her on all the TV shows, including Live at the Apollo, Mock the Week, Frankie Boyle's New World Order. Perhaps you've seen her on tour or read or listened to her hilariously honest memoir, The Other Mother, I Love the Audiobook, or her podcast, WTB, which I think is short for a slightly ruder title.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

937.374

This is the story we want to see. Run to the airport, run to the jail cell. I love you really, probably. I don't know. That's a great title.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

950.039

I have to point out again, Jen, I'm so sorry, but we're in a double name situation again. We had Evgivu, Evgivu, Evgivu multiple times and we've got Catalina, Catalina.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

958.931

Because Cortez's mum is Catalina.

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

967.903

This is why we've got you back, Jen. We only do it for episodes if we share names. I appreciate it. So, OK, so his wife, begrudgingly, is Catalina Suarez. Catalina Cortez? Or does she keep the Suarez?

You're Dead to Me

Hernán Cortés and Malintzin: the Spanish conquest of Mexico

997.262

Great. So Cortés and Velázquez are besties again. He was climbing the ranks. He was the mayor of Santiago and then in 1518 Velázquez gave him another promotion and this one is an expedition promotion. I want you to go and explore, conquer...

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1059.662

He also has quite high standards when it comes to other people. There's a quote that he says, if a chap can't compose an epic poem while he's weaving a tapestry, he'd better shut up. He'll never do any good at all. Ha ha! I feel, I mean, that's two skills I can't do.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1082.551

I mean, Cariad, what are the two things that the modern gentle person should be able to do simultaneously?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1092.137

Those sound very difficult. Only one of those at a time. Come on.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1097.641

So he's setting high standards for others, but he's setting them for himself too. William Morris is an interesting fella. And much like the Bloomsbury group that we spoke about in our 100th episode, the arts and crafts movement, again, is a bunch of university pals going, hey, I'm a bit posh and fancy like you and we are all friends.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

114.887

And you'll definitely remember her from our episodes about Agrippina the Younger, Georgian Courtship. It's the wonderful Cariad Lloyd. Welcome back, Cariad.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1141.803

Doesn't he do architecture as well?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1254.777

I mean, you said unfortunately, but there's a sort of argument here that William Morris is like, yeah, I mean, what are you going to do? I think...

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

130.282

You're an expert in the Regency period.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1316.904

So Dante Gabriele Rossetti was in the family bed. And also Morris also invited in Edward Byrne-Jones and his wife Georgiana to come and move in with them as well.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

134.166

No, you're very good. You're very good. But today we're in the Victorian era.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1342.698

How sure. It's fair. Very early in your career kind of vibes.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1364.245

No. Edward Burne-Jones and Georgina, they actually turned the invitation down.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1369.246

And Morris responded. Oh, God.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

137.43

And even into the early 20th century. So what do you know of the arts and crafts movement?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1386.946

Maybe that's it. Maybe everyone's like, no, we're not moving. We're not. No.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1397.359

William Morris wrote, when he got the knockback, he just wrote, I cried, but I've got over it now.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1407.392

Okay, so we've got these talented friends who are collaborating artistically, collaborating romantically, occasionally. Not always successfully artistically. There's a famous mural. They're invited into Oxford's famous debating chamber. And they're asked to do a mural. And they're going to do an Arthurian mural.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1425.545

But they don't necessarily check the kind of textbook on how to do a mural. Exactly.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1508.565

They also, I mean, William and Jane, they build their family home in Bexley Heath in Kent. It's called Red House. Have you ever been, Cariad?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1517.149

It's a nice one. It's built in 1860 and Philip Webb, their old friend, designs it.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1597.452

Which I think is what people refer to as the royal family as well. Yeah, yeah.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1635.236

They're doing all sorts of things. They're not just putting up a mural. They're not just hanging some lovely curtains. They're doing stained glass windows.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1780.358

Amazing. So the company flourishes. And as you said, Cariad, we're used to artists being useless at the basic. Yeah, kind of falling apart.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1790.044

No, this goes really well. They expand into bigger premises near Wimbledon.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1830.295

Yeah, I'm going to be an agent provocateur here, Isabella, because as a historian, I'm going to have to say, one of the reasons the company flourishes is because of the Industrial Revolution. Yeah.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

184.01

William Morris. He'd love to be Elizabethan. Yeah, he would.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1842.259

I mean, come on. I mean, they're rejecting it.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1846.925

I know I'm being annoying, but we have to be true. The Industrial Revolution creates a middle class.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1931.044

Yeah, and that's always the case, right? You can have grand, lofty ambitions, but the economics are always going to underpin, does this work or not? What's interesting about Morris, he's obviously self-taught, as we've heard, all these things he's picking up. He's also getting other people to teach themselves. He's inspiring others. We know of an artist called William de Morgan.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1948.631

He teaches himself ceramics. He has a minor mishap. Just a little one. Do you want to guess what happens? Does he blow up a kiln? Yes, he does.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

1960.997

It's like his house is on fire.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2066.57

There's another artist we should mention, actually, because she's slightly different in that she went outside. Gertrude Jekyll.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2072.978

Who did interior, but she also did gardens.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2088.479

Yeah, I mean, there's quite a lot of good names in this episode.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

210.692

So what do you know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And I imagine most people will have heard of the big dog of the arts and crafts movement, William Morris. His floral designs are still printed on curtains, wallpaper, notebooks, pencil cases, even on football kits.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2103.335

The thing that I find quite interesting is the arts and crafts ethos moves beyond Morris' control. And that happens, right? We happen to see that in music, we see that in comedy.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2116.564

But we get a sense of an arts and crafts movement out of England into Scotland, into Wales, into Ireland, maybe internationally, I don't know.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

232.272

What's more, modern homeware brands like Cathy Kidston owe a huge amount to the arts and crafts movement, and we see the design legacy in TV shows like Grand Designs and Queer Eye. But the wider history of the movement is perhaps more hidden. Beyond the cutesy curtains, what was arts and crafts really about? Why did traditional manufacturing methods have a resurgence in Victorian Britain?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

253.433

And what is a strawberry thief? Let's find out. Right, Dr. Isabella, where do we start our story?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2658.857

acacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac Athlet Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacketketketketacacacacacacacacacacacacacacacacacacacacacketketketketketketketketketketketketketacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac住acacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacosket

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2901.025

Yes. How does the arts and crafts movement finish? I mean, do people just go, that's enough. Thank you.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2973.41

It's back in fashion. Maybe it never left.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

2979.813

The Nuance Window! Time now for The Nuance Window. This is where Cariad and I recline in our drawing room in Red House with our embroidery samplers while Dr Isabella has two minutes to tell us something we need to know about the arts and craft movement that we haven't heard already. So my stopwatch is ready. Take it away.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3151.396

But ironically, it's back to mass production again, isn't it? Yeah, yeah. Yeah, it's the sort of memification. Yeah.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3189.554

Great. Well, it's time now for the So What Do You Know Now? This is our quickfire quiz for Cariad the Quiz Queen to see how much she has learned. You are renowned in this show for the heroic achievements in quizzing. But we've got 10 questions for you, Cariad.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3208.191

That might work. Let's see. Okay. Question one. Yeah. Who coined the term Arts and Crafts Movement?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3220.224

Yes, very good. Yeah, well done. Thomas Cobden Sanderson. Very good. Well remembered. That was a hard one. Well done. Question two. What economic development was the Arts and Crafts Movement reacting against?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3232.056

Yeah. Question three. Can you name two other arts and crafts practitioners besides William Morris?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3240.325

Yeah, sure. That's fine, yeah. Dante Rossetti, yeah. Philip Webb, Jane Byrne, yeah. There's lots of people. Question four. What went wrong with the Arthurian mural that Morris and his circle produced for the Oxford Union Debating Chamber?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3256.238

It was just bare brick and then some lovely Othi Rihanna. Question five. What was the name of the house designed for William and Jane Morris to live in by the architect Philip Webb?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3269.642

Question six. Where did Morris and co hire a number of their employees from? Which school?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3278.952

That's it, yeah. Industrial school, industrial home for destitute boys.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3288.403

Question seven. What two crafts was Gertrude Jekyll a practitioner of?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3294.53

Yeah, what particular type of...

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3296.772

It was embroidery. Yeah, very good. Well done. It's always embroidery.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3301.573

Question eight. What arts and crafts organisation was founded by Lady Victoria Welby in 1872 and is now looked after by a certain Dr. Isabella?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3313.175

The Royal School of Needlework.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3326.38

Question nine. How did Mary Seaton Watts put radical arts and crafts ideas into practice when commissioned to do the Compton Mortuary Chapel?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3337.924

And they didn't blow up their kilns.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3341.204

Yeah, that's very... Question 10. What was it about the Art Workers Guild that did not enumerate them to women?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3359.691

Yeah, exactly. Cariad Lloyd, never in doubt, 10 out of 10. Yes!

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3367.577

It was 10 out of 10, Cariad. Well done. Thank you so much for coming in again. And thank you, Dr. Isabella. Listener, if after today's episode you want more Cariad Lloyd in your life, you can check our episodes on Mary Wollstonecraft. Well, craft. Arts and Wollstonecraft. Yeah, baby. Got there in the end. Sorry.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3382.907

Or, of course, the George and Valentine's episode where we talked about some surprisingly racy nudes being sent in the post. Yep.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3390.532

Drawings of eyes. Fan work. Yep. Yep. And if you want to hear more about British artistic movements, why not listen to our 100th episode on the Bloomsbury Group, who were radical and also just incredibly randy. And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3409.247

But I'd just like to say a huge thank you to our guests. In History Corner, we had the incredible Dr Isabella Rosner from the Royal School of Needlework. Thank you, Isabella.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3420.095

And in Comedy Corner, we had the cracking Cariad Lloyd. Thank you, Cariad.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3427.404

And to you, lovely listener, join me next time as we reupholster another neglected historical subject. But for now, I'm off to go and teach myself ceramics and maybe blow up my house. Bye! This episode of You're Dead to Me was researched by John Norman Mason. It was written by Emmy Rose Price Goodfellow, Emma Neguse and me.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3446.688

The audio producer was Steve Hankey and our production coordinator was Ben Hollands. It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook. You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

3489.948

LAUGHTER Yes, exactly. LAUGHTER This is how we investigate cybercrime. We look for the yachts.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

354.517

What is a movement? Are there rules? Is there a manifesto?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

374.949

We're not sure quite when it starts. You said 1860, you went into 1870s, but this is 1887 that it gets its name. So that's not very good branding if you've been going for 27 years. We should really call this something. There is a quote by Morris in an 1877 lecture.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

561.645

But that's also a mean average, which means mostly it's children dying.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

567.348

We have then a movement that comes along that's reacting to the trauma of the Industrial Revolution. It is a trauma, right?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

57.264

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I am a public historian, author and broadcaster. And today we are packing our William Morris tote bags and heading back to the 19th century to learn all about the arts and crafts movement. And to help us spin this story, we have two practitioners of very different arts.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

573.553

These artists are responding in a way that feels like they're looking for escapism. And they go hunting for escapism in the past. Cariad, what bygone age would you daydream about or do you daydream about?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

590.604

Well, you live there half the time.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

609.212

I mean, the artists that we're talking about here, they're interested in Elizabethan, but it's the medieval world that they're particularly drawn to.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

620.555

Sure. But it's a romantic medieval. I'm a medievalist by training. Oh my God, the pressure is on now. The medieval world was violent and dark and scary. And of course, there was art and beauty and philosophy. But this is not a time necessarily of great joy and pleasantness. But the arts and crafts movement, they see it as a romantic age.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

732.282

And talking of great men of the Victorian era, we should probably mention Ruskin. Do you know Ruskin?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

740.985

Try another man's name from the period.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

743.566

John Ruskin. John Ruskin, well done. There you go. You get there in the end. I've heard of him. He's an extraordinary figure in the 19th century. He's slightly debated these days. Everything. Amongst everything else. Absolutely everything. Architect, critic, painter, writer, philosopher, poet.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

758.355

He's what the Victorians would call him, a great man.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

763.798

He's a polymath. And he's kind of an inspiration for the arts and crafts movement.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

769.662

Intellectual kind of figurehead, I would say.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

77.953

In History Corner, she's curator of the Royal School of Needlework and a research consultant at Whitney Antiques. She's an art historian of the material culture of the 17th to 19th centuries with a particular focus on needlework. You might have listened to her podcast, So What? It's a pun. It's Dr. Isabella Rosner. Welcome, Isabella.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

904.393

Okay, so we have some of our intellectual figures. Let's move on to William Morris. We've name-checked him already.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

914.7

Yeah, Daddy Morris. Which, I don't know, feels worse and feels slightly sordid. I don't know.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

924.246

Yeah, yeah, yeah. I think many people would recognise a William Morris print. I don't think they're going to recognise a photo of him. He's not got one of those distinctive Victorian faces. Who was William Morris? Where was he educated?

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

96.894

We're delighted to have you here. And in Comedy Corner, she is a comedian, actor, improviser, writer and podcaster. You may know her from her podcast, Griefcast, an award-winning show. It's spin-off book, You Are Not Alone, her many TV appearances, her Weirdos Book Club podcast with lovely Sarah Pascoe, or her new children's book, The Christmas Wishtastrophe.

You're Dead to Me

The Arts and Crafts Movement: William Morris and his circle

995.752

And as a personality, I mean, he's a prodigious brain. He's another classic polymath.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1002.688

Sharon, Marco Polo tells us some really interesting things about life in the Mongol court, but also kind of wider administrative aspects. And two of the things I think that are particularly interesting would be the postal system.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1022.942

Welcome to the nerd show over here.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1027.265

I'm writing this down. I did. We knew you were coming in. We thought we'd go fully nerd. Sharon, the postal system and paper money are two things that Polo is particularly intrigued by. These aren't brand new inventions, but these are things the Mongol dynasty are renowned for. So can you talk us through them?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

111.258

It's Rialina. Welcome back to the show, Ria. Thank you so much. It's great to be here. We're delighted to have you back. Now, Ria, you are, I think, officially the most educated, therefore most hyper-intelligent comedian we've ever had on. You have a PhD.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1136.45

Yeah, so we've got something like 1,400 waystop stations and there'd be 50,000 horses in the network, we believe. And as you said, Sharon, they can deliver a message immediately In 36 hours, to the furthest extent of the Mongol Empire.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1173.636

They were sealed, Sharon, if I remember rightly. There was a sort of security integrity system, wasn't there?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1204.544

Tell us about paper money because Marco Polo is particularly fascinating because paper money is not in use in Europe, is it, at this time?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1233.787

That's a nightmare, isn't it?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

127.307

The most educated, perhaps. Okay.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1278.011

Amazing. Famously, Marco Polo tells us that the punishment for refusing the paper money was death.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1295.514

And I will be taking these kiwi fruits with me. Exactly that. Let's move on to something even shinier than paper money, which is jewels. Shiny, shiny jewels. Marco Polo listed three techniques for unearthing natural diamonds in India, interestingly enough, outside of China. Can you guess what these techniques might have been? I'll give you a clue, Ria. One of them involves eagles. What?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1324.172

That's definitely a technique, sure.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1331.214

That's a very sensible technique, yeah.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

134.171

But your PhD is in science.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1350.927

How many diamonds do you have?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1352.708

None of those worked for me. Sorry. Sorry to hear that. Sharon, is Ria about to be a very, very wealthy person with her diamond industry? I mean, what was the Marco Polo technique that he tells us about? These three different ways.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1448.048

Is it caramelized? Does someone put it in a sort of delicious jus so it's just kind of sticky?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1454.915

Sticky bloody meat. Okay.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

147.158

How are you with history?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1472.322

Maybe, because then you're getting a free engagement ring.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1476.904

Diamonds are a girl's best friend, but you do have to wait for them to come through an eagle's digestive tract first.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1485.956

Yeah, and we've done a coffee episode if people want to listen to that. So there we go. It's all synced up.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1499.989

Yeah, arguably that's not mining, that's theft. But sure, sure.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1514.335

Sharon, I think at the top of the show we mentioned Marco Polo sheep, which sounds delightful. What's that about?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1562.367

I mean, that's amazing. So we call them Marco Polo sheep because he wrote about them. So this is him noticing these things and then modern day scholars going, oh yeah, the sheep that Marco Polo talked about. He also, he talks about luxury goods that were very valuable back in Europe and in the wider world that were from the animal kingdom.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1580.077

Ria, if I say to you, ambergris and musk, do you know what those two things are? Whale vomit. It is.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1589.461

I didn't know there was a song, but yes.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1611.412

It's quids in, isn't it? Yeah, it's tens of thousands of pounds. Yes, it's whale phlegm. And so ambergris was very luxurious, used in perfumes, as you say. Musk was extracted from the anal glands of certain types of deer, I believe, Sharon. Is that correct? Yes.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1663.17

Been a bit of a sausage fest so far. You know, I'm aware that we've really only talked about men so far. Marco, Maffeo, Niccolo, Kublai Khan. Marco Polo does write about the women he encounters on his 24 years. He talks about the women of Tibet as particularly interesting. Do you know why, Ria?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

168.334

Yeah, yeah. We're not so good on the UK curriculum with the sort of medieval China.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1683.175

Yes. I'll give you a clue about their romantic and sexual lives.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1721.265

That's a great guess. Did he, Sharon?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1768.206

Exactly there. So instead of notches on the bedpost, these, I guess, are nomadic people without beds.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

177.043

So is Marco Polo a familiar name?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1783.007

Fair point. And his final mission at the end of these 24 years is to escort a bride quite a long way, Sharon. Is this a sort of fairytale occasion? Is this a big royal wedding? Is it Harry and Meghan, Mark II?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

184.511

Okay. Or in swimming. Talk us through the rules.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1909.645

Marco has delivered the bride safely, not to the right husband, but never mind, to a husband. And then they sailed home. 50% of the right husband. Yeah, I mean, same surname, right?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1920.994

And they get back to Venice in 1295. And I'm thinking, warm welcome, right? He's been away 24 years. In 1295? In 1295. Remember, he's born in 1254. So he's an old man now. He's getting on a bit. Was it a warm welcome, Sharon? Was it, you know, street party, parades, trumpets? He's 41. I mean... I'm 42. So, you know, I'm feeling the age now.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1944.467

Yeah. For me, that's... It really isn't.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1948.028

Thank you, but I feel like I'm decaying quickly.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

1960.115

I've written seven books. Does that count? Yes. Nice one. Sharon, talk me through the welcoming, the big arrival. Do the polos get off the boat and everyone's like, where have you been?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

200.964

So you're echolocating.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2006.723

Okay, so he's in a Genoese prison. He has survived 24 years in the court of the terrifyingly, you know, famously fearsome Kublai Khan. He has survived thousands of miles of voyages. He's survived everything you can. He gets back home, and four years later, he's in jail. It's not ideal. It's quite bad luck.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

203.206

Cartographically, is that how Marco Polo traveled the world, Sharon? By echolocating. Yes.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2031.126

He was just coasting around going, hello, hello, hello.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2036.952

So unlucky for him. Lucky for us, though, because, Sharon, we get the book because his cellmate is a renowned writer with a lovely name, Rusticello.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2093.544

You've gone through the hard work of all that scribbling in the cell. It's probably not very good lighting.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2102.069

That's the thing, isn't it? He extracted these stories from him. And the book, as you said earlier, Sharon, is not called Travels of Marco Polo. It is called Description of the World, composed in 1298, dictated to Rustichello. Rustichello. Thank you. Thank you.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

216.991

So, what do you know? This is the So What Do You Know, where I have a go at guessing what you, our lovely listener, might know about today's subject. And you've probably heard of the name Marco Polo. Much like Rie, you may have known he was a medieval famous traveller. You may even have played the famous swimming pool game. Marco! Polo! Polo! career.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

239.535

Now, sadly, this is a 20th century invention, not something that Marco did splashing around in the canals of Venice when he was a little boy. If you've travelled to Venice, oh, aren't you fancy? You will have flown to the Marco Polo airport. You may have stayed in the Marco Polo hotel. He's been the subject of a Netflix series.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

254.958

If you're a diehard Doctor Who fan and you've seen the original 1960s mini series, you'll know that Marco Polo's in there too. He gets around, this famous traveller. But what was the real historical story behind the big name? Did Marco Polo really go to China? And why is there a sheep named after him? Let's find out. Professor Sharon, can we start at the beginning? When was Marco Polo born?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

276.129

And what was his family situation like? Was he wealthy? Is he born into privilege?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2804.124

That's really interesting. So the age of exploration in the 13th century, then you get the age of conquest and colonialism where these men of science and learning but also administrators are looking at earlier texts and going, ah, yes, I can see that plant. He's written about it earlier. It's very interesting to see a book having that kind of legacy in life.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2842.65

Find me a Marco Polo sheep. I want to ride it.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

2852.421

This is the part of the show where Ria and I sit quietly and study our navigation charts, while Professor Sharon has two minutes to tell us something we need to know about Marco Polo. My stopwatch is ready, so Professor Sharon, please take it away.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

298.528

Right. So we know he was born in 1254. And that's it. That's right. Helpful. Okay. I'll turn to you, Ria. What do you imagine his childhood was like in medieval Venice before little Bambino Marco was splashing around in the canals?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3024.767

Amazing. Thank you, Sharon. Thank you so much. Ria, that's a really interesting note to finish on, isn't it?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3040.471

Cannibalism. Oh. Yes. So what do you know now? Well, there we go. So it's time now for the So What Do You Know Now? This is our quickfire quiz for Ria, who is wincing, panicking. What's the word?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3066.672

It's a delightful polo sheep. It has a hole in the middle. Because it's got a hole in the middle.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3070.833

And bowls for horns. All right. I've got 10 questions for you.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3073.794

Let's see how you do. Question one.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3079.852

Question one. What was the title of Marco Polo's book when he first wrote it? Description of the World. It was very good. Question two. In which city was Marco Polo born?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3091.124

It was. Oh, very nice. Yes. Venice. Venezia. Very good. Question three. Who was the Mongol emperor that the Polos worked for?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3099.116

Very good. Question four. What was the name of Kublai Khan's capital city? Do you remember?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3118.149

You've taken some very good notes. Yeah, absolutely. Khanbalak and Dadu, which would be Beijing. Also there was Anadu as well, which I think was a separate capital. Question five. What did Marco Polo say about the women in Tibet?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3151.163

That's right. Question six. Describe one of the three ways that you can mine diamonds in India.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3203.56

Yeah. They're going to guano on you. Okay. That's an amazing answer. Well done. Question seven. What was the final mission that Marco Polo carried out for Kublai Khan?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3238.445

This is an incredible answer. You've got an incredible memory, honestly. Absolutely.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3245.415

You had tons of people. It was, absolutely. Question eight. Which famous Italian writer did Marco Polo co-write the description of the world with?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3264.402

It was 24 beds for 24 years away, I guess, maybe. I don't know.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3270.545

This were a perfect 10. Which famous explorer was known to be a big Marco Polo fan in 1492?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3282.998

But Christopher Columbus. It was Columbus. Ten out of ten, Rialina. Well done. What an extraordinary reciting of what we talked about. Incredibly accurate. Well done. And also well done, Sharon, for such instructive teaching there. That was amazing. I've had such a lovely time. Thank you, Sharon. And thank you, Ria.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3305.197

Oh, yeah. And listener, if you want more Chinese history with Ria, you can check out the episode on the iconic pirate queen, Chunyi Cao. What an extraordinary life she led as well.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3316.643

The fact that she got to retire with all her riches. Incredible. They were just like, all right, you know, incredible.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3323.887

And of course, you can listen to our episode on Chinggis Khan as well. And if medieval travellers are your thing, we also have an episode on Ibn Battuta. And remember, if you've enjoyed the episode, please share the show with your friends. Subscribe to You're Dead to Me on BBC Sounds to hear the episodes one month before all the other platforms. It's very important.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3339.137

And if you get on there, make sure to switch on your notifications so you never miss an episode. I'd just like to say a huge thank you to our guests. In History Corner, we have the spectacular Professor Sharon Kinoshita from UC Santa Cruz. Thank you, Sharon. Thank you.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3352.106

It was wonderful having you on.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3353.927

Yeah, it was absolutely fascinating. And in Comedy Corner, we have the sensational Ria Lina. Thank you, Ria.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3359.97

It's been a delight. I've learned all about eagle poo and diamonds and all sorts. Eagle guano. And to you, lovely listener, join me next time.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

3368.902

Why not? Why not? I'll come with you. And to you, lovely listener, join me next time as we navigate more historical wonders. But for now, I'm off to go and train a bunch of eagles, then chuck some juicy steaks into my local jewellers. I'm going to be rich. Bye! Your Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

374.92

Sharon, I think we have done very well there. I think that's a very interesting summary of the 13th century of Venice. Can you tell us any more or are we good?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

485.529

So we call this the Silk Road, despite it being seas, the Silk Road is this trade network.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

49.551

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are packing our trunk and boarding a ship to 13th century China to learn all about medieval traveller Marco Polo. And to help us on our way, we have two very special travelling companions.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

493.072

Yeah, have you heard the phrase?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

497.054

That's a very different type of website, Ria.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

503.257

So that's Venice. Sharon, tell us about Polo's family relations. Do we know of his siblings, mother, father?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

579.866

In my head, I'm thinking Marco Polo is the big exciting explorer, but the dad and uncle have already done it. So there's already a trade network there, which is kind of interesting. What is the court? Where is the court?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

69.143

In History Corner, she's Distinguished Professor of Literature at the University of California, Santa Cruz. Her research focuses on the intercultural relations of 12th and 13th century Asia and Europe, and in literature particularly. And luckily for us, she's the most recent translator of Marco Polo's book, as well as the author of Marco Polo and His World. It's Professor Sharon Kinoshita.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

691.11

So Ria, Marco grew up not really seeing his dad or his uncle because they were off gallivanting around Western Asia. And then suddenly one day they came back and they came back with a message for the Pope from the Mongol Emperor. But daddy makes it up to little Marco by saying, I've come back, I've delivered my message to the Pope. And actually, I quite fancy going back out again.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

725.903

So the polos now, our pack of polos, let's call them that. So Maffeo, Niccolo and Marco, they head back out to Mongol China in 1271. Marco is a young, he's what, 17, 18? He's a young man. That's right. And they travel to Acre, which is in the Holy Land of what we now call the Middle East.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

743.877

And they definitely go to China, Sharon, because when I was a student about 20 years ago or something like that, there was a big sort of like, oh, did he really go to China? Did he make it up? Was he telling stories? But he definitely went to China, right?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

849.145

Listeners, if you want to know more about the Mongols, we did an episode on Genghis Khan, the grandfather of Kublai Khan. Genghis Khan, I guess, more famous name, but Genghis is what we called him. I mean, he's there. He's quite impressed by Kublai Khan and the capital, Dadu or Khanbaliq. Do you want to guess how long the Polos stay in this part of the world?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

868.543

Well, let's call it a trip, but it's quite a long trip.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

882.717

That's a really good guess. It's 24 years. Yes. So you've done very well. You're very good at this, Ria. You've got incredible knowledge here.

You're Dead to Me

Marco Polo: history’s most famous travel writer?

892.204

Well, amazing. But yeah, they're there for 24 years. And Sharon, we get a sense then that Marco Polo, even though he arrives as a 17-year-old, he becomes a man in China, in Mongol-controlled China. What does he tell us about his life in Mongol China?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

909.412

24 years, Marco. Come on. He's too busy having fun. You talked about a book. What have we got?

You're Dead to Me

Marco Polo: history’s most famous travel writer?

91.589

We're delighted to have you here. And in Comedy Corner, she's a comedian, actor and writer. You might have seen her on loads of things on TV, including live at the Apollo QI, Pointless, having news for you. Maybe you've seen her stand-up tour, Reawakening, or heard her on Radio 4's News Quiz or The Now Show. And you will definitely remember her from our episode on Pirate Queen, Chung-I Sao.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1.429

BBC Sounds. Music, radio, podcasts. Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we're getting political. We're travelling back to the 17th century to discover the causes of the British Civil Wars. You might call them English Civil War. We'll explain later.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1002.785

And he was now relying on a new advisor called Thomas Wentworth, the Earl of Stratford, who was out in Ireland. And he tried to recall Wentworth back to London. Parliament found out about it. They intercepted him. They accused him of treason. And they forced the king to sign the death warrant. And Stratford was executed.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1108.015

And this is one of the reasons we don't call it the English Civil War, because Ireland is a huge part of it. Scotland's a huge part of it. Unfortunately, Wales just gets sucked into England. Sorry, Wales. So we get the Grand Remonstrance. Do you know what that is, Toussaint?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1140.028

But it's not, John. It's much more serious than that. And the music isn't nearly as jolly. Well, so it's basically a big document with 204 clauses.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

116.592

So what do you know? So what do you know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And as you've probably heard of the British Civil Wars, or rather you've probably heard of the English Civil War. That's not really a name we use that much anymore. And also there aren't that many movies about it or pop culture about it.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1206.158

There's also a petition presented to Parliament, which is 24 yards long. So it's about 20 metres long. It's got 15,000 signatures on it. It's against Catholic peers and bishops. And I love the idea of just unrolling this petition slowly in front of Parliament. It's so passive aggressive. We're getting daily clashes in Parliament by this point.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1225.009

We've got riots, we've got protests, we've got people being shot, proper violence breaking out in Westminster. And a fed up King Charles basically comes up with a plan. He's going to arrest Pym. He's going to accuse him of treason. He's presumably going to execute him. And why doesn't it work?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1287.634

So 1642, this is the year of the Civil War. And in May of 42, we get the country. How does the country raise itself to war when it's the king that they're angry at?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1372.842

I mean, it's a fair point. Why not? Is it just because it's in the middle of the country? Is that just a good sensible...?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

138.525

We've got King Charles popping up in To Kill a King. There was Blackout of the Cavalier years. Probably you're thinking of Roundheads versus Cavaliers or Oliver Cromwell and his ugly wart or Charles I being beheaded. But how did a civil war actually start? And just how long is a long parliament? Let's find out.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1384.604

So, on the fateful day, 22nd August 1642, having come to power in 1625, Charles I raised the royal standard at Nottingham and then apparently the wind blew it down, which was never a good sign, and thus declared the British Civil Wars, the English Civil War, whatever you want to call it, but he declared war. The question I want to ask you, Toussaint, which side would you have sided with?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1405.791

Would you have gone King or Parliament?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1444.597

So you're a cavalier. Feather in the cap and off you go. So there we go. So that's the end of the story. We're not going to cover the actual wars itself. We're stopping here. But there we go. Toussaint has committed himself to the king's cause. OK, time now for the nuance window.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1466.229

This is where Toussaint and I sit quietly and read seditious pamphlets for two minutes while Dr John tries not to topple over in the pulpits while gesticulating wildly about the British Civil Wars. You have two minutes. Take it away, Dr Healy.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

156.252

The British Civil Wars or the War of the Three Kingdoms or the English Civil War or... I mean, there's loads of names for it, but they started in 1642. They lasted about a decade. But today we're going to do the prequel. So, John, where do we start our story? Do we start with Charles?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1590.353

You were fighting for the king a minute ago. What's happened? We've lost you. Well, thank you so much, Toussaint. And listen, if you want more Toussaint, do check out our episode on the American abolitionist Frederick Douglass, who was an extraordinary man. For more Stuart history, we've got the episode on King James, of course, but also Nell Gwynne, the 17th century actress.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1608.638

And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But I've just got to say a big thank you to our guests in History Corner. We had the amazing Professor Jonathan Healy from the University of Oxford. Thank you, John. Thanks, Greg.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1623.461

And in Comedy Corner, we have the truly talented Toussaint Douglas. Thank you, Toussaint.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

1629.988

And to you, lovely listener, join me next time as we untangle the complicated origins of another historical happening. But for now, I'm off to go and petition my local council with a 24-yard-long petition about potholes. They're going to feel my petty wrath. Bye!

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

236.588

So, Toussaint, King Charles I comes to the throne, 1625. Do you think he learns from daddy's mistakes?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

24.057

And to help us separate the Royalists from the Radicals, we have two very special guests. In History Corner, he's Associate Professor in Social History at Kellogg College, University of Oxford, where his research focuses on the social history of early modern England. You might have read his incredible book, The Blazing World, A New History of Revolutionary England.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

254.642

I think that's a pretty good guess. John, things just get worse for young Charles, don't they?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

276.784

One of the grievances is Charles has married Princess Henrietta Maria of France, who, of course, was a Catholic. This was a provocative move at the time where religious tensions were high. There's also a weird thing called Toussaint. Tell me if you've heard of this before. Tonnage and poundage.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

388.481

We've got the third parliament of 1628 called where, again, he's trying to raise money because there's a subsidy bill, John, isn't there? And forced loans, there's martial law, the petition of rights, there's tonnage and poundage again. The subcommittee are in charge of the tonnage and poundage thing and they just suddenly decide to be a subcommittee about Catholicism.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

40.947

He's also the author of a forthcoming book, The Blood in Winter, all about the run-up to the Civil War in 1642. It's Dr Jonathan Healy. Welcome, John. Hi, Greg. Lovely to be here. Thank you for Coming in and in Comedy Corner, he's an award-winning stand-up comedian.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

413.012

And Charles is annoyed at this and he demands an adjournment.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

450.325

And the king responds by imprisoning nine MPs. That's not good news, right? John, you can't imprison MPs. Can you?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

471.515

Toussaint, do you want to guess how long this personal rule no Parliament is?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

482.981

Sensible guess. It's 11 years.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

488.864

Is he raising cash just in his own way then?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

524.335

Something he does too, he turns to ship money. What is ship money?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

54.095

You may have seen him on BBC Three's Stand Up for Live Comedy or loads of Dave shows like Outsiders, Hypothetical, Question Team or Late Night Mash. And you will remember him from our episode on Frederick Douglass. It's Toussaint Douglass. Welcome back to the show, Toussaint.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

557.006

You can see the tensions rising here, Tucson, I think, because the king is just doing what he wants. So we've already mentioned tension between the high church Anglicans and the ones who are almost a bit Catholic and the Puritans. What is Armenianism? Is it this high church thing you mentioned?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

614.491

So William Lord, it's Lord L-A-U-D. And there's a vicar called Peter Titley who sounds fun. Not because of his name. Although, I mean, maybe a bit because of his name.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

627.339

John, why is Peter Titley fun?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

651.829

But we also then get the cost of living crisis again, John. Why is this crisis happening? It's not inflation, is it?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

674.83

Now, earlier, Toussaint, you mentioned Marvel, and I can ring my Marvel bell because we have Captain Carter show up, who is a lady who sort of rallies the brave lads of Malden in Essex. Do you know what she does, Toussaint?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

687.741

Yeah, they go on a heist. They go to steal some stuff.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

692.907

Well, they're going after the grain. They carted it off. Captain Carter carted it off.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

712.04

You can't eat gold, Doosan. Come on. They're hungry. This is a political act. John, Captain Carter, or Anne Carter as she is, she was executed for this heist. Was she rare, being a woman involved in protest?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

775.754

Wow. I mean, chucking molten tar onto a sort of sacred table in a holy building, that's quite bold. Toussaint, I mean, have you ever gone that bold with a protest?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

803.683

We've spoken a lot about England so far, and I think it's really important, in case listeners don't know, that Charles I of England was king of Scotland as well. So these English reforms, these William Lord reforms, was he also pushing them north of the border up into Scotland as well?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

84.486

Tucson, last time you proved yourself a bit of an American history aficionado. You knew quite a lot about Frederick Douglass.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

853.018

So Charles does the obvious thing here. He calls another parliament. And having had the short parliament before, he now goes on a parliamentary bender. It's called the long parliament. He can't get enough. Toussaint, how long is the long parliament?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

872.554

That's a very sensible guess. It's 20 years.

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

896.866

In fairness, he was dead for half of that. So, you know, I mean, John, it's a technicality, right? The parliament is never dissolved because the king is executed. But, you know, we're jumping ahead. But that's why it's called the long parliament. Is that fair?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

947.653

Yeah. So we now have a parliamentarian sort of step forward, you know, because often people will assume that Cromwell will be kind of important at this phase. But Cromwell isn't really in the picture yet. The person who steps forward to be sort of leader of Parliament a bit is called John Pym. Is that right?

You're Dead to Me

Causes of the British Civil Wars (Radio Edit)

984.85

Pym starts to unpick Charles' policies. He goes after ship money, which was that inland coastal thing. He goes after the Star Chamber, which is how Charles had crushed the media. He goes after the High Commission. He goes after crucifixes and images in the churches. So King Charles was under huge pressure from Pym and from Parliament in general.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1017.593

We've got Ear, son of Hera. He's got fantastic hearing.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1022.575

I feel like the guy who stands on his head didn't get the memo on.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1031.001

Someone's got to stay behind and guard the castle. Upside down. Slowly shuffling around the moat. Mike, what talent do you think Lip, son of Placid, possesses? Lip? Yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1049.314

Too useful. I mean... Magical kisses? I guess. Can he kiss it all better? That would be... What a wonderful thing. For the Indian knights. Oh, that would be so good.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1062.284

No, his skill is... Well, I'll read you the quote. On days when he was sad, he would let his bottom lip drop down to his navel... And on the other day, it would be a hood over his head. Yeah, so the party trick he does with his bottom lip is it goes down to the navel. But I should clarify, actually, the top lip goes up over the head, like a hood. How do you see? Wow.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1088.774

I don't see how that's particularly useful.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

110.3

Interesting. I mean, you're a total legend, but King Arthur, total legend. What do you know?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1106.682

And after this charmingly weird Mabinogion, we get our first English horse, Mary. And it's not entirely English, because Geoffrey of Monmouth... Is a bit Welsh?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1179.162

Because he claims to be, he says he found a very ancient book of an ancient tongue.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1185.107

But then obviously he doesn't name it and we don't have it. And you're like, did you?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1220.923

Oh, that's, yeah, that's huge. That's, like, you know, for most of our text, we've got, like, 20, 25, 30 sometimes.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1237.042

Yeah, he's the John Grisham of the 13th century.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1246.965

It's hugely important, inspiring European intellectuals to think about history in a new way. So you suddenly get this sort of splitting of history into three categories. Matter of Rome, ancient history. The Matter of France, Charlemagne's empire. And the Matter of Britain... Because in Geoffrey of Monmouth's text, King Arthur unifies England, Scotland, Wales and Ireland.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1267.332

And then he's like, that's not enough. I'm going to go conquer some stuff. And he adds to that Brittany, Denmark, Germany, Iceland, Norway, France and Romania. He's basically a one man Eurovision. Wow. Yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1283.76

There is a gap, isn't there? So this King Arthur is a conqueror and king of half of Europe, as well as king of Britain, a unified Britain, which is an interesting political idea, obviously.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1294.046

And, of course, you've mentioned he's important, but Geoffrey of Monmouth, we would call him a chronicler, we would call him a historian, but he's hugely important for the literature aspects of what becomes Arthuriana. So do you want to talk us through that?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1358.363

Because I think most people will hear the name and go, Morgan Le Fay, baddie, sorceress, evil queen, witch lady.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1399.679

So in this early... In Geoffrey of Monmouth, she is a positive figure. She heals Arthur when he's injured. Later on, she will be turned into a villain.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1408.027

We do get... We sort of get Excalibur-ish.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

141.154

Hard. We'll find out if there's any detail. So, what do you know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And I think like Mike, you definitely would have heard of Arthur, Guinevere, Lancelot, Merlin. Most people will have seen an Arthurian screen adaptation, I think.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1416.836

Because X means from, so Excaliburnus, from Caliburn.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1459.605

He advises Uther Pendragon. Yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1469.433

Now, why do you think Merthyn was renamed to Merlin by Geoffrey of Monmouth? This is just a possibility. We're not sure this is true, but why might that be the case? That's interesting.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1498.995

Oh, you're thinking murder? Yeah. No, in French, merde means shit. Of course!

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1521.848

It's a beautiful name in Welsh, but when you translate it to French, it's literally a crap name. It's like one of the earliest examples of rebranding, is it?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1531.713

So Merlin, or Merlin in French, I suppose, but Merlin in English. The other thing that Geoffrey of Monmouth brings in is something you've already mentioned, the idea of Arthur as the once and future king as well, doesn't he? The idea of his return.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1575.417

Exactly that. And that then kickstarts what we might charmingly, cheekily call fan fiction. It's not necessarily fan fiction, but it's a sudden surge of other writers going, oh, I can run with this. I can add to this. And it starts straight away, doesn't it?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1638.153

Do you know why they're called romances, Mike?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

164.038

That's your Disney Sword in the Stone, your boisterous King Arthur with Keira Knightley and Clive Owen, your John Borman's weird and wonderful Excalibur. You've got the kid who would be king. You've got the sing-along Camelot. You've got the BBC series Merlin. There's Dev Patel in the swoon-worthy Sir Gawain and the Green Knight. Quite weird, but good.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1644.577

Because we now use the word romance to mean, you know, love stuff, bouquet of flowers and all that. But it's a linguistic history, right? It's just the romance language. Right. Yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1700.938

He's a lover and a fighter, ladies. Yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1718.237

Well, let's do a mini quiz for you, actually, Mike. So Chrétien de Troyes is probably the most important writer of this period, writing in sort of the 1170s, 1190s, adds quite a lot of iconic elements to the Arthurian canon. So which of these five iconic elements was not Chrétien's invention? So I'm going to give you five. One of them is not from Chrétien. One, Camelot. Two, Lancelot.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1741.39

Three, Lancelot's tragic romance with Guinevere. Four, The Round Table. Five, The Quest for the Holy Grail, which was not Christiane's invention. I'm going to say The Quest for the Holy Grail. It's a good guess, but it's the round table. Is it really? Yeah, the round table.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1758.148

Chrétien didn't come up with that. Chrétien came up with the others. So who invented the round table?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1794.533

Yeah, siège means chair in French. Yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1807.399

Robert Wass, that's the Roman de Brut. So that's the story of Brutus. That's 1155. So that's 15 years before Chrétien. But Chrétien de Troyes describes something that he does invent, which is the Holy Grail.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

182.166

Obviously, the best Arthurian movie ever is Monty Python and the Holy Grail. A film I love so much, I wrote my master's thesis about it. I am on home turf today. Amazing. Finally, something I know about. And that's not mentioning all the operas, plays, poems, video games, paintings and books about King Arthur. But where do these stories come from?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1822.046

Now... What do you think of when you think of a Holy Grail? Beyond the Monty Python film. What do you think of in terms of what it looks like, what it is?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1890.333

I need to ask also, we've mentioned the round table. Yeah. How many knights are sitting around the round table?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1902.557

You're bang on for one of the sources. But we also get various numbers, right?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1937.851

1,600 knights. And this thing is portable, we're saying. So the round table can seat 13 or 1,600. Or somewhere in between. Or somewhere in between. It really depends. So each Arthurian text was changing core elements, Mary. We're seeing here writers coming in, adding bits, tweaking bits, taking a name, running with it.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

1958.639

We get Morgan Le Fay being transformed from helpful healer into traitorous sister to Arthur, becoming the incestuous mother of their child, Mordred. And then we've also got the knights who become the prominent, the famous knights of the round. How many can you name off the top of your head?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

200.522

Was the medieval Arthur the same as our Arthur today? And just how big was a round table anyway? Let's find out. Right, Dr. Mary, Hollywood's vision of Arthur, or Arthuriana, I think is what we call it, the collective world of King Arthur. Hollywood makes it all sort of shiny armor, knights riding around, ladies in pointy hats, dangerous forests. It's very 14th century.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2002.26

Sir Mordred, Sir Gehaerys, Sir Gareth. Tristan, of course, yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2006.783

Yeah. We also need to mention Marie de France.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2029.278

But also rooting perhaps to the British tradition, the Breton, Brittany, that sort of link.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2068.526

She was writing in the late 1100s. Yes. There's also Robert de Boron who invents another motif. Do you want to guess what Arthurian motif he adds into the canon?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2079.056

Yes! Is it? God, you're doing very well at this.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2085.322

That's amazing. And what's interesting after that is we get what's called the Vulgate cycle.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2091.948

A slight pivot in the direction of the themes.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2123.392

When is this? Early 1200s. So we start to see a slight pivot away from the adventures of knights and it's becoming a little bit more about Christian purity and the idea of the ideal knight. And this is the time of Crusades, right?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2171.284

Have you heard of Le Morte d'Arthur as a book by Thomas Mallory? Have you read it?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2186.98

You know your stuff, don't you, Mike?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2202.239

Yeah, you're spot on. Yeah, so, OK, you haven't read it, but you know that he's a bit of a character. Yeah. I mean, Mary, this is very much the Marvel Cinematic Universe of the 15th century. Here is someone trying to grapple with an enormous, sprawling collection of stories where people are rewriting, rewriting, rewriting, and he's gone, oh, we need to standardise this.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2221.323

We need to bring this all into one coherent narrative, a beginning, middle and end, about King Arthur, and he dies at the end. So what is the mess that he tries to cohere?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

225.28

Is that where we start our quest for King Arthur?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2253.24

We call it Le Morte d'Arthur, which sounds pretty sexy. Yes, no, it wasn't called... And it was a major spoiler. Yeah, yeah, actually, that's true. You're right, actually, yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2285.386

So it's just before the Tudor era. It's right at the end of the Middle Ages.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2310.209

He was the sort of first great printer in English, the English language. And so Le Morte d'Arthur is his sort of rebrand of this great text. Mallory is a politician. He's a sort of... Sheriff. He does some bad stuff. He ends up in prison. So tell us, who was he?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2407.584

Yes. So Le Morte d'Arthur is a sort of compendium of stories. We break it down into eight tales.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2493.601

And it's worth just saying also that Galahad sits on the siege perilous, the sort of the scary chair. Yes, he's the dude, isn't he?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2501.043

And he does it. He does a grail. He's like, bosh, nailed it.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2508.305

So this is the kind of classic text that students read, well, try and read, and then very quickly give up. So it's a romance, but it's not that romantic as everyone dies at the end. Yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2553.508

So we've discussed literature. We should talk quickly about Arthurian artefacts, or Arthur-facts, if you will, which is to say that in the Middle Ages, people started finding proof. Yeah. Question mark.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2594.806

Yeah, that's Richard the Lionheart. Richard the Lionheart gives Arthur's sword.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2603.529

We've got King John. He's got Sir Tristan's sword. Yep. Some say it's still used in royal coronations.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2644.058

My favourite one of all, Cambridge University in the 1400s claims that King Arthur had given them a tax exemption and it was hand-delivered by Sir Gawain himself.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2654.482

But the real Arthur aficionados in the medieval world were big on it. But the Victorians, they loved a bit of Arthurian honour.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2674.961

He's a conqueror. He unifies Britain.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2741.525

We also get, of course, Victorian print books have beautiful illustrations. That's another big appeal. You see gorgeous art. And in a previous episode, we've talked about the arts and crafts movement and they were obsessed with Arthur as well. Paintings. Paintings and all sorts of things. So we've got kind of really rich sort of Arthurian poetry and so on.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2760.615

But there's also women involved here, too. We've got more important figures here.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2833.289

Yeah, fan fiction unleashed. Yeah. Nice. So Gawain out on the porch with his shotgun. Yeah. A cool box.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2846.955

A very famous photographer, really important.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2849.897

And often we'll see lots of exhibitions about her these days. She's sort of back in vogue.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2868.286

These are people who also were using Arthuriana to justify the British Empire.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2917.781

stick a flag in it home for neighbours I think it might be your moustache Mike but there feels like a 19th century leadership quality to you I feel like I want to follow you into battle but you won't be invading Britain any time soon I'm assuming I'll try not to I'm fighting the urge every day of learning There are lots of landmarks. I know we've talked about some already.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2938.7

Just very quickly, what are sort of the real classic landmarks? Tintagel, Mike's mentioned.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2949.811

And the grave of Arthur and Guinevere was found.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2955.636

When they needed some funding. Yeah, and it's been visited ever since. Oh right, so it's genuine.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2960.559

It was a very useful discovery. Why not upgrade to annual membership?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2966.201

They had a fire and they needed to rebuild and suddenly, out of nowhere, King Arthur! What are the chances?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2983.865

The polls have got one of those.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

2997.816

Your Polish heritage is coming out there.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3011.449

Arthur's Seat in Edinburgh, of course.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3017.614

Mike, do you know which British city has Arthur's seal, Arthur's coat of arms on their modern civic seal? I want to say Winchester. It's a good guess. They've got the round table, right? Yeah, exactly. I would guess Bath because, you know, we talked about the Bath button. It's none of those. Aberystwyth. No, it's... It's Hull. Is it really?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3083.783

So it's time now for the nuance window. This is where Mike and I sit quietly at the round table for two minutes with our many, many, many other nights. And we give Dr. Mary two minutes to tell us something we need to know. So my stopwatch is ready. Without much further ado, the nuance window, please.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3198.979

Amazing. Thank you so much. There you go. To King Arthur. He's the once and future king because actually he keeps coming back.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3208.527

So there we go. How do you feel about King Arthur now, Mike?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3214.652

You said earlier on that you had like rough outlines.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3236.078

Exactly, exactly. So what do you know now? It's time now for the So What Do You Know Now? This is our quickfire quiz for Mike to see how much he has learned. Are you feeling confident? I don't think I am feeling confident.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3257.127

I feel like you contributed very well to the overall conversation, so I'm not going to hold it against you if this is where you fall down. So, ten questions. Here we go. Question one. Which English chronicler wrote A History of the Kings of Britain, inspiring others to create Arthurian romance literature? Your friend and mine, Geoffrey of Monmouth. It was. Question two.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3279.239

It was way too many knights. Question three. In the story of Colic and Elwynn, what weird talent did Lip, son of Placid, possess?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3295.545

What a skill. OK, question four. Why might Geoffrey of Monmouth have changed Merlin's name from Mervyn?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3309.392

Beautifully done. Question five. How did Morgan Le Fay's character arc change over the medieval period?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3320.821

Yeah, a treacherous half-sister. An incestuous mother of Mordred, yes. Question six. Name one Arthurian artefact that allegedly medieval kings claimed to own.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3338.454

Giving it to the King of Sicily or some Duke of Sicily? Yeah, Tancred. Yeah, well remembered. Very good. You could have also had the Sword of St Tristan after his crown as well. And Gawain's head was in Dover for some reason. Question seven. Who wrote Le Morte d'Arthur while in prison? Thomas Mallory. He was. He was the Geoffrey Archer of his age. Question eight.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3357.266

According to Chrétien de Troyes, what was the Holy Grail? Oh, it was a serving platter.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3362.95

Not a cup after all. Yeah, it was a serving platter for the Eucharist. Question nine. Juliet Margaret Cameron's photographs illustrated the ideals of the king written by which famous poet laureate? Tennyson. This for a perfect ten, Mike. Which British city has King Arthur's supposed coat of arms in its crest? Hull. Ten out of ten. That's amazing. Mike Wozniak. You are King Arthur after all.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3424.598

There you go. All right, well, thank you so much. Listener, if you crave more Wozniak in your life, of course you do. Check out our episodes on Stone Age Chattel Hoyuk. Chattel Hoyuk, do you remember that?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3433.2

Or, of course, Dickens at Christmas, a very festive episode. And for more lovely legends, we've got an episode on Atlantis, which was not real, but very interesting. And remember, if you enjoy the podcast, please leave us a review, share the show with friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3446.947

But I just want to say a huge thank you to our guests in History Corner. We had the brilliant Dr Mary Bateman from the University of Bristol. Thank you, Mary.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3455.592

It's been lovely. And in Comedy Corner, we have the marvellous, king himself, Mike Wozniak, the once and future Arthur. Thank you, Mike. It's lovely. I've loved it. Thank you so much. Fabulous. And to you, lovely listener, join me next time as we ride off on another historical quest. But for now, I'm off to go and trim my beard. First, I just need to find a wild boar. Bye!

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3478.148

This episode of You're Dead to Me was researched by John Norman Mason and Hannah Cusworth. It was written by John Norman Mason, Emmy Rose Price Goodfellow, Emma Neguse and me. The audio producer was Steve Hankey and our production coordinator was Ben Hollands. It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

3494.135

You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

385.178

So King Arthur, not necessarily a king, possibly a Roman. Yes. Might be a Briton or a Romano-British. Right.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

408.837

I learned it was Nennius when I was at university.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

412.36

Pseudo-Nennius. I know people like that.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

44.792

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are saddling our noble steeds and galloping back to the Middle Ages in search of the legendary King Arthur. And to help us on our quest, we have two chivalrous companions at arms.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

463.396

Yeah. Wearing woolens. Going to a farmer's market on a Sunday.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

467.359

They've been looking after the environment.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

470.461

And then Brutus shows up. Yeah. With his Greek ways and stabs them. Exactly. Swinging it about.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

481.369

That's right. It's not very nice. No. Come on. So this document, Historia Britannum, or The History of the Britons. Yes. We're not sure who writes it. Maybe Nennius, Pseudo-Nennius. He doesn't call Arthur King Arthur.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

507.563

Yeah, dux bellorum. Lovely. It's nice, isn't it? That's a really lovely phrase. So I have to ask the big question, is he real?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

618.653

So we don't know if there was a real King Arthur. Not to say that there wasn't, but I'm not convinced. Maybe King Arthur is just a friend we made along the way. He's just an idea. It brings us together. So the next text we have to talk about would be a Welsh classic. My pronunciation is going to be dreadful, but Mabinogion...

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

62.657

In History Corner, she's a lecturer at the University of Bristol, where her research focuses on the literature of late medieval and early modern England. Luckily for us, she's also the author of the prize-winning book, Local Places and the Arthurian Tradition in England and Wales, 1400 to 1700. It's Dr Mary Bateman. Welcome, Mary.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

668.28

So written maybe sort of post-Norman conquest, but possibly even older stories.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

739.065

All I'm hearing here, Mary, is he invented Taskmaster. That's what I'm hearing. Mike, 40 tasks, off you go.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

755.83

It's wonderfully weird, but it's brilliant. It's amazing, but it's quite Studio Ghibli. It's quite like talking animals and weird forests. There's lots of people turning into boars.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

81.548

And in Comedy Corner, making a triumphant return to the show, he's a comedian, an actor, a podcaster. You'll have seen him in Taskmaster, Man Down, and again in Taskmaster as Rosematter Fayot's assistant on the wonderful Junior Taskmaster, which is lovely. Plus, you'll have heard his dulcet tones on many podcasts, including my absolute fave comedy podcast, Three Bean Salad. Check it out.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

906.002

Yeah. What's Excalibur called? Because it's not called Excalibur yet, the sword.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

935.815

Sure, yeah, multi-powered, yeah.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

949.147

That's good, isn't it? So we're definitely edging towards Guinevere. We're getting towards Gawain. So it's starting to feel Arthurian. Beginning to feel familiar, yeah. But it's not quite there yet.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

963.016

Yeah, and according to the tale of... How do you pronounce it? Killuck?

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

968.179

According to the tale of Killuck and Oren, we've got King Arthur and a host of 260... Oh, blimey. Quite a lot of people he's gathered around his table. They've got some special talents. Some of them are quite weird special talents, Mary. Yes. We've got Sight, son of Seer.

You're Dead to Me

Legends of King Arthur: from medieval literature to modern myth

99.161

But you'll know him best from our previous episodes, including our festive special about Charles Dickens himself. It's Mike Wozniak. Welcome back, Mike. Thank you very much for having me back. I'm very excited.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1006.113

As a historian, you're loving this, but that's chaos.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1019.503

And the king responds by imprisoning nine MPs. That's not good news, right? John, you can't imprison MPs. Can you? Can he?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1053.728

Toussaint, do you want to guess how long this personal rule no parliament is?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1084.511

It's a good point, John. I mean, is he raising cash just in his own way then? He's not getting Parliament to pass these laws for him?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

109.485

You may have seen him on BBC Three's Stand Up for Live Comedy or loads of Dave shows like Outsiders, Hypothetical, Question Team or Late Night Mash. And you will remember him from our episode on Frederick Douglass. It's Toussaint Douglass. Welcome back to the show, Toussaint.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1171.922

Right. Tucson, if you need to sort of rustle up, I don't know, let's say three billion quid. What strategies would you go for?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1188.374

I mean, that might work. I don't know. Maybe that works in some dictatorships. I don't know. But I think that tends to lead to hyperinflation. But, you know, I'm not an economist. Something he does do is he turns to ship money. What is ship money?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1266.039

You can see the tensions rising here, Tucson, I think, because the king is he's just doing what he wants. So we've already mentioned tension between the kind of the high church situation. Anglicans and the ones who are sort of almost a bit Catholic and the Puritans. What is Armenianism? Is it this high church thing you mentioned?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1342.119

OK, so William Lord, it's Lord L-A-U-D. And there's a vicar called Peter Titley who sounds fun. Not because of his name. I mean, maybe a bit because of his name.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1384.309

Okay, so the anti-Puritan push of the 1630s also enters a surprising arena, which is sports. Toussaint, what kind of things are you imagining here? I'll be generous. There aren't that many formalized sports in the 1630s.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

140.666

Tucson, last time you proved yourself a bit of an American history aficionado. You knew quite a lot about Frederick Douglass.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1401.536

Yeah, so the kind of high church Armenian style sports.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1527.103

There's also the wits and ales. So the brewing of ales, which I think is, again, the Puritans are against. So we've got this sort of culture war. The king is ramping up the culture war on one side. The Puritans are pushing back. But we also then get the cost of living crisis again, John. Why is this crisis happening? It's not... Inflation, is it?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1588.257

Why is the guy dressing up in women's clothing? Is he just feeling more comfortable that way? This is his excuse.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1631.969

It's quite pantomime, isn't it? It's quite sort of weird, wanky. Now, earlier, Toussaint, you mentioned Marvel, and I can ring my Marvel bell because we have Captain Carter show up, who is a lady who sort of rallies the brave lads of Malden in Essex. Do you know what she does, Toussaint?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1649.718

Yeah, they go on a heist. They go to steal some stuff.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1656.246

Well, they're going after the grain. They carted it off. Captain Carter carted it off.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1675.374

You can't eat gold, Doosan. Come on, think of it. They're hungry. This is a political act. John, Captain Carter, or Anne Carter as she is, she was executed for this heist.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1703.509

Yeah. Okay. And the king also devises other stricter penalties. He goes after the printing. So he's sort of controlling the media, I suppose. Is that fair?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

172.548

So what do you know? This is the So What Do You Know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And as you've probably heard of the British Civil Wars, or rather, you've probably heard of the English Civil War. That's not really a name we use that much anymore. And also, there aren't that many movies about it or pop culture about it.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1759.679

Yeah. So getting your ears lopped off in a snowstorm is the 17th century equivalent of YouTube taking down a video for copyright infringement. It's quite bad, but they don't kill you. Let's get back briefly to Captain Carter. Was she rare being a woman involved in protests, John? You said it was rare that she was executed, but were women often politically engaged, politically radicalised?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1849.628

Wow. I mean, chucking molten tar onto a sort of sacred table in a holy building, that's quite bold. Toussaint, I mean, have you ever gone that bold with a protest?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1878.382

All right, so that's a very bold protest. She called herself the primate and metropolitan, and she sat in a bishop's throne as well, didn't she? She really, like, wasn't keen. Cheeky, very cheeky. Cheeky, I think is politely putting it.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

1926.294

We've spoken a lot about England so far, and I think it's really important, in case listeners don't know, that Charles I of England was king of Scotland as well. There were kingdoms that he reunited because he was a steward. His family was Scottish. His dad was Scottish. So these English reforms, these William Lord reforms, was he also pushing them north of the border up into Scotland as well?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

194.483

We've got King Charles popping up in To Kill a King. There was the show The Devil's Whore. There was Blackout of the Cavalier Years. Recently, we've had Julianne Moore and Nicholas Galatine seducing their way into the early Stuart Court in Mary and George, which was very rude and naughty. I enjoyed it. But I reckon most listeners are going to be unsure of the details here.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2029.595

You've said something very, very important there, John. And I'm going to be an absolute childish idiot here. And I'm going to have to just pull you up on something. You said chucked her stool at the dean meeting. Do you mean furniture or do you mean she pooed in her hand and lobbed it at his head? Because I don't know if this is good, but I'd just like some clarity.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2072.033

OK, so you said the Scottish Covenant has got rid of bishops entirely. And this means war, Toussaint. Do you know what this war is called? The British Civil War? You'd think so, right? That's what we've got you here. That's what we're doing. Are we there yet?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2090.071

This is called the Bishop's War. Now, is it a war fought by bishops, for bishops, against bishops, or just near some bishops? How are the bishops involved, John?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

213.41

I think probably you're thinking of Roundheads versus Cavaliers or Oliver Cromwell and his ugly wart or Charles I being beheaded. But how did a civil war actually start? And just how long is a long parliament? Let's find out. The British Civil Wars or the War of the Three Kingdoms or the English Civil War. I mean, there's loads of names for it, but they started in 1642. They lasted about a decade.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2189.354

Yeah. I mean, without wishing to spoil it, there is a second Bishops' War. So as soon as the treaty is signed, he's already planning a second one. And of course, the second one breaks out a year later. So Charles does the obvious thing here. He calls another parliament. And having had the short parliament before, he now goes on a parliamentary bender. It's called the long parliament.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2209.943

He can't get enough. Toussaint, how long is the long parliament?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2218.431

That's a very sensible guess. It's 20 years.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2243.382

In fairness, he was dead for half of that. So, you know, I mean, John, it's a technicality, right? The Parliament is never dissolved because the King is executed. But, you know, we're jumping ahead. But that's why it's called the Long Parliament. Is that fair?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2293.673

Yeah. So we now have a parliamentarian sort of step forward, you know, because often people will assume that Cromwell will be kind of important at this phase. But Cromwell isn't really in the picture yet. The person who steps forward to be sort of leader of Parliament a bit is called John Pym. Is that right?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2343.245

And he gets nicknamed King Pim. Which sounds like Kingpin, but it's King Pim. But that, I mean, I'm guessing his friends call him that?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

237.989

But today we're going to do the prequel. We're going to go Phantom Menace, Toussaint. We're going to basically do... In fact, Phantom Menace had loads of chat about tax and import duties. That's what we're doing as well. So lucky you.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2371.869

Pym starts to unpick Charles's policies. He goes after ship money, which was that inland coastal thing. He goes after the Star Chamber, which is how Charles had crushed the media. He goes after the High Commission. He goes after crucifixes and images in the churches. So he's taking on the Anglican high church, Arminianism. He's sort of puritanising and streamlining government.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2393.493

So King Charles was under huge pressure from Pym and from Parliament in general. And he was now relying on a new advisor called Thomas Wentworth, the Earl of Stratford, who was out in Ireland. And he tried to recall Wentworth back to London. Parliament found out about it. They intercepted him.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2407.921

They accused him of treason and they forced the king to sign the death warrant and Stratford was executed. And he had been running Ireland. And without Stratford there, suddenly we get a huge, huge outbreak of violence in Ireland. And this is a really important factor, isn't it?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2522.065

And we get the Irish Catholic Confederation of Kilkenny, which is the sort of unification of an Irish resistance or independent movement almost. And they are fighting for the king, but they sometimes fight against the Scottish and sometimes for. Like it's it's very confusing what's going to happen. But the Irish equation is so important.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

253.634

It's not all taxes, I promise you. So, John, where do we start our story? Do we start with Charles?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2542.55

And this is one of the reasons we don't call it the English Civil War, because Ireland is a huge part of it. Scotland's a huge part of it. Unfortunately, Wales just gets sucked into England. Sorry, Wales. So we get the Grand Remonstrance. Do you know what that is, Toussaint?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2574.168

But it's not, John. It's much more serious than that. And the music isn't nearly as jolly.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2656.203

There's also a petition presented to Parliament, which is 24 yards long. So it's about 20 metres long. It's got 15,000 signatures on it. It's against Catholic peers and bishops. And I love the idea of just unrolling this petition slowly in front of Parliament. It's so passive aggressive. So the Grand Remonstrance, not a ballroom dance, unfortunately.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2675.997

It's an absolutely huge list of things that people hate about the King. We're getting daily clashes in Parliament by this point. We've got riots, we've got protests, we've got people being shot, proper violence breaking out in Westminster. And a fed up King Charles basically comes up with a plan. He's going to arrest Pym. He's going to accuse him of treason. He's presumably going to execute him.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

277.225

James I of England, James VI of Scotland, but for Toussaint's benefit, what are the super speedy highlights of James I's quite controversial reign?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2788.808

1642, this is the year of the Civil War. And in May of 42, we get the country basically going to... How does the country raise itself to war when it's the king that they're angry at? Well...

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2914.625

I mean, it's a fair point. Why not? Is it just because it's in the middle of the country? Is that just a good sensible?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2947.896

So on the fateful day, 22nd of August, 1642, having come to power in 1625, Charles I raised the royal standard at Nottingham and then apparently the wind blew it down, which was never a good sign, and thus declared the British Civil Wars, the English Civil War, whatever you want to call it, but he declared war. Charles had come to power in 1625.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

2967.305

So it's 400 years this year since Charles has come to power. The question I want to ask you, Toussaint, which side would you have sided with? Would you have gone king or parliament?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3013.123

OK, so you're a cavalier. Yeah, cavalier, yeah. Feather in the cap and off you go. So there we go. So that's the end of the story. We're not going to cover the actual wars itself. We're stopping here. But there we go. Toussaint has committed himself to the king's cause. And John, I guess, I don't know, are you fighting for the parliamentary side? I don't know.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3034.449

OK, great. Lovely. The nuance window! OK, time now for the nuance window. This is where Toussaint and I sit quietly and read seditious pamphlets for two minutes while Dr John tries not to topple over in the pulpits while gesticulating wildly about the British Civil Wars. You have two minutes. Take it away, Dr Healy.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3168.519

Yeah. Too sorry. You were fine for the king a minute ago. What happened? With last year. So what do you know now? This is our quickfire quiz for Toussaint to see how much he has learned and remembered. And you are giggling and wincing at the same time.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3210.763

400th anniversary. Well done. Question two. How did King James and King Charles' close advisor, the Duke of Buckingham, die?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3222.998

He was. He was stabbed outside a pub in Portsmouth.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3231.445

It seems plausible. Question three. During his personal rule, how long did King Charles go without calling Parliament?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3245.234

It was 11 years. Well done. Question four. Can you remember who was Captain Carter?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3261.279

She did and she was executed. Question five. Can you name the Archbishop of Canterbury whose reforms were so unpopular they became unpopular?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3272.589

William Lord. Well done. Question six. Which unpopular tax... There were quite a few, actually. Which particular unpopular tax could King Charles levy without Parliament even in inland communities? Yes.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3300.088

Very good. Well done. Yes. Question seven. Can you name one traditional activity or outdoor activity that Charles encouraged during his anti-Puritan efforts?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3316.75

Yeah, and Morris dancing, maypoles, wits and ales. Yeah, the shin kicking is a good one. Question eight, which wars of 1639 and 40 were sparked by Charles's attempt to bring the Scottish Kirk in line with the English church?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3331.465

It was. Well done. Yeah, Bishop War 1 and 2. Question 9. King Pym. It was King Pym. John Pym. This for a perfect 10. My favourite place in the world, an absolutely beautiful part of England. It's got to be Nottingham. Woohoo! 10 out of 10. Well done, Toussaint. Excellent. Really, really impressive. Well done, John, for an excellent history lesson.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3365.41

Well, thank you so much, Toussaint. And listen, if you want more Toussaint, do check out our episode on the American abolitionist Frederick Douglass, who was an extraordinary man. For more Stuart history, we've got the episode on King James, of course, but also Nell Gwynne, the 17th century actress.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3378.439

And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But I've just got to say a big thank you to our guests in History Corner. We had the amazing Professor Jonathan Healy from the University of Oxford. Thank you, John. Thanks, Greg.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3393.27

And in Comedy Corner, we have the truly talented Toussaint Douglas. Thank you, Toussaint.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3399.714

And to you, lovely listener, join me next time as we untangle the complicated origins of another historical happening. But for now, I'm off to go and petition my local council with a 24-yard-long petition about potholes. They're going to feel my petty wrath. Bye! This episode of You're Dead to Me was researched by Matt Ryan. It was written by Emmy Rose Price Goodfellow, Emma Neguse and me.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

3421.809

The audio producer was Steve Hankey and our production coordinator was Ben Hollands. It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook. You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

378.254

And so by the end of James's reign, England is at war with Spain.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

403.235

It's quite incel behaviour, isn't it?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

422.723

Goodness me. So the end of James's reign, England and Scotland, of course, at war with Spain, which is bad news. So, Toussaint, King Charles I comes to the throne, 1625. Do you think he learns from daddy's mistakes?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

447.58

I think that's a pretty good guess. John, things just get worse for young Charles, don't they?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

488.354

And the grievances are, they're long and they're extensive. One of the grievances is Charles has married Princess Henrietta Maria of France, who of course was a Catholic. This was a provocative move at the time where religious tensions were high. She wasn't even allowed in the church during the coronation and wedding ceremony.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

534.202

There's also a weird thing called, Toussaint, tell me if you've heard of this before, tonnage and poundage.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

547.129

And if we weren't Radio 4, what would you say?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

553.414

All right, John, tonnage and poundage is not as filthy as it sounds.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

57.415

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we're getting political on the 400th anniversary of the coming of King Charles I. So yes, we're travelling back to the 17th century to discover the causes of the British Civil Wars. You might call them English Civil War.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

605.979

Okay, so he's raising an awful lot of money on tonnage and poundage, which is a sort of medieval customs duty.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

618.73

You've mentioned the Duke of Buckingham. So he was King James's lover. He'd been raised to that status. He is the star of Mary and George. If you want to watch that show, it's very fun. So he's sort of chief advisor to Sartre. He's not having a great time of it, though, because he launches a military campaign to go and attack Cadiz in Spain. And it goes very badly.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

637.4

All the soldiers get drunk and then run away. So how do you think he gets back into Parliament's good books?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

658.834

I mean, your instincts are quite good on this. You've basically sort of guessed where we're going in this episode. His attempt to get in their good books is to launch another military campaign, having bungled the first one. And he bungles this one as well. It's a double bungle. He's trying to help the French Protestants, the Huguenots, in La Rochelle, John. And it's a sort of classic clerical era.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

758.439

So we have the Duke of Buckingham killed. The chief adviser's gone. He's out of the picture. So does that mean things are a little bit easier for Charles because Parliament is appeased that, you know, one of the bad guys is gone?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

77.145

We'll explain later. And to help us separate the Royalists from the Radicals, we have two very special guests. In History Corner, he's Associate Professor in Social History at Kellogg College, University of Oxford, where his research focuses on the social history of early modern England. You might have read his incredible book, The Blazing World, A New History of Revolutionary England.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

857.564

We've got the third parliament of 1628 called where, again, he's trying to raise money. Parliament's like, no, people who refuse are imprisoned. They're pushed into the army. They're pressed into the army. So there's real tension where Charles is throwing his weight around. There's a lovely quote, John, Sir Benjamin Rudyard. He says, this is the crisis of parliaments.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

877.577

We shall know by this if parliaments live or die. Oh, that's good, isn't it? It's a good quote.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

901.761

Yeah. And Charles's attitude to parliaments goes, he goes full cycle. King Charles wrote a lovely quote here. At first I liked parliaments, but since, I know not how, I was grown to distaste of them. But I am now where I was. I love parliaments. Tucson, I know you like your politics. I know you're quite, you're quite into sort of politics.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

921.861

Is I love parliaments a good slogan? You know, is it memeable?

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

933.777

So Charles, he loves Parliament for now, but the honeymoon period doesn't last because there's a subsidy bill, John, isn't there? And you've talked about the forced loans, there's martial law, the petition of rights. there's tonnage and poundage again. And you mentioned the subcommittee. The subcommittee are in charge of the tonnage and poundage thing.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

95.455

He's also the author of a forthcoming book, The Blood in Winter, all about the run-up to the Civil War in 1642. It's Dr Jonathan Healy. Welcome, John. Hi, Greg. Lovely to be here. Thank you for coming in. And in Comedy Corner, he's an award-winning stand-up comedian. He's a writer.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

952.227

And they just suddenly decided to be a subcommittee about Catholicism. They just changed the name.

You're Dead to Me

Causes of the British Civil Wars: Royalists versus Parliamentarians

960.752

And Charles is annoyed at this and he demands an adjournment.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1000.159

It's fair to say we would assume that's a hunting scene, right?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1003.6

That panel of lions. Is that what we're seeing here? Are these depictions of... You won't believe what I did last week, lads. I went out and I hunted this many lions and this is what it looked like. What is this for?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1052.624

share it with your friends Sean let's talk art supplies okay they couldn't pop down to WF Smith's for their sort of paintbrush set and their my first art palette what do you think they're using to make all this art whatever's to hand you know because that's art you know it's not about being right it's just about having fun right and using whatever's to hand

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1130.343

So there's a slightly emulsive quality to adding the fats in, right? Makes it slightly thicker and...

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1161.591

Oh, like a straw. Like a straw, yeah. Yeah, cute.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1172.536

Wow. Yeah. Okay, let's talk about the canvas, or rather the caveness. I mean, the actual physical space we're talking about. Sean, when you're writing a comedy show, do you ever think about the physical space you're performing in? So the lights, the sound, the acoustics?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1228.809

So, Izzy, do we get a sense of the cave as an art space?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1275.17

Have a fondle, Sean, have a fondle.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1354.434

So that's ideal.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1357.355

Yeah, it's great, isn't it? Let's leave the cave for now, because that was charming, but, you know, it's quite damp in there. LAUGHTER So that's fascinating. The idea of illustrating the... You've got static art, but it's illustrated by the flicker of the flames. It's a fascinating animating technique. Sean, do you know what the word pareidolia means?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1382.116

If only it was. It's actually the study of parasols, you know, the umbrellas. Now, Izzy, what is pareidolia?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1440.185

But what's so interesting, I think, is that pareidolia, if I understand it, is you're more likely to see the thing that you're accustomed to seeing.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1447.669

So if you spend your days in the dark looking at animals, you're more likely to see animals. Is that right? Yeah.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

147.514

This is a story of working-class women trying to get by. This is survival.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1496.149

Fascinating, isn't it? Yeah. I'm going to drag us back a little bit more towards form and function, a little bit of, like, why might this art have been so important to people? Sean, I mean, we've already talked about, like, hunting manual. Are there any other theories you might want to chuck out as to why people would spend such time and effort doing art? It's something to do, really.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1517.915

I think the one I would pitch more seriously would be when you get people around a campfire and they start telling stories. And I've had this on an archaeology dig. You get people around a campfire from different backgrounds. They don't all speak the same language. Sometimes art is quite useful. So is there anything in that?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

155.45

I'm here shining up my fraudulent damehood. I started getting abuse online for having accepted a damehood, which is the ultimate mark of authenticity.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1595.195

So, OK, so I'm pushing the kind of communication functionality. Are there any other theories that you want to name check, even if you don't agree with them?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1631.627

Maybe religious elements, this early phase of what we might call ritual behavior that, you know, It's no longer simply just survive, but it's now like, here are some ideas we have about maybe there's a sky god or a reindeer god.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1651.69

This is the part of the show where Sean and I put down our paintbrushes and sit quietly by the fire for two minutes for some storytelling, while Dr Izzy takes centre stage to tell us something we need to know about Paleolithic art. Take it away, Dr Izzy.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1781.189

Thank you so much. Listener, if you want more from Sean, of course you do, check out our episode on medieval Irish magic. Also some animal stories in that, some quite weird things in there. Yeah, it gets weird. And for more prehistoric stories, listen to our episode about the Neanderthals with Tim Minchin. That was a fun one.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1796.828

And if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. I'd just like to say a huge thank you to our guests. In History Corner, we have the incredible Dr Izzy Wisher from Aarhus University in Denmark. Thank you, Izzy.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

1811.582

And in Comedy Corner, we have the spectacular Sean Burke. Thank you, Sean. Thank you very much for having me. And to you, lovely listener, join me next time as we uncover another lost historical masterpiece and try not to smudge it with our finger. But for now, I'm off to confuse future archaeologists by painting mammoths all over the local coffee shop. Bye!

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

193.08

Hello and welcome to Your Dent to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are cracking out our crayons and journeying back tens of thousands of years into the deep past to learn all about the Paleolithic and cave art. And to help us paint an audio picture, we have two very special guests.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

213.346

In Archaeology Corner, she's a postdoctoral researcher at Aarhus University in Denmark, where she's researching the evolution of early symbolic behaviour. Usefully for us, she has a PhD from Durham University in Upper Paleolithic Cave Art. It's Dr Isabel Wisher. Welcome, Izzy.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

228.826

And in Comedy Corner, he's a rising star of sketch and stand-up. You may have seen his recent Edinburgh Fringe show, Burke in Progress, a fine title, or caught him on the hilarious sketch show No Worries If Not, The Michael Fry Show or Hollywood Hijack. If you've got the internet, I recommend it. It's very good.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

243.53

You've probably seen one of his many viral comedy sketches, but you'll definitely remember him from our episode on medieval Irish folklore. It's Sean Burke. Welcome back, Sean. Thanks for having me. It's lovely to be back. It's lovely to have you back. Yeah. You've grown a fantastic moustache.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

272.936

What do you know about cave art? Have you seen any? Have you ever visited any or seen it in a movie? I'm...

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

329.98

This is where I have a go at guessing what our listener will know about today's subject. And I reckon you've seen some cave art at some point somehow. At least you've spotted some in the background on the Flintstones. It's in everything from animated movies like the Ice Age franchise, which I absolutely love.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

343.434

It's in the Oscar-winning classic The English Patient, which I'd totally forgotten, but it is in there. Maybe you've visited a cave on your holidays. Someone like Cresswell Crags in Derbyshire or Lascaux in the south of France. But for how long have humans been showcasing their artistic talents? What sort of things did they paint on cave walls? Sean's already given us a summary, but there's more.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

361.566

And were cave people really the first comic book illustrators? Let us find out, shall we? Right, we'll start with some basics. Sean, do you know what we mean by the Paleolithic period? Give me a date range, start and finish. 1975.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

391.926

Because really, it's what, 3.3 million?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

486.506

You have 4% Neanderthal DNA, Sean.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

490.109

I went through your ancestry. I gave you a swap on the way in.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

498.073

That's why you're a bit late. We've got a lab in the back. He stole our hairs. The idea of the Stone Age is 200 years old. The concept of it was coined in the 1820s. When was cave art first discovered? Is it the Victorians?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

545.492

So a mammoth carved a mammoth. Sean, I mean, you're a sketch artist in a comedy sense, but if you were a sketch artist in an artistic sense, what would be your best artwork made of the thing that it's depicting?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

566.035

Let's talk about cave paintings, because I think that's probably what listeners are really imagining in their head. So when were those first found?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

636.556

So there's one guy called Harlow who visited this site.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

650.206

Just get out a sharpie. There you go, mammoth, what do you want? He did the opposite. He wiped his finger across it and smudged it through. What does that prove? That it's incredibly delicate?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

674.084

I understood few of those. Exactly. It's basically my bad.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

690.714

Priced his artwork, rubbed his finger through it, nearly destroyed it. Sean, what's the comedian's equivalent of that?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

705.9

All right, so we've done southern France, we've done Altamira in Spain. Where else were the major sights?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

734.554

But we do actually have a much older example of drawing.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

764.372

OK, so that's 100,000 years ago, the earliest human art that we have in terms of drawing. Let's move on to representative art. This is art that looks like a thing. So, Sean, in the past few months, literally in the past few months, scientists have announced the discovery of the oldest ever painting depicting a real thing. OK. It was found in Sulawesi, which is in Indonesia, on an island. Right.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

789.07

Yeah, I'm going to stick with beach ball. Beach ball? Yeah, yeah. Yeah. Well, we can show you what it was. I'll hand it to you. There you go. Thank you. What can you see? A very well-fed pig. Yeah. Is it? Yeah. All right. It's an incredible pig, isn't it? Yeah. Yeah, it looks happy and healthy, if you ask me. Izzy, this is very exciting for numerous reasons.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

811.361

A, it's the oldest ever representative art.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

813.902

Secondly, art outside Europe.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

816.343

So tell us about it.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

844.742

Is art something that's invented once and spreads or is it a human instinct that shows up constantly in different places because each new group of humans is going, I've got an idea.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

887.366

I think listeners are thinking, talk about the bison. Talk about that. So what kind of animal? Well, actually, I'll ask you, Sean, what kind of animals, apart from bison, because that would be cheating.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

911.613

So you think predatory animals?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

913.995

Big, scary, predatory animals. I think that's a very common response. Yeah. And surprisingly, that's not common at all, is it?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

936.589

Yeah, and wild cattle called aurochs, which are terrifying. They're mega cows. Yeah. Mega cows. Imagine a cow charging towards you.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

948.114

Okay, I got it. I'm running.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

955.7

I don't think you're getting it. Mega cow. So we do have one famous scene.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

962.786

It's called the Panel of the Lions.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

965.028

Where is it?

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

968.03

I can show it to you, Sean.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

970.414

I'm handing you a bit of paper. Thank you.

You're Dead to Me

Palaeolithic Cave Art (Radio Edit)

981.85

Kind of like a terrifying herd, really. The first image I get on this is it looks like a scene from a kind of comic book or something. It's got a very interesting overlapping depth of field.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1010.077

No, I love a bit more boring. That's very much over here. But that has brought us on to the idea of Catholicism and coffee. So we've already mentioned Islam and that kind of big debate over those sort of theological questions of can you have this as a licit or illicit drink? How do you think the Pope, Pope Clement VIII, where do you think he stood on the moral question of coffee in the 1600s?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

105.822

Welcome back for a sixth appearance, Sophie.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1106.792

That's a shame, though, because the line, this devil's drink is delicious, is a really good line. It's a good one. Stick that on a T-shirt.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1116.437

Someone phone up Mespresso and say, we've got a new marketing line for you. So we've seen in the Ottoman world that the idea of the coffee house could be seditious and dangerous, but also there would be intellectual activity there. People gathering, discussing, debating political ideas. Does the same thing happen in Europe?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

113.809

Yeah. She was busy doing the Grammys or something.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1131.465

Do we see the sudden arrival of a kind of coffee culture that is philosophical and enlightened and scientific? Yeah.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

121.135

A key important question here. I'm relying on you. Do you drink coffee?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1282.108

Esquerose, Greek Orthodox, was it? Yeah, exactly. Immigrant to London. He published an advert for his coffee shop, which he listed coffee as having many health benefits, Sophie. He said it aided digestion, prevents drowsiness, prevents miscarriages, helps sore eyes and headaches, cures coughs, consumption, which is tuberculosis, scurvy, dropsy and gout. Wow.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1306.023

What's modern? I mean, it's a wonder drug, clearly, in the 17th century. How would you market coffee now if you were going to add extra things it does? What's your additional claims?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1334.636

We'll settle on that. It's not a ringing endorsement, but we'll settle for that, Jonathan. OK, so we've heard health benefits and claims being advertised by Pasqua Rose, who opens the first coffee house in London in 1652. And we get this intellectual culture in coffee houses. You know, they become places of more than just socialisation. Is that right? Yeah.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1382.062

The insuring firm. The insuring firm. The stock exchange that powers the City of London and the insurance industry both start in coffee houses. Correct. That's quite impressive.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1435.163

And we also get some quite famous names from the 1600s showing up in these coffee houses to have some big, big old chats. Isaac Newton. Oh, yeah. And Edmund Halley, famous for his comet spotting abilities. They were founding members of the Royal Society of Science. They met and did a public demonstration in London's Grecian Coffee House. What did they demonstrate, Sophie? What did they do?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1472.672

If I say to you dissection, what animal do you think they might be dissecting live in a coffee house? A frog.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1498.74

A live dissection of a dolphin in a coffee house.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1511.763

Oh, boy. We also need to talk about Voltaire. You studied French. Yes, I did. So you know who Voltaire is. I do know who Voltaire is.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1522.131

He enjoyed his coffee. How many cups a day do you think he drank?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1571.425

So the intellectual revolution was, you know, the Royal Society, powered by coffee, the insurance industry, the economic industry. I mean, coffee is powering everything. And I suppose the interesting question is, this is an import from the Arab world via the Ottoman Empire, who sometimes are the enemy, right? In the 17th century, we have these huge wars between Christianity and Islam.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1592.498

So the Turkish... are the enemy, and yet this is a Turkish drink. I mean, what... Is there a rebranding? Is there a sort of awkwardness there?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

165.866

I don't drink coffee at all. I don't know anything about coffee. So Jonathan, I'm assuming you're a coffee drinker.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1686.039

So cafe au lait. So cafe au lait. So it's a French compromise. They are willing to accept an exotic foreign import, but they have to find a way to... Yeah, to kind of Frenchify it. We need to talk about the darker side of this coffee boom. Where do these things originate from? We've heard they came from Ethiopia, then Yemen, then the wider Islamic world.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1706.455

But by the 1600s and definitely 1700s, we're getting coffee plantations? Yeah.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

176.43

All right. And you're going to talk us through the history of coffee. So we're going to learn plenty today. So what do you know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1793.722

So by the 1780s, 80% of the world's coffee supply comes from the Caribbean. Yes.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1805.229

Right, okay. So where does Britain muscle in to this history?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

192.754

And whether you've got a crippling caffeine problem, whether you keep it decaf, whether, like Sophie, it is a dangerous thing for you, or if you're like me, you just can't stand the bitterness, you all know what coffee is. I don't know if it explains to you what coffee is. In terms of pop culture, coffee is just part of our life. Coffee shops crop up all over our favourite pop culture.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1922.882

OK, so we've had some pretty horrible history there. Let's try and be a little cheerier. Sophie, when do you think America fell in love with their cup of joe, the US? What do you think their kind of inciting moment is where they go, hang on a second, we're coffee drinkers?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1946.676

You've gone, okay, so you're like 1880s.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1954.801

Okay, fine. If I say to you, Boston Tea Party. No. You just reject that outright. No.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

1963.956

So you've gone too early now, I think, maybe. Or maybe you haven't. Jonathan, the Boston Tea Party is obviously in the 1770s.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

2091.622

So the American Civil War was in the 1860s, obviously. And this extraordinary thing, soldiers' diaries mention the word coffee more than the word bullet or rifle. We also have a soldier called Lieutenant Colonel Walter King. It's a soldier in Missouri Cavalry Regiment who designs a rifle which has got an inbuilt coffee grinder.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

211.736

You've got Central Perkin Friends. You've got Luke's Diner and Gilmore Girls. You've got Will Ferrell enjoying the best cup of coffee in the world in Elf. Giles from Buffy, featuring in the Sexy Nescafe adverts from the 90s. You've got Sabrina Carpenter, already mentioned by Sophie, the espresso summertime hit.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

2112.87

If you can install a coffee grinder into any everyday item, what would you go for? Put you on the spot.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

2145.943

I feel I know where you're going with this. OK. But... Moving on. Thank you for your contribution, Sophie. Okay. We also get, Jonathan, at this time, customers buying loose green coffee beans. They're roasting them at home. So you can now make coffee at home. We get mechanical improvements too, don't we? Jabez Burns is important.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

226.267

And my personal fave would be Paul Rudd ranting in Role Models about the stupidly inconsistent name of all the different coffee sizes. Venti means 20, he shouts. But what about the history of coffee? How did it become the world's favourite beverage? And what do goats have to do with it? Let's find out. Right, Professor Jonathan, can we start with the basics?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

245.625

I'm pretty sure Nespresso pods do not grow on trees. That is correct. Good. They do not. Good. No.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

278.396

And there's caffeine in those seeds beans.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

2918.355

It is Starbucks. And this is important, I suppose, for economic reasons, for corporate reasons, but also just the sort of taste reasons in terms of the idea of speciality coffees, the idea of coffee as something you can enjoy, almost like you can enjoy red wine.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

294.632

Sophie, maybe you're being enchanted.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

2988.565

So there we go, Sif. We've done a lot of latte history. We've gone around the world. We've seen coffee was religious, medical, political, colonial, cultural, industrial. Does it change your view? Are you more tempted to go out and drink a coffee now or are you less tempted? Yeah.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3026.392

Yeah, we've heard a lot today about people getting together and being together and socialising, chatting, communing.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3052.58

This is where Sophie and I sit silently and sip our moccas for two minutes while Professor Jonathan tells us something we need to know about the history of coffee. My stopwatch is ready. Take it away, Professor Jonathan.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

310.39

Where in the world do these beans, trees, shrubs, whatever they are, grow? Where is their natural habitat?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3200.421

Wonderful. Thank you. Sophie, any thoughts on that?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3229.368

So what do you know now? It's time now for So What Do You Know Now? This is our quickfire quiz for Sophie to see how much she has learned. We have fired a huge amount of history at you across the globe. You're one of our quiz queens, however. You are notoriously good at this. Are you feeling the pressure?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3255.942

Amazing. OK, I've got ten questions for you. Here we go. Question one. A man named Kaldi allegedly discovered coffee beans when dancing with which over-caffeinated animals? It was a goat. It was his goats. They were enjoying the bean. Question two. Which Arab country was at the centre of the first coffee trade?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3279.457

It was Yemen. Well done. Question three. Why did Ottoman Sultan Suleiman the Magnificent close coffee shops in 1565?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

328.961

Lovely. There is a story. There's a sort of lovely myth that people like to talk about. The first time people got hooked on caffeine in these wild coffee plants involved an animal. Sophie, do you want to guess what the animal was and what the story was?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3294.109

Question four. What did Pope Clement VIII never do but allegedly call coffee?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3303.704

Very good. That's right. He never actually said it, but we like it so much it's in the quiz. Question five. What patriotic coffee drink was invented in France in the 18th century?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3314.327

Café au lait. Café au lait. Question six. What did Isaac Newton and Edmund Halley get up to in London's Grecian coffee house?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3331.905

Flipper. Question seven. Can you name two supposed health benefits of coffee according to Pasquale Rose's 1652 advert?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3344.527

Very good. That's two. That's good. Very good. You could add sore eyes, dropsy, gout, scurvy, drowsiness. It does everything. Of course, it doesn't. Question eight. What ingenious coffee-related device was invented by a soldier during the American Civil War?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3363.05

He did put a grinder in his rifle. Well done. Question nine. What didn't the original Starbucks sell?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3399.827

Well, I mean, it's been extraordinary history. Thank you so much, Jonathan. Thank you, Sophie. OK, listener, if you want to double down on Duca, you can check out our episodes on Benedetta Carlini, Ashanti Garner, The Chevalier de Saint-Georges, if you want some musical history.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3412.415

And for more foodie historical stuff, we have episodes on the history of chocolate, on the history of ice cream, and on celebrity chef Alexis Soyer, which is one of my favourite episodes. That's a very fun one. And remember, if you've enjoyed the podcast, please share the show with your friends.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3425.024

Subscribe to You're Dead to Me on BBC Sounds to hear the episodes one month before other platforms, lucky you, Make sure also to have your notifications switched on so you never miss an episode. But I'd just like to say a huge thank you to our guests in History Corner. We had the coffee historian himself, Professor Jonathan Morris from the University of Hertfordshire. Thank you, Jonathan.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3444.071

I will. I will give it my best. And in Comedy Corner, we had the ever-sensational Sophie Duker. Thank you, Sophie. Thank you so much. Thank you. And to you, lovely listener, join me next time as we savour another historical delight. But for now, I'm off to try and convince the Pope to sanction my debilitating hot chocolate habit. Bye! This episode of You're Dead to Me was researched by Matt Ryan.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

3466.309

It was written by Emmy Rose Price Goodfellow, Emma Neguse and me. The audio producer was Steve Hankey and our production coordinator was Ben Hollands. It was produced by Emmy Rose Price Goodfellow, me and senior producer Emma Neguse and our executive editor was James Cook. You're Dead to Me is a BBC Studios audio production for BBC Radio 4.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

354.561

It is a goat. So tell me the story. Recount for me this fabled myth.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

384.409

Fighting trolls is a lovely reference.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

456.907

Yeah, there's one involving Solomon, King Solomon.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

49.943

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster. And today we are grinding our beans, popping on the kettle and plunging our cafetiere as we learn all about the history of coffee. And to help us get caffeinated and educated, we've invited over two very special coffee guests.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

491.296

Yeah. Very fast. That's our kind of mythic origins. But what about an actual historical reference, Jonathan? Have we got something that we can we can say this is the first mention of coffee?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

552.548

But it may have been older. That's just our earliest reference.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

582.046

Ethiopia to Yemen crosses across the Straits and into Yemen, so we're into the Arab world. From Yemen, do we get it then spreading out through those sort of trade routes out through the Middle East?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

612.986

Gotcha. And so it spreads through trade routes. You've got Mecca, Jeddah, Medina, Cairo, these big, big cities in the Islamic world. At what point do people go, But it tastes nice and I'm not a sophistic, but could I just drink it? When does it become a beverage?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

656.844

So it's within the rules of Islam, you can drink coffee.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

681.88

Sophie, this Pasha, which means governor really, he's called, I think, Kayir Beg. Why do you think he wants to ban coffee? What do you think is a problem about it?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

70.2

In History Corner, he's a research professor in history at the University of Hertfordshire, where he's a historian of consumption, especially the history of coffee. Maybe you've read his book, Coffee, A Global History, or listened to his podcast series, A History of Coffee. It's Professor Jonathan Morris. Welcome, Jonathan. Thank you, Greg. Lovely to have you here and in Comedy Corner.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

714.013

I think there's a good instance. I mean, that's probably about right, I think, Jonathan.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

765.189

Gosh. So students of the 1500s. And it's Suleiman the Magnificent. He closes down the coffee houses in Istanbul and Aleppo and Damascus. And yet somehow, as you say, the coffee house culture starts to thrive.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

828.715

Yeah. I see. Okay. By the 1600s, I think we find coffee in Europe. So how does it come into Europe, Jonathan?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

88.604

She's an award-winning comedian and writer. You will recognise her from loads of TV, including her glorious victory on Taskmaster. Maybe you've seen her new stand-up show, But Daddy, I Love Her. It's fantastic. And of course, you'll remember her from our back catalogue, including recent episodes on Naughty Nun, Benedetta Carlini and The Legend of Atlantis. It's Sophie Duker.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

898.598

And this stuff, this is called a fin can. Is it a fin can?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

919.922

Sophie, would you take a prescription of coffee? It doesn't sound like it would do you any good.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

933.233

I wanted to ask you actually, Sophie, do you know where the name cappuccino comes from?

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

965.198

What's the etymological? It comes from, so we have, I guess in our typical language, we have two words for cappuccino. One would be a type of monkey.

You're Dead to Me

History of Coffee: from devil’s brew to our favourite beverage

972.42

The other one will be a type of monk. So it's named after the monks. It's named after the Italian Capuchin friars who wore brown robes. And so cappuccino is named after the type of brown robes that they wore.

You're Dead to Me

Aristotle (Radio Edit)

1004.525

Yes. So the Lyceum is arguably the first teaching university. The academy is a philosophy class. But this has got a library. This feels like it's something different. It is something different.

You're Dead to Me

Aristotle (Radio Edit)

1066.235

Yeah, so the father of the GP was Nick Comacus.

You're Dead to Me

Aristotle (Radio Edit)

1076.58

So he writes 160 books or treatises.

You're Dead to Me

Aristotle (Radio Edit)

1091.023

Okay. And he's writing books on physics, on metaphysics, on Nicomachean ethics, the politics, on the soul. He writes about the soul. He writes about animals. He writes about storytelling. He writes about jurisprudence and law and justice and equity. Like he's just every subject. Logic. He's doing everything.

You're Dead to Me

Aristotle (Radio Edit)

1107.887

And the thing that I suppose he's most famous for in moral philosophy is what we call virtue ethics. Yeah. How would you sum that up? I mean, it's a big subject. How would you sum that up quickly on a comedy podcast?

You're Dead to Me

Aristotle (Radio Edit)

1132.679

It's so sensible. It's sensible centrist politics. It's what we want. And there are words that are used in philosophy. Eudaimonia. Yeah, that means... Flourishing.

You're Dead to Me

Aristotle (Radio Edit)

1150.514

So be good, be happy, and you will be good. And if you be good, you'll be happy. Basically. It's pretty good, isn't it?

You're Dead to Me

Aristotle (Radio Edit)

118.598

This is the So What Do You Know? This is where I have a go at guessing what you, our lovely listener, might know about today's subject. And Aristotle is one of the most famous Western philosophers of all time. He's one of the most famous names in all of history. Maybe you're picturing a beardy guy in a robe.

You're Dead to Me

Aristotle (Radio Edit)

1219.948

No, he doesn't.

You're Dead to Me

Aristotle (Radio Edit)

1233.277

Wow, okay.

You're Dead to Me

Aristotle (Radio Edit)

1250.051

I think we do. I mean, we've spent a lot of the episode saying what an extraordinary man. And I'm not going to back away from that. But he has flaws. He's not a saint. There are things that he believed that we would find repellent. Absolutely. One of them was that he did not believe women were as intellectually capable as men. Right. So he thinks women are not as smart.

You're Dead to Me

Aristotle (Radio Edit)

1289.35

Yeah.

You're Dead to Me

Aristotle (Radio Edit)

1319.089

We do have to kill Aristotle off. He sort of dies slightly in ignominy. He's sort of chased out of Athens.

You're Dead to Me

Aristotle (Radio Edit)

133.985

Maybe he's lecturing a bottle-blonde Alexander the Great because you've seen the movie Alexander where all the Macedonians were Irish for some strange reason. Perhaps you've encountered Aristotelian ethics through the wonderful sitcom The Good Place. But who was this philosopher who changed intellectual life in the West forever? How did he get to be so brainy and so important?

You're Dead to Me

Aristotle (Radio Edit)

1375.472

And Theophrastus stays behind in that. Yes. And keeps his books. And that's how we have them, right?

You're Dead to Me

Aristotle (Radio Edit)

1397.734

Wonderful relationship. So he died soon after the sort of exile from Athens. And his reputation immediately after is not that burnished with glory. It takes a little while for people to rediscover his brilliance, I think. Is that fair?

You're Dead to Me

Aristotle (Radio Edit)

1429.844

So there you go, Dan. Aristotle, pretty good life.

You're Dead to Me

Aristotle (Radio Edit)

1445.75

But when we did the Pythagoras episode, you were able to sort of knock down quite a few myths.

You're Dead to Me

Aristotle (Radio Edit)

1459.634

The nuance window! No! All right, time now for the Nuance Window. This is where Dan and I peripatetically promenade around the Lyceum for two minutes while Professor Edith tells us something that we need to know about Aristotle. My stopwatch is ready. You have two minutes, Edith. Take it away.

You're Dead to Me

Aristotle (Radio Edit)

153.612

And what do you do when a king orders you to tutor his frat boy son? Let's find out. Right, Professor Edith, let's start at the beginning. Where and when was Aristotle born? What was his family situation like?

You're Dead to Me

Aristotle (Radio Edit)

1557.483

Intellectual history and then we end up with a bum joke. That's what should be in his poetics about comedy, right? Yeah. Are you kind of like on board with Aristotle? Because I think we're both team Aristotle over here.

You're Dead to Me

Aristotle (Radio Edit)

1595.284

Yeah. Lovely stuff. Well, thank you so much, Dan. Thank you, Edith. And listener, for more applied philosophy, check out Edith's previous episode on Pythagoras, which was an absolute hoot. We also did an episode on medieval science. And if you want more Dan in your ears, you can scroll all the way down in the app back to 2019 to the Young Napoleon episode with Dr. Laura O'Brien.

You're Dead to Me

Aristotle (Radio Edit)

1614.218

It's a really fun one. And remember, if you've enjoyed the podcast, please leave a review, share the show with your friends, subscribe to You're Dead to Me on BBC Sound so you never miss an episode. But I'd just like to say a huge thank you again to our guests. In History Corner from the University of Durham, we had the fantastic Professor Edith Hall. Thank you, Edith. Thank you.

You're Dead to Me

Aristotle (Radio Edit)

1630.664

And in Comedy Corner, we had the brilliant Dan Schreiber. Thank you, Dan. Thanks, Greg. To you, lovely listener, join me next time as we return to the classroom for another lesson from the past. But for now, I'm off to go and rewrite Aristotle's lost volume on comedy. I think it's mostly to do with bums. Bye!

You're Dead to Me

Aristotle (Radio Edit)

1674.248

Defibrillation.

You're Dead to Me

Aristotle (Radio Edit)

25.78

And to help us tell our virtue ethics from our empiricism, we have one top-notch teacher and one very eager pupil. In History Corner, she's Professor of Classics at Durham University and a Fellow of the British Academy. You might have heard her on Radio 4's Natalie Haynes stand-up for the classics or Radio 4's Great Lives.

You're Dead to Me

Aristotle (Radio Edit)

250.581

What do you think he does with his time, you know, 13, 14? Was there any sports at the time? Oh, yeah.

You're Dead to Me

Aristotle (Radio Edit)

273.9

Intellectual things.

You're Dead to Me

Aristotle (Radio Edit)

275.34

He's absolutely excelling everywhere. And so his brother-in-law and his sister spot the talent and go, this kid needs proper training, right? Absolutely.

You're Dead to Me

Aristotle (Radio Edit)

322.59

Yeah, right.

You're Dead to Me

Aristotle (Radio Edit)

323.931

So Aristotle rocks up to Plato's Academy. He's going to learn from this superstar philosopher. And Plato had been taught by Socrates.

You're Dead to Me

Aristotle (Radio Edit)

351.116

And he studies a variety of things at the academy, right? So it's not just philosophy, it's astronomy, natural science. Well, he studies lots of things that Plato really wouldn't have approved of.

You're Dead to Me

Aristotle (Radio Edit)

40.843

Maybe you've read one of her many books, including Aristotle's Way, How Ancient Wisdom Can Change Your Life, and her most recent book, Facing Down the Furies. And you'll know her from our episode on Mr Triangle himself, Pythagoras. It's Professor Edith Hall. Welcome back, Edith.

You're Dead to Me

Aristotle (Radio Edit)

404.868

So he writes about lyric poetry. He writes about drama. He writes about epic, which I guess is the Iliad, the Odyssey. He writes about comedy, but we don't have it. Which is devastating to me because you and I both love comedy. We don't have his book on comedy.

You're Dead to Me

Aristotle (Radio Edit)

421.652

Where did it go?

You're Dead to Me

Aristotle (Radio Edit)

469.716

I think he thought he was an appropriate wit. In 348, a big thing happens to him. The death of Plato, 348 BCE. His tutor, his great intellectual figurehead dies. And again, the idyllic life comes crashing down around him. And you might assume that he gets the gig, teaching at the academy, takes over running the school.

You're Dead to Me

Aristotle (Radio Edit)

508.893

You've clearly deduced what happened because he doesn't get the job that he's expecting. The rivals sort of step in and muscle him out. And it's a guy called Spew Sippers. Yeah, which means enthusiast for horses.

You're Dead to Me

Aristotle (Radio Edit)

543.41

It's bye bye, Aristotle. So he doesn't get the gig and he instead he gets an invitation to go to a new place. He does. And this place is called Assos.

You're Dead to Me

Aristotle (Radio Edit)

551.737

And off he goes to Assos, which is where?

You're Dead to Me

Aristotle (Radio Edit)

585.137

Which sounds very progressive and modern, doesn't it? So he heads off to Assos. I spent most of my 30s on Assos too, but I was mostly trying to buy skinny jeans. That would be an Aristotle joke. That's appropriate wit, everyone. I bet there was an equivalent joke to that. So Assos, he goes there and he finds love. He does.

You're Dead to Me

Aristotle (Radio Edit)

6.712

Hello and welcome to You're Dead to Me, the Radio 4 comedy podcast that takes history seriously. My name is Greg Jenner. I'm a public historian, author and broadcaster and today we are dusting off our philosophy textbooks and going back nearly 2,400 years to ancient Greece to learn all about one of history's greatest beardy chin-strokers, Aristotle.

You're Dead to Me

Aristotle (Radio Edit)

60.908

OK, we'll get into that later. And in Comedy Corner, he's a writer, comedian, presenter, producer and podcaster. He's a polymath. Maybe you've listened to his incredible podcasts. No such thing as a fish. And his new show, We Can Be Weirdos. And you'll definitely remember him from our episode of You're Dead to Me all the way back in Series 1 on Young Napoleon. It's Dan Schreiber.

You're Dead to Me

Aristotle (Radio Edit)

615.224

He marries her and it seems to have been very happy. They have a daughter together, also called Pythias, because Aristotle apparently, you know, he's run out of names. He's like, well, you know, I've met one.

You're Dead to Me

Aristotle (Radio Edit)

627.427

Oh, really? In which case it would have been very natural to call the little girl. Oh, that's sad. But they move to the Isle of Lesbos. They do. Which is not far from Assos. And we've got this single dad with his little girl. What do you think they get up to on Lesbos? What do you think Aristotle's going to do?

You're Dead to Me

Aristotle (Radio Edit)

643.512

Nice try.

You're Dead to Me

Aristotle (Radio Edit)

656.382

And it's a place of great culture.

You're Dead to Me

Aristotle (Radio Edit)

743.493

He's not desperately trying to get his job back in Africa.

You're Dead to Me

Aristotle (Radio Edit)

747.994

Study that lemon and write a book about it. Right, exactly.

You're Dead to Me

Aristotle (Radio Edit)

760.578

And so when he's there, he describes 500 species of animal. He's looking at plants as well. Yeah, but it was easier back then. There was so much, nothing had been described.

You're Dead to Me

Aristotle (Radio Edit)

796.919

And extinction is an idea that isn't really rediscovered until the 18th century.

You're Dead to Me

Aristotle (Radio Edit)

81.456

Welcome back, Dan.

You're Dead to Me

Aristotle (Radio Edit)

812.508

You think he's got a wristwatch? You think it is?

You're Dead to Me

Aristotle (Radio Edit)

818.349

I knew you'd make it weird. I didn't think it would be this far in.

You're Dead to Me

Aristotle (Radio Edit)

825.991

Yeah. He's on Les Boss. He's doing all this. He's having a great time. He's written stuff. And then suddenly he gets a job offer. Oh, dear. From a man called Philip of Macedon. He was in the king business. And Philip says, I've got a kid over here. Bit of a brat. Could you teach him? And the kid's name is? Alexander the Great. Not yet great. Not yet great.

You're Dead to Me

Aristotle (Radio Edit)

845.82

The brat. So he's the heir to the throne. He's the son of Philip's fourth wife, Olympias. Complicated court politics, murder, poison, intrigue. Absolutely. You never know you're going to survive through adulthood. And Aristotle gets the gig and he decides to go. Why? Why?

You're Dead to Me

Aristotle (Radio Edit)

879.807

So you think he's a threat?

You're Dead to Me

Aristotle (Radio Edit)

892.337

Because Alexander is told, you don't have to be a philosopher, but please do listen to the philosophers, which feels like a compromise. Like, OK, all right, you're not going to be a philosopher. I get it. But can you at least listen to them? Well, he would have definitely taught him ethics, politics and rhetoric.

You're Dead to Me

Aristotle (Radio Edit)

910.476

So rhetoric is speech-making.

You're Dead to Me

Aristotle (Radio Edit)

938.428

But he doesn't put names to it usually. It's aged 48 that we get Aristotle returning to Athens. And he's lived life by this point. He has written a new constitution. He's fallen in love. He's become a new dad. He's been widowed. He's invented zoology. He's invented marine biology. He's tutored a trust fund brat and survived the most dangerous blaze in the world. And he's gone back home to Athens.

You're Dead to Me

Aristotle (Radio Edit)

95.126

So last time out, Dan, we had you back in 18th century France and Corsica, and we were following the travails of a young man called Napoleone. Yes. How do you feel about ancient Greece? Is this a comfort area for you?

You're Dead to Me

Aristotle (Radio Edit)

957.06

You'd think to take up his job at the academy, but he doesn't, right? He ends up opening a rival school, which I don't know if that's petty. No, it's not petty. No? He just wanted to run his own show.