Dr. Suzanne Humphries
👤 PersonPodcast Appearances
1916, Upper East Side, Manhattan, there was a Rockefeller lab that their specific stated goal was to try to create the most pathological, neuropathological strain of polio possible. And they did that by taking monkey brains and human spinal serum and injecting it into monkeys. And there was a big problem with that, which was released into the public by accident.
1916, Upper East Side, Manhattan, there was a Rockefeller lab that their specific stated goal was to try to create the most pathological, neuropathological strain of polio possible. And they did that by taking monkey brains and human spinal serum and injecting it into monkeys. And there was a big problem with that, which was released into the public by accident.
And the world experienced the worst polio epidemic on record, 25% mortality. That's unheard of. Really freaked the public out. And you can see the epicenter as it fanned out. And as it fanned out and as time went on, never heard of it again. It attenuates as it moves through the body because it's a normal human commensal that goes back to its normal state when it's in a human.
And the world experienced the worst polio epidemic on record, 25% mortality. That's unheard of. Really freaked the public out. And you can see the epicenter as it fanned out. And as it fanned out and as time went on, never heard of it again. It attenuates as it moves through the body because it's a normal human commensal that goes back to its normal state when it's in a human.
It is. And it doesn't develop drug resistance like a lot of the drugs that are engineered for it. Yeah, the hippies seem to have got it right, I think.
It is. And it doesn't develop drug resistance like a lot of the drugs that are engineered for it. Yeah, the hippies seem to have got it right, I think.
And that's generally what happens. If you have a highly lethal virus and it kills a lot of people, those people are dead. They can't spread anything. So that's kind of a different story if you want to talk about hantavirus or something like that. But as far as polio goes, no, polio was only made more lethal by the stupid things that humans did around it.
And that's generally what happens. If you have a highly lethal virus and it kills a lot of people, those people are dead. They can't spread anything. So that's kind of a different story if you want to talk about hantavirus or something like that. But as far as polio goes, no, polio was only made more lethal by the stupid things that humans did around it.
So make it more invasive into the body, just like you can go do stupid things and end up with herpes outbreaks and staph outbreaks. Poliovirus is a normal commensal. It used to be until we obliterated it with oral vaccines and replaced it with vaccine strain. But the wild strains... are normal human commensals.
So make it more invasive into the body, just like you can go do stupid things and end up with herpes outbreaks and staph outbreaks. Poliovirus is a normal commensal. It used to be until we obliterated it with oral vaccines and replaced it with vaccine strain. But the wild strains... are normal human commensals.
Absolutely. Today, it would be the oral polio vaccines because they're the live strains and they're still giving them pulse fashion all throughout India. They did a campaign a few years back in Israel, and they always say that a nomad came and pooped in the sewage system, and they find it in the sewage system, and they don't want an outbreak to happen, so they treat everybody.
Absolutely. Today, it would be the oral polio vaccines because they're the live strains and they're still giving them pulse fashion all throughout India. They did a campaign a few years back in Israel, and they always say that a nomad came and pooped in the sewage system, and they find it in the sewage system, and they don't want an outbreak to happen, so they treat everybody.
So that's today the most common reason to see
So that's today the most common reason to see
poliomyelitis disease from a virus if you test for a virus they'll usually find the vaccine virus and that's why today we don't remember when we were kids because we're about the same age I think they would give us the sugar cube maybe you didn't but I did I got the sugar cube and that was the live vaccine well they stopped doing that because after a while the only cases of polio and it became so obvious that the only cases of polio we were seeing related to a virus when they tested for polio virus were vaccine strains then they started injecting us again
poliomyelitis disease from a virus if you test for a virus they'll usually find the vaccine virus and that's why today we don't remember when we were kids because we're about the same age I think they would give us the sugar cube maybe you didn't but I did I got the sugar cube and that was the live vaccine well they stopped doing that because after a while the only cases of polio and it became so obvious that the only cases of polio we were seeing related to a virus when they tested for polio virus were vaccine strains then they started injecting us again
But the early injections caused more paralytic polio than it prevented. And that's the part that people don't understand when they say, what about polio? Because they, like you, just go, well, there's no more iron lungs. There's no more crippling. There's no more of these poor little kids walking around with their casts. Well, that's not true because the iron lung is now called a ventilator.
But the early injections caused more paralytic polio than it prevented. And that's the part that people don't understand when they say, what about polio? Because they, like you, just go, well, there's no more iron lungs. There's no more crippling. There's no more of these poor little kids walking around with their casts. Well, that's not true because the iron lung is now called a ventilator.
So that's out the window. Transverse myelitis, which there are about 1,300 cases. I think it's a month diagnosed in one particular – I put a quote – put a quote in here on that. But transverse myelitis is actually something that would have absolutely, it follows the same pathology as polio, would have been called polio back in the day.
So that's out the window. Transverse myelitis, which there are about 1,300 cases. I think it's a month diagnosed in one particular – I put a quote – put a quote in here on that. But transverse myelitis is actually something that would have absolutely, it follows the same pathology as polio, would have been called polio back in the day.
So we still have polio that we had in 1953, because in 1953, all you had to have to be diagnosed is polio. Anyone could diagnose you, just one examination with one set of muscles being paralyzed. There was no timeframe on it. There was no testing done on it. And then it was considered a public service to do it because then you were eligible for funding.
So we still have polio that we had in 1953, because in 1953, all you had to have to be diagnosed is polio. Anyone could diagnose you, just one examination with one set of muscles being paralyzed. There was no timeframe on it. There was no testing done on it. And then it was considered a public service to do it because then you were eligible for funding.
Myelitis? Poliomyelitis is the definition of the actual pathology. So it basically means inflammation of the gray matter of your spinal cord. That's what polio in Greek, poliomyelitis. It means gray matter inflammation, poliomyelitis. Poliomyelitis is what happens in the body. If you want to talk about what causes it, then, okay, maybe in some cases a poliovirus causes it.
Myelitis? Poliomyelitis is the definition of the actual pathology. So it basically means inflammation of the gray matter of your spinal cord. That's what polio in Greek, poliomyelitis. It means gray matter inflammation, poliomyelitis. Poliomyelitis is what happens in the body. If you want to talk about what causes it, then, okay, maybe in some cases a poliovirus causes it.
And all the other things we just mentioned, arsenic, lead arsenate, calcium arsenate, injections, tonsillectomies were huge cause of some of the worst cases of poliomyelitis. And in fact, injections and tonsillectomies and unnecessary surgeries were put on hold during the years where the epidemics were the worst. So that's just proof that even the surgeons knew that.
And all the other things we just mentioned, arsenic, lead arsenate, calcium arsenate, injections, tonsillectomies were huge cause of some of the worst cases of poliomyelitis. And in fact, injections and tonsillectomies and unnecessary surgeries were put on hold during the years where the epidemics were the worst. So that's just proof that even the surgeons knew that.
Okay, so if you happen to have poliomyelitis circulating in your body that's not just sitting in your intestines and, say, it made its way into your body, because we can. Things can go from your intestines into your body. And you happen to have it close to a nerve that's up, say, around your throat, and then you go and take tonsils out.
Okay, so if you happen to have poliomyelitis circulating in your body that's not just sitting in your intestines and, say, it made its way into your body, because we can. Things can go from your intestines into your body. And you happen to have it close to a nerve that's up, say, around your throat, and then you go and take tonsils out.
then what you've done is you've given that access to the blood compartment, the lymph compartment, and the brain stem, which is right there, local. So those are the people that would get what was called bulbar polio, which is the ones that put you on a ventilator. And it's highly lethal. It's the worst kind of polio to get, bulbar polio.
then what you've done is you've given that access to the blood compartment, the lymph compartment, and the brain stem, which is right there, local. So those are the people that would get what was called bulbar polio, which is the ones that put you on a ventilator. And it's highly lethal. It's the worst kind of polio to get, bulbar polio.
And it was very well known to have been coincident with tonsillectomies. Not only that, but tonsillectomies changed the structure and antibodies and the immunity that occurred in the throat and changed it for the worse, not for the better.
And it was very well known to have been coincident with tonsillectomies. Not only that, but tonsillectomies changed the structure and antibodies and the immunity that occurred in the throat and changed it for the worse, not for the better.
Okay, so again, it's not just a cut and dry answer because let's just say that anyone who's ever brought their child to me because the tonsils were touching or they were snoring has not had to have a tonsillectomy. Now, does that mean that a tonsillectomy won't solve that problem where you're snoring and your kid's maybe not oxygenated? No.
Okay, so again, it's not just a cut and dry answer because let's just say that anyone who's ever brought their child to me because the tonsils were touching or they were snoring has not had to have a tonsillectomy. Now, does that mean that a tonsillectomy won't solve that problem where you're snoring and your kid's maybe not oxygenated? No.
If you let it go that long, probably you're going to need a tonsillectomy. But I've seen so many cases reverse. It's a very easy thing to do. But as doctors, we're not taught about all the things that you were talking about earlier, the natural remedies, but just simply gargling with a solution of –
If you let it go that long, probably you're going to need a tonsillectomy. But I've seen so many cases reverse. It's a very easy thing to do. But as doctors, we're not taught about all the things that you were talking about earlier, the natural remedies, but just simply gargling with a solution of –
sodium ascorbate, vitamin C, can make a huge difference because tonsils are like, they're like porous golf balls, if you want to think of them that way. They've got pits in them. And so food you eat and bacteria and pus can build up.
sodium ascorbate, vitamin C, can make a huge difference because tonsils are like, they're like porous golf balls, if you want to think of them that way. They've got pits in them. And so food you eat and bacteria and pus can build up.
But if you just start rinsing the outsides of them and start nourishing the body from the inside and getting rid of things that the kid might be allergic to, which almost every kid's going to eat if your parent doesn't know better, it can make a remarkable difference in these kids that have these huge tonsils. So I think that
But if you just start rinsing the outsides of them and start nourishing the body from the inside and getting rid of things that the kid might be allergic to, which almost every kid's going to eat if your parent doesn't know better, it can make a remarkable difference in these kids that have these huge tonsils. So I think that
I think everything else should be done first before taking out the tonsils if there's time because I'd say 95% to 99% of the time you can prevent that child from needing their tonsils removed.
I think everything else should be done first before taking out the tonsils if there's time because I'd say 95% to 99% of the time you can prevent that child from needing their tonsils removed.
Absolutely, 100%. And it's not just something he's dreamed up. Again, provable medical literature in the book, Dissolving Illusions. The physiology, the pathology is known. It's very well known that the vaccines that have aluminum in them skew the immune system. So the immune system kind of just, if you want to break it down really simply, you have your Th1 arm and your Th2 arm.
Absolutely, 100%. And it's not just something he's dreamed up. Again, provable medical literature in the book, Dissolving Illusions. The physiology, the pathology is known. It's very well known that the vaccines that have aluminum in them skew the immune system. So the immune system kind of just, if you want to break it down really simply, you have your Th1 arm and your Th2 arm.
Your Th1 arm is a really important one. Those are your T cells, you know, your lymphocytes, the cells that, you know, chew up any garbage that's going around. That's the part you want activated in any infection you have, whether it's COVID or measles or smallpox or whatever. And then you have your TH2 arm, which is there mostly to deal with parasites and things like that.
Your Th1 arm is a really important one. Those are your T cells, you know, your lymphocytes, the cells that, you know, chew up any garbage that's going around. That's the part you want activated in any infection you have, whether it's COVID or measles or smallpox or whatever. And then you have your TH2 arm, which is there mostly to deal with parasites and things like that.
And it's mostly an antibody arm of immunity. That's the one that vaccinologists are obsessed with, making sure there's enough antibody. So the vaccines that have aluminum in them, as opposed to the live attenuated vaccines, which don't have aluminum. All the other ones do. So your DTAP is going to have aluminum in them. All your killed vaccines are going to have aluminum in them.
And it's mostly an antibody arm of immunity. That's the one that vaccinologists are obsessed with, making sure there's enough antibody. So the vaccines that have aluminum in them, as opposed to the live attenuated vaccines, which don't have aluminum. All the other ones do. So your DTAP is going to have aluminum in them. All your killed vaccines are going to have aluminum in them.
And that is very well known to trigger that TH2 response, which is the allergic response, which can set up your body for autoimmunity. And so part of the purpose of breastfeeding, which is part of the blueprint for humanity and every other mammal, is that the mother is able to introduce antigens in the world to her baby through her own breast and things that she's been eating and breathing in.
And that is very well known to trigger that TH2 response, which is the allergic response, which can set up your body for autoimmunity. And so part of the purpose of breastfeeding, which is part of the blueprint for humanity and every other mammal, is that the mother is able to introduce antigens in the world to her baby through her own breast and things that she's been eating and breathing in.
And then the baby's able to develop tolerance. So, you know, while vaccine scientists are obsessed with getting antibodies and ramping up an infant's inadequate immune system, the fact of the matter is, is that it's more important to learn what not to react to when your immune system's developing rather than to becoming defensive against every microbe that could get you.
And then the baby's able to develop tolerance. So, you know, while vaccine scientists are obsessed with getting antibodies and ramping up an infant's inadequate immune system, the fact of the matter is, is that it's more important to learn what not to react to when your immune system's developing rather than to becoming defensive against every microbe that could get you.
So that's kind of the paradox there and one of the battlegrounds for immunology, within immunology, and for those of us out here that are going, what are you doing here?
So that's kind of the paradox there and one of the battlegrounds for immunology, within immunology, and for those of us out here that are going, what are you doing here?
It's so much more than that. And I was actually quite startled when I really went down that rabbit hole to see not only, I mean, it is food. It's excellent nutrition with short-chain fatty acids and sugars that the baby needs. It actually trains your gut. to be healthy in the long run as an adult, which trains your immune system as well.
It's so much more than that. And I was actually quite startled when I really went down that rabbit hole to see not only, I mean, it is food. It's excellent nutrition with short-chain fatty acids and sugars that the baby needs. It actually trains your gut. to be healthy in the long run as an adult, which trains your immune system as well.
But what that mother is putting through her breast milk, you know, things like something called HAMLET, H-A-M-L-E-T, which stands for human alpha-lactalbumin made lethal to tumors. And this is a substance. This is a protein. It's like a transformer protein that can literally turn into a cancer-busting molecule that is being used by the oncology industry, okay?
But what that mother is putting through her breast milk, you know, things like something called HAMLET, H-A-M-L-E-T, which stands for human alpha-lactalbumin made lethal to tumors. And this is a substance. This is a protein. It's like a transformer protein that can literally turn into a cancer-busting molecule that is being used by the oncology industry, okay?
And when it's not in that form, it's a powerful protein that fights off pertussis, all kinds of pneumococcal bacteria. And when it's not doing that, it's food. Okay, so it's like it's got so many different purposes. Stem cells are coming through that mother's milk. Activated T cells. Activated T cells have another substance in them that is kind of hijacked by the oncology industry.
And when it's not in that form, it's a powerful protein that fights off pertussis, all kinds of pneumococcal bacteria. And when it's not doing that, it's food. Okay, so it's like it's got so many different purposes. Stem cells are coming through that mother's milk. Activated T cells. Activated T cells have another substance in them that is kind of hijacked by the oncology industry.
And that is when they're immunosuppressing kids for leukemia or whatever. and they come in contact, say, with chickenpox, what they can do is get somebody like me, who's immune to chickenpox naturally, and take my memory T cells that remember that, and there's a substance in there called dialyzable leukocyte extract.
And that is when they're immunosuppressing kids for leukemia or whatever. and they come in contact, say, with chickenpox, what they can do is get somebody like me, who's immune to chickenpox naturally, and take my memory T cells that remember that, and there's a substance in there called dialyzable leukocyte extract.
When you put that into another child, even if whether they eat it or inject it into them, It transfers cellular, that Th1, important arm of immunity I just told you, it transfers it onto them and protects them for a long time.
When you put that into another child, even if whether they eat it or inject it into them, It transfers cellular, that Th1, important arm of immunity I just told you, it transfers it onto them and protects them for a long time.
So that's kind of in the old days when mothers had measles in the old days and normally, and they were able to pass this powerful immunity through that DLE factor, as well as all these other things, including preformed immune globulins. I mentioned something like 80,000 stem cells. It's just incredible. And we still have only hit the tip of the iceberg in terms of what we know about breast milk.
So that's kind of in the old days when mothers had measles in the old days and normally, and they were able to pass this powerful immunity through that DLE factor, as well as all these other things, including preformed immune globulins. I mentioned something like 80,000 stem cells. It's just incredible. And we still have only hit the tip of the iceberg in terms of what we know about breast milk.
No, they don't tell you anything, just Tylenol, which actually makes the vaccine not work as well, in addition to causing all kinds of immunological disturbances at the time that you're supposed to be upregulating your immune system against this dreaded disease. Yeah, but one of the things about the recommended by the white coats and the authorities is that they
No, they don't tell you anything, just Tylenol, which actually makes the vaccine not work as well, in addition to causing all kinds of immunological disturbances at the time that you're supposed to be upregulating your immune system against this dreaded disease. Yeah, but one of the things about the recommended by the white coats and the authorities is that they
But breast milk also, it's been proven again, that if you're going to, if you are going to vaccinate your baby, if you're breastfeeding, the vaccine will bring that baby more into a Th1. If you're not breastfeeding and you're giving formula, that baby's going to move more into a TH2 in response to that vaccine.
But breast milk also, it's been proven again, that if you're going to, if you are going to vaccinate your baby, if you're breastfeeding, the vaccine will bring that baby more into a Th1. If you're not breastfeeding and you're giving formula, that baby's going to move more into a TH2 in response to that vaccine.
So like if I think if most women understood the powers of breast milk, they would do everything possible to be able to do it.
So like if I think if most women understood the powers of breast milk, they would do everything possible to be able to do it.
Parasites. We have we have parasites that. have been parasites upon humanity for such a long time. And that's what happens is that something is discovered. And for some people, maybe it can be a good idea, but then the parasites take it and want to. So when it came to breastfeeding, it was you don't have to do that. You don't have to bother yourself like that.
Parasites. We have we have parasites that. have been parasites upon humanity for such a long time. And that's what happens is that something is discovered. And for some people, maybe it can be a good idea, but then the parasites take it and want to. So when it came to breastfeeding, it was you don't have to do that. You don't have to bother yourself like that.
You don't have to pull your boobs out in public. You don't have to become a dairy cow. Just strap them down. The milk will stop. And then you can start putting this wonderful. When I was a kid, I was fed soy milk in a warm plastic bag. That was the fad then growing up. So the formula industry is a huge moneymaker. And some women do prefer it.
You don't have to pull your boobs out in public. You don't have to become a dairy cow. Just strap them down. The milk will stop. And then you can start putting this wonderful. When I was a kid, I was fed soy milk in a warm plastic bag. That was the fad then growing up. So the formula industry is a huge moneymaker. And some women do prefer it.
Fortunately, 75% of women in the USA today do initiate breastfeeding. So that's very much better than the polio days when almost nobody was breastfeeding and they were using milk in the infant formula that had been contaminated by what the cows were eating. And so that was another part of the polio story that's not been told.
Fortunately, 75% of women in the USA today do initiate breastfeeding. So that's very much better than the polio days when almost nobody was breastfeeding and they were using milk in the infant formula that had been contaminated by what the cows were eating. And so that was another part of the polio story that's not been told.
Well, the cows wouldn't have been necessarily getting sick from it, but it would be concentrating in their milk. And so the milk would have been expressed. But you just brought me back to another place. Cows were also used during the smallpox era, and what you're saying is true about that. So they would basically take – Sorry, it's just so dark that sometimes you have to laugh.
Well, the cows wouldn't have been necessarily getting sick from it, but it would be concentrating in their milk. And so the milk would have been expressed. But you just brought me back to another place. Cows were also used during the smallpox era, and what you're saying is true about that. So they would basically take – Sorry, it's just so dark that sometimes you have to laugh.
But they would take pus from other animals, scratch it into the belly of a cow, then take the pus off of the big pimples that would form on the belly of a cow. The cow could become very sick, and yet that cow could still be butchered up at the butcher shop. The butcher would get sick with pemphigus or some hand and mouth disease or, you know, the things that the cows normally catch.
But they would take pus from other animals, scratch it into the belly of a cow, then take the pus off of the big pimples that would form on the belly of a cow. The cow could become very sick, and yet that cow could still be butchered up at the butcher shop. The butcher would get sick with pemphigus or some hand and mouth disease or, you know, the things that the cows normally catch.
And so those cows could still be used to produce meat in those cases. I don't know that it was used to produce milk. I don't think that would have – I don't know. But I know it was used to produce meat because the butchers were getting sick and the people that were eating the meat were getting sick.
And so those cows could still be used to produce meat in those cases. I don't know that it was used to produce milk. I don't think that would have – I don't know. But I know it was used to produce meat because the butchers were getting sick and the people that were eating the meat were getting sick.
And certainly the people that took the vaccines that had certain who knows what in them because it was shown – Like into the 1970s, 80s, and even recently, I have a reference from after the year 2000 that there was more bacteria and fungus in the smallpox vaccines than there was smallpox virus.
And certainly the people that took the vaccines that had certain who knows what in them because it was shown – Like into the 1970s, 80s, and even recently, I have a reference from after the year 2000 that there was more bacteria and fungus in the smallpox vaccines than there was smallpox virus.
The public believes that so many drugs and remedies are standardized that the conventional medical system gives out. And when you go to actually look at them, and this includes vaccines, even though they're standardized, meaning that the manufacturers are told what the regulations should be in terms of production, when people go and look at them, they find it's anything but standardized.
The public believes that so many drugs and remedies are standardized that the conventional medical system gives out. And when you go to actually look at them, and this includes vaccines, even though they're standardized, meaning that the manufacturers are told what the regulations should be in terms of production, when people go and look at them, they find it's anything but standardized.
So it was because they had this thing called pure lymph, which was pus that came out of the horse's foot or a donkey's pus skin or a cadaver of a human or a cow's ulcerating udders. and scraped into glycerin and called Pure Lymph and marketed all over the world. This is the joke. This was our success. This is the one vaccine that eliminated, eradicated a disease. Can you believe that fairy tale?
So it was because they had this thing called pure lymph, which was pus that came out of the horse's foot or a donkey's pus skin or a cadaver of a human or a cow's ulcerating udders. and scraped into glycerin and called Pure Lymph and marketed all over the world. This is the joke. This was our success. This is the one vaccine that eliminated, eradicated a disease. Can you believe that fairy tale?
I'll tell you another one. It doesn't get crazy. This is our success. This vaccine that I had described in great detail with what was in it and what people saw under microscopes and then later tested genetically was what was called a quasi-species, meaning they don't even, after a while, it became its own thing. It wasn't from a horse anymore. It wasn't from a human anymore.
I'll tell you another one. It doesn't get crazy. This is our success. This vaccine that I had described in great detail with what was in it and what people saw under microscopes and then later tested genetically was what was called a quasi-species, meaning they don't even, after a while, it became its own thing. It wasn't from a horse anymore. It wasn't from a human anymore.
They called it humanized horsepox when they genetically characterized the dry vacs and then ordered that every dry vac specimen on the planet be destroyed. I think that was around 2009. Why did they do that? Good question. I don't know. Hiding the evidence, possibly. But they now have a new vaccine, which doesn't work. But they wanted to bring this one back.
They called it humanized horsepox when they genetically characterized the dry vacs and then ordered that every dry vac specimen on the planet be destroyed. I think that was around 2009. Why did they do that? Good question. I don't know. Hiding the evidence, possibly. But they now have a new vaccine, which doesn't work. But they wanted to bring this one back.
When I was in the peak of my career in 2003, I got a letter on my desk stating that they needed people to get vaccinated for smallpox so that
When I was in the peak of my career in 2003, I got a letter on my desk stating that they needed people to get vaccinated for smallpox so that
those other people that were getting vaccinated would have somebody that could treat them that would be immune to smallpox because it's well known that if you get a smallpox vaccine and you get these horrible scabs that you're going to spread smallpox and you're going to have a horrible, itchy time of secondary infections. You will need a doctor at some point.
those other people that were getting vaccinated would have somebody that could treat them that would be immune to smallpox because it's well known that if you get a smallpox vaccine and you get these horrible scabs that you're going to spread smallpox and you're going to have a horrible, itchy time of secondary infections. You will need a doctor at some point.
Well, it turns out that the trials that they did on super healthy people, soldiers that were in top shape, were so bad in terms of cardiac disease and other diseases that that the government put it on hold for a second and said, no, no, no, we can't do this. Meanwhile, guess what? They were using the same vaccine in the 1700s and 1800s
Well, it turns out that the trials that they did on super healthy people, soldiers that were in top shape, were so bad in terms of cardiac disease and other diseases that that the government put it on hold for a second and said, no, no, no, we can't do this. Meanwhile, guess what? They were using the same vaccine in the 1700s and 1800s
late 1700s all through the 1800s into the 1900s, they would sometimes, you probably saw the picture of the child's arm considered a good take, five huge ulcers on the arm with sanitation being what it was, no antibiotics. Can you imagine having your baby have five scars on its arm, ulcerating from these things, having fevers? Sometimes the arms became necrotic.
late 1700s all through the 1800s into the 1900s, they would sometimes, you probably saw the picture of the child's arm considered a good take, five huge ulcers on the arm with sanitation being what it was, no antibiotics. Can you imagine having your baby have five scars on its arm, ulcerating from these things, having fevers? Sometimes the arms became necrotic.
Sometimes the disease spread all over the place, and there was nothing to give them except bloodletting, mercurials, and arsenicals, and heating them up in a dark room with no sunlight. That was the treatment for smallpox. So you tell me why smallpox was so lethal.
Sometimes the disease spread all over the place, and there was nothing to give them except bloodletting, mercurials, and arsenicals, and heating them up in a dark room with no sunlight. That was the treatment for smallpox. So you tell me why smallpox was so lethal.
Yes, it is good to keep an open mind, isn't it, and be flexible and look at a 360-degree view of things rather than your tunnel vision and what you're indoctrinated into, isn't it?
Yes, it is good to keep an open mind, isn't it, and be flexible and look at a 360-degree view of things rather than your tunnel vision and what you're indoctrinated into, isn't it?
It's very variable, which is why we see such variability in the And the results when people receive them, that's only one reason why there's so much variability.
It's very variable, which is why we see such variability in the And the results when people receive them, that's only one reason why there's so much variability.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Well, we certainly saw an explosion of their creativity since 1986. So actually in 1986, you're referring to the National Child Vaccine Injury Act that was passed in 1986. But before 1986, we had 1976, which was the swine flu vaccine fiasco. And that was a situation where there was so much injury that the vaccine producing companies were no longer able to get insurance.
Well, we certainly saw an explosion of their creativity since 1986. So actually in 1986, you're referring to the National Child Vaccine Injury Act that was passed in 1986. But before 1986, we had 1976, which was the swine flu vaccine fiasco. And that was a situation where there was so much injury that the vaccine producing companies were no longer able to get insurance.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you.
Thank you. Thank you.
And so they went to the government and they said, we need you to indemnify us. And they did. And so the government absorbed all the lawsuit cases that happened as a result of the Guillain-Barre that happened from then. And so that kind of set a precedent for 1986. So back then, vaccines were just kind of, you know, pieces of microbe, or maybe a live attenuated virus. And then they would
And so they went to the government and they said, we need you to indemnify us. And they did. And so the government absorbed all the lawsuit cases that happened as a result of the Guillain-Barre that happened from then. And so that kind of set a precedent for 1986. So back then, vaccines were just kind of, you know, pieces of microbe, or maybe a live attenuated virus. And then they would
put a background of all kinds of hard things inside of it and tell you it was just a clear, beautiful, pure solution. But that's beside the point. So then 1986 comes along because there's so many lawsuits happening because of the diphtheria pertussis tetanus vaccine. that, again, the vaccine companies couldn't continue to go on the way they were because they were being sued so much.
put a background of all kinds of hard things inside of it and tell you it was just a clear, beautiful, pure solution. But that's beside the point. So then 1986 comes along because there's so many lawsuits happening because of the diphtheria pertussis tetanus vaccine. that, again, the vaccine companies couldn't continue to go on the way they were because they were being sued so much.
Welcome to my life.
Welcome to my life.
In the 70s. I believe we're in the 70s.
In the 70s. I believe we're in the 70s.
So then this horrible act was passed, which to some people seemed like a good idea. And this is always how it goes, is we're going to make you this promise. Yes, yes, yes, we're going to cover all the lawsuits now out of taxes, but it's going to be okay because we're going to pay out these lawsuits and you're going to be fine. If your kid takes one for the team, you're going to be okay.
So then this horrible act was passed, which to some people seemed like a good idea. And this is always how it goes, is we're going to make you this promise. Yes, yes, yes, we're going to cover all the lawsuits now out of taxes, but it's going to be okay because we're going to pay out these lawsuits and you're going to be fine. If your kid takes one for the team, you're going to be okay.
Yeah. Well, the way they were able to get away with it is 226 years worth of propaganda. Because the fact of the matter is that ever since the beginning of smallpox vaccines, there have been vaccine deaths. The reason, and look, we've added, I brought you a special copy. This is a limited edition. In the 10th anniversary edition, we added 200 pages. We added a chapter called The White Plague.
Yeah. Well, the way they were able to get away with it is 226 years worth of propaganda. Because the fact of the matter is that ever since the beginning of smallpox vaccines, there have been vaccine deaths. The reason, and look, we've added, I brought you a special copy. This is a limited edition. In the 10th anniversary edition, we added 200 pages. We added a chapter called The White Plague.
The White Plague is also tuberculosis. Tuberculosis was a side effect of the smallpox vaccine. Tuberculosis rates were rampant. In fact, the inventor of the smallpox vaccine, his child died of tuberculosis and so did his two test subjects that he used. And it was well known to follow smallpox. Lots of doctors talked about it. But in about two or three years after the vaccine was
The White Plague is also tuberculosis. Tuberculosis was a side effect of the smallpox vaccine. Tuberculosis rates were rampant. In fact, the inventor of the smallpox vaccine, his child died of tuberculosis and so did his two test subjects that he used. And it was well known to follow smallpox. Lots of doctors talked about it. But in about two or three years after the vaccine was
accepted in England, you hear doctors speaking out about it, cursing the day they ever agreed to do it to people, to children, to anybody. And so what happened is that the government came down harder and started making it mandatory and would take your furniture away and started intimidating the doctors. And that's an age old thing as well.
accepted in England, you hear doctors speaking out about it, cursing the day they ever agreed to do it to people, to children, to anybody. And so what happened is that the government came down harder and started making it mandatory and would take your furniture away and started intimidating the doctors. And that's an age old thing as well.
And I experienced it in any doctor that's ever stepped out of line and said something bad about vaccines will either be intimidated or worse. So 226 years of propaganda. And so I'm just going to give you one example, and I'll give you a copy of this to have, and you can put it up later if you want.
And I experienced it in any doctor that's ever stepped out of line and said something bad about vaccines will either be intimidated or worse. So 226 years of propaganda. And so I'm just going to give you one example, and I'll give you a copy of this to have, and you can put it up later if you want.
But in 1984, because there was so much going on in terms of the public learning about the problems with the diphtheria, tetanus, pertussis vaccine, and the polio vaccines, that a federal register was issued by the government and went to all Health Department in the United States, which is supposed to have been just kept there and never circulated.
But in 1984, because there was so much going on in terms of the public learning about the problems with the diphtheria, tetanus, pertussis vaccine, and the polio vaccines, that a federal register was issued by the government and went to all Health Department in the United States, which is supposed to have been just kept there and never circulated.
And it said, quote, any doubts whether or not well-founded. about the safety of the vaccination program must not be allowed to exist. That's literally what it said. It's straight out of, you know, Lenin. So you had that, and then you have the changing of the goalposts, and the outright lies within scientism, because it's not science.
And it said, quote, any doubts whether or not well-founded. about the safety of the vaccination program must not be allowed to exist. That's literally what it said. It's straight out of, you know, Lenin. So you had that, and then you have the changing of the goalposts, and the outright lies within scientism, because it's not science.
And what happens is after time, after they get their foot in the door, they narrow down the... they basically have a kangaroo court that decides if you're eligible. And so the qualification tables got narrowed down because in the beginning they were paying out so much of this.
And what happens is after time, after they get their foot in the door, they narrow down the... they basically have a kangaroo court that decides if you're eligible. And so the qualification tables got narrowed down because in the beginning they were paying out so much of this.
It's the religion that calls itself science, and we still are a victim of that today. Most science today is sponsored by the very people that are going to profit from it. And I think even look, even Jenner, who invented the smallpox vaccine, never did a scientific study. He never did a controlled study. He never did non-vaccinated people, vaccinated people.
It's the religion that calls itself science, and we still are a victim of that today. Most science today is sponsored by the very people that are going to profit from it. And I think even look, even Jenner, who invented the smallpox vaccine, never did a scientific study. He never did a controlled study. He never did non-vaccinated people, vaccinated people.
and then expose them to smallpox in a large enough group. He would cowpox them and then expose them to smallpox. And it was well known that smallpox followed cowpox. So it's just been, look, again, I never expected to be here. I just wanted to be a healer. I just wanted to be a doctor. I wanted to be a nephrologist and teach medical students and make the world a better place for people.
and then expose them to smallpox in a large enough group. He would cowpox them and then expose them to smallpox. And it was well known that smallpox followed cowpox. So it's just been, look, again, I never expected to be here. I just wanted to be a healer. I just wanted to be a doctor. I wanted to be a nephrologist and teach medical students and make the world a better place for people.
That's all I ever wanted. This is a nightmare for me, actually, to – while I've met some incredible people and I've had a really good life and I have no regrets and I would do it all again, no doctor wants to be put in a position where their integrity is doubted, their sanity is doubted. And if you want to pull up a page called – it is called – rational wiki, I think, maybe.
That's all I ever wanted. This is a nightmare for me, actually, to – while I've met some incredible people and I've had a really good life and I have no regrets and I would do it all again, no doctor wants to be put in a position where their integrity is doubted, their sanity is doubted. And if you want to pull up a page called – it is called – rational wiki, I think, maybe.
Anyway, I'm considered a Sith Lord. And in fact, I didn't know what a Sith Lord was back then. I had to actually look it up. So I'm like Darth Vader. So it was a bit of a compliment. But on the other hand, most doctors can't tolerate being called quacks or having their reputation destroyed.
Anyway, I'm considered a Sith Lord. And in fact, I didn't know what a Sith Lord was back then. I had to actually look it up. So I'm like Darth Vader. So it was a bit of a compliment. But on the other hand, most doctors can't tolerate being called quacks or having their reputation destroyed.
And I went from treating the CEO of actually the head of the laboratory at my hospital for hypertension to becoming
And I went from treating the CEO of actually the head of the laboratory at my hospital for hypertension to becoming
you know, somebody that was doubted on every levels after a while because of one thing that I said, which was, can we stop giving vaccines to my sick patients, to people who are having chemotherapy while they're having chemotherapy, to my patient before I've even seen them on the ward? Can we just hold this up and give it to them on the day of discharge? That was my request in the beginning.
you know, somebody that was doubted on every levels after a while because of one thing that I said, which was, can we stop giving vaccines to my sick patients, to people who are having chemotherapy while they're having chemotherapy, to my patient before I've even seen them on the ward? Can we just hold this up and give it to them on the day of discharge? That was my request in the beginning.
That's how this all landed here. And had they not tried to intimidate me, doubt me, and pushed me to research and show that what I saw was actually real, I would still be lockstep working as a regular doctor because there were some good things about it. So look, even if you look at what happened with COVID, let's just look at that. Like how did they pass this off? Look at the media today.
That's how this all landed here. And had they not tried to intimidate me, doubt me, and pushed me to research and show that what I saw was actually real, I would still be lockstep working as a regular doctor because there were some good things about it. So look, even if you look at what happened with COVID, let's just look at that. Like how did they pass this off? Look at the media today.
Do you know that they're giving COVID vaccines to six-month-old children now? We know how bad it is. We know that it ruins stem cells in pregnant women. They don't give stem cells to their babies. The industry is upset because the placentas no longer have stem cells. They used to use those stem cells in research and cosmetics, et cetera.
Do you know that they're giving COVID vaccines to six-month-old children now? We know how bad it is. We know that it ruins stem cells in pregnant women. They don't give stem cells to their babies. The industry is upset because the placentas no longer have stem cells. They used to use those stem cells in research and cosmetics, et cetera.
So not only did it make the vaccine companies very, very wealthy and indemnify, but as you alluded to just a minute ago, um, the creativity of the vaccine companies expanded. So after that, they could add different, what we call adjuvants, things that stimulate the immune system. So the vaccine works better.
So not only did it make the vaccine companies very, very wealthy and indemnify, but as you alluded to just a minute ago, um, the creativity of the vaccine companies expanded. So after that, they could add different, what we call adjuvants, things that stimulate the immune system. So the vaccine works better.
They're not getting them anymore because of what the COVID shots. to the placentas and those infants. That's not being talked about in the media. Nothing bad about the shots being talked about when we have Kevin McKernan and all these people looking at it going, there's SV40 in it. There was a staphylococcal endotoxin gene. There were two snake genes in there.
They're not getting them anymore because of what the COVID shots. to the placentas and those infants. That's not being talked about in the media. Nothing bad about the shots being talked about when we have Kevin McKernan and all these people looking at it going, there's SV40 in it. There was a staphylococcal endotoxin gene. There were two snake genes in there.
You know, it's a definite gain of function. Nope. We got to put it on the vaccine, the baby vaccine schedule. Because any doubts, whether or not well-funded, about the vaccination must not be allowed to exist. That's why.
You know, it's a definite gain of function. Nope. We got to put it on the vaccine, the baby vaccine schedule. Because any doubts, whether or not well-funded, about the vaccination must not be allowed to exist. That's why.
And it's been gone on.
And it's been gone on.
Three of them. They get three by the certain, you'd have to look up the schedule, but I believe it starts at six months and they get three of them kind of boom, boom, boom. Are doctors really recommending this? It's on the, look, there's a group of people called ACIP, the doctors, usually with vaccine interest in their bank accounts that make the recommendations for the vaccines.
Three of them. They get three by the certain, you'd have to look up the schedule, but I believe it starts at six months and they get three of them kind of boom, boom, boom. Are doctors really recommending this? It's on the, look, there's a group of people called ACIP, the doctors, usually with vaccine interest in their bank accounts that make the recommendations for the vaccines.
And they've recommended vaccines. that six-month-old. So if your doctor is following the ACIP program, you have to be offered that vaccine. And now that doctor, this is another part of the story, is that doctor's likely to lose $250,000 a year if they don't do that because there's incentive given to
And they've recommended vaccines. that six-month-old. So if your doctor is following the ACIP program, you have to be offered that vaccine. And now that doctor, this is another part of the story, is that doctor's likely to lose $250,000 a year if they don't do that because there's incentive given to
hospitals and doctors, which is what naively I was on the other end of when I woke up in 2008 and said, wait a minute, why are we doing this stuff to my sick, inflamed patients? You're giving more inflammation. It's because the hospital would lose something like $40,000 if they didn't give a vaccine within the first 24 hours of admission.
hospitals and doctors, which is what naively I was on the other end of when I woke up in 2008 and said, wait a minute, why are we doing this stuff to my sick, inflamed patients? You're giving more inflammation. It's because the hospital would lose something like $40,000 if they didn't give a vaccine within the first 24 hours of admission.
And they would get $40,000. It was all a money game. That's really the bottom line of it. And I didn't know that until a nurse years ago who was a high-level administration. She said, Suzanne, this is why they did that to you. Oh, wow. Okay. Well, at least it makes sense now.
And they would get $40,000. It was all a money game. That's really the bottom line of it. And I didn't know that until a nurse years ago who was a high-level administration. She said, Suzanne, this is why they did that to you. Oh, wow. Okay. Well, at least it makes sense now.
Well, that's been the case since basically the medical profession was infiltrated in the early 1900s by high-level interests that didn't want us thinking for ourselves and carrying on with the natural cures that actually work. carrying on with normal midwifery.
Well, that's been the case since basically the medical profession was infiltrated in the early 1900s by high-level interests that didn't want us thinking for ourselves and carrying on with the natural cures that actually work. carrying on with normal midwifery.
There was just so many changes that happened as a result of best practice medicine, not to mention the forming of the AMA by a couple of real quacks. That's a really good story. And the AMA would give their stamp of approval. So say you created an infant formula, well, it would say AMA approved, and your infant formula would sell even better. Remember when doctors smoked camels?
There was just so many changes that happened as a result of best practice medicine, not to mention the forming of the AMA by a couple of real quacks. That's a really good story. And the AMA would give their stamp of approval. So say you created an infant formula, well, it would say AMA approved, and your infant formula would sell even better. Remember when doctors smoked camels?
Uh, then they start, that's why we're able to be in a messenger RNA vaccine situation today, which, which that wouldn't have happened if it weren't for this indemnification that, you know, the vaccine trials have always been a bit of a joke, but they're even more of a joke today than they were in the beginning. We've never seen a vaccinated unvaccinated, um,
Uh, then they start, that's why we're able to be in a messenger RNA vaccine situation today, which, which that wouldn't have happened if it weren't for this indemnification that, you know, the vaccine trials have always been a bit of a joke, but they're even more of a joke today than they were in the beginning. We've never seen a vaccinated unvaccinated, um,
Because camels were best.
Because camels were best.
Well, first Rockefeller, I think oil was one of their primary investments. So that's the pharmaceutical aspect of it. That's right.
Well, first Rockefeller, I think oil was one of their primary investments. So that's the pharmaceutical aspect of it. That's right.
Oh, so you want to talk about the school system.
Oh, so you want to talk about the school system.
You want to know the irony? It's crazy. It kind of works. Yeah. I got rid of a really bad case of mange in a dog by kerosene, putting kerosene diluted in olive oil. And they had been through everything. They could not get rid of this mange on this beautiful dog.
You want to know the irony? It's crazy. It kind of works. Yeah. I got rid of a really bad case of mange in a dog by kerosene, putting kerosene diluted in olive oil. And they had been through everything. They could not get rid of this mange on this beautiful dog.
That's crazy that that worked. It was a cane corso dog.
That's crazy that that worked. It was a cane corso dog.
Really bad. But one spray, it was done.
Really bad. But one spray, it was done.
You have to keep careful around the flames and stuff.
You have to keep careful around the flames and stuff.
No, it can't. Joe, come on. You had to have an expert help you. No kerosene, no nothing, just love.
No, it can't. Joe, come on. You had to have an expert help you. No kerosene, no nothing, just love.
Food and love. That was an argument I had in a hallway once with the senior— chief of medicine, he was like, he would always say, so how are you today? And normally be like, good, you know, superficial confidence. I said, by the way, I'm having real trouble with, you know, the H1N1 vaccine. My patient's getting kidney failure after getting it. And he turned dark on me. I never saw him dark before.
Food and love. That was an argument I had in a hallway once with the senior— chief of medicine, he was like, he would always say, so how are you today? And normally be like, good, you know, superficial confidence. I said, by the way, I'm having real trouble with, you know, the H1N1 vaccine. My patient's getting kidney failure after getting it. And he turned dark on me. I never saw him dark before.
And he said, no, they just didn't have time to take effect. And of course, then I heard every kind of soundbite in the book from him, which I didn't know were soundbites at the time. And then he said, well, what do you think has happened with meningitis in these college kids? I'm like, oh, come on. That's a total no-brainer. It's like their nutrition goes down the tubes when they leave home.
And he said, no, they just didn't have time to take effect. And of course, then I heard every kind of soundbite in the book from him, which I didn't know were soundbites at the time. And then he said, well, what do you think has happened with meningitis in these college kids? I'm like, oh, come on. That's a total no-brainer. It's like their nutrition goes down the tubes when they leave home.
They're smoking. They're staying up all night long. They're hanging out with their pals. They're doing everything they couldn't do when they were at home. Oh, you've got to be kidding me. So you think it's their food that's causing problems? And I was like, well, what medical school did you go to? Like I was actually taught that nutrition matters and how it matters and why it matters.
They're smoking. They're staying up all night long. They're hanging out with their pals. They're doing everything they couldn't do when they were at home. Oh, you've got to be kidding me. So you think it's their food that's causing problems? And I was like, well, what medical school did you go to? Like I was actually taught that nutrition matters and how it matters and why it matters.
But that's been almost completely – like if you want to sneak vitamin C into somebody's hospital room, you know the best way to do it? Don't bring in a jar of vitamin C because they will stop that at the door. You get yourself a McDonald's milkshake or a burger. And you just dump that milkshake out and you put something else in there, a smoothie with some vitamin C, and they will say, off you go.
But that's been almost completely – like if you want to sneak vitamin C into somebody's hospital room, you know the best way to do it? Don't bring in a jar of vitamin C because they will stop that at the door. You get yourself a McDonald's milkshake or a burger. And you just dump that milkshake out and you put something else in there, a smoothie with some vitamin C, and they will say, off you go.
That's perfectly fine. That's going to be great for this person, this child. That's how you can get it in because they think that McDonald's is wonderful. In fact, McDonald's are kind of situated proximal to a lot of hospitals and the McDonald's, Ronald McDonald houses are there and everything else.
That's perfectly fine. That's going to be great for this person, this child. That's how you can get it in because they think that McDonald's is wonderful. In fact, McDonald's are kind of situated proximal to a lot of hospitals and the McDonald's, Ronald McDonald houses are there and everything else.
But bring in a homeopathic or, you know, magnesium or vitamin C and you've got to get permission for it and go through so much red tape and a lot of time you'll be told.
But bring in a homeopathic or, you know, magnesium or vitamin C and you've got to get permission for it and go through so much red tape and a lot of time you'll be told.
study that is accepted by the powers that be as good enough. The vaccinated unvaccinated studies that they have, they use another vaccine for. You probably know that. So if you're testing a measles vaccine, you could test it against a diphtheria vaccine or a flu shot vaccine is tested against a hepatitis A vaccine.
study that is accepted by the powers that be as good enough. The vaccinated unvaccinated studies that they have, they use another vaccine for. You probably know that. So if you're testing a measles vaccine, you could test it against a diphtheria vaccine or a flu shot vaccine is tested against a hepatitis A vaccine.
No, you can't give it because, oh, you'll cause bowel necrosis, you'll cause diarrhea, you'll cause kidney stones, everything in the book that doesn't actually happen with vitamin C. Look, they've measured vitamin C levels on people that enter hospitals, and pretty much everybody's deficient or on the border of deficient when they enter, and pretty much everybody when they leave has got borderline scurvy.
No, you can't give it because, oh, you'll cause bowel necrosis, you'll cause diarrhea, you'll cause kidney stones, everything in the book that doesn't actually happen with vitamin C. Look, they've measured vitamin C levels on people that enter hospitals, and pretty much everybody's deficient or on the border of deficient when they enter, and pretty much everybody when they leave has got borderline scurvy.
If not full scurvy. Fortunately, they go home and start doing other things and can rebuild some of their vitamin C scores. But there's a lot of subclinical scurvy walking around out there. And those are the people that are going to do the worst with the vaccine and they're going to do the worst with the actual disease.
If not full scurvy. Fortunately, they go home and start doing other things and can rebuild some of their vitamin C scores. But there's a lot of subclinical scurvy walking around out there. And those are the people that are going to do the worst with the vaccine and they're going to do the worst with the actual disease.
Well, you know, it's not just the poor diet. So any kind of stress will consume vitamin C. A cigarette will consume 75 milligrams of vitamin C. And they tell you that you only need 190 milligrams a day. That's the FDA requirement.
Well, you know, it's not just the poor diet. So any kind of stress will consume vitamin C. A cigarette will consume 75 milligrams of vitamin C. And they tell you that you only need 190 milligrams a day. That's the FDA requirement.
So you just have a few cigarettes and you've depleted your stores. We don't make our own vitamin C as humans. Humans and guinea pigs, we don't do that. And so we have to consume it. And we're reliant upon our fruits and vegetables or supplements to do it. Or if you eat organ meat, you can eat the adrenals that are loaded with it.
So you just have a few cigarettes and you've depleted your stores. We don't make our own vitamin C as humans. Humans and guinea pigs, we don't do that. And so we have to consume it. And we're reliant upon our fruits and vegetables or supplements to do it. Or if you eat organ meat, you can eat the adrenals that are loaded with it.
But aside from that, it's your fruits and vegetables that are going to give it to you. So if you're under a lot of stress or you're taking medication or you have a lot of inflammation or arthritis, whatever, that's going to consume vitamin C. Because vitamin C is an antioxidant as well as an antiviral and good for your nervous system. So yeah, most people are walking around skimming the edge.
But aside from that, it's your fruits and vegetables that are going to give it to you. So if you're under a lot of stress or you're taking medication or you have a lot of inflammation or arthritis, whatever, that's going to consume vitamin C. Because vitamin C is an antioxidant as well as an antiviral and good for your nervous system. So yeah, most people are walking around skimming the edge.
You can see kind of a red line on some people's gums. They're probably vitamin C deficient. If your gums are bleeding a lot when you floss, you probably need some vitamin C. And, you know, you could have an infection, too, but it will deal to the infection as well as the integrity and the collagen inside of your bones and your soft tissues.
You can see kind of a red line on some people's gums. They're probably vitamin C deficient. If your gums are bleeding a lot when you floss, you probably need some vitamin C. And, you know, you could have an infection, too, but it will deal to the infection as well as the integrity and the collagen inside of your bones and your soft tissues.
I mean, it's it's like one of those things that's so important. It should be given upon admission to every hospital.
I mean, it's it's like one of those things that's so important. It should be given upon admission to every hospital.
Probably not enough. Not enough.
Probably not enough. Not enough.
And you're a hippie if you want to just eat kiwi fruits and get your vitamin C from that or have oranges or broccoli. Oh, my gosh. Broccoli makes you a total hippie. Or kale. Yeah. Forget about it.
And you're a hippie if you want to just eat kiwi fruits and get your vitamin C from that or have oranges or broccoli. Oh, my gosh. Broccoli makes you a total hippie. Or kale. Yeah. Forget about it.
Now, see, we have a different kind of malnutrition today than we describe in the book. Back then it was people were toxic from basically drinking poop water and being worked to death and having diseases all around them. And so they were protein calorie malnutrition people. as well as vitamin as well.
Now, see, we have a different kind of malnutrition today than we describe in the book. Back then it was people were toxic from basically drinking poop water and being worked to death and having diseases all around them. And so they were protein calorie malnutrition people. as well as vitamin as well.
There's no saline placebo because the few studies that exist with saline placebos show how bad the vaccine actually is and how it makes you not only not respond to the disease when it comes around, but more susceptible to it in many cases.
There's no saline placebo because the few studies that exist with saline placebos show how bad the vaccine actually is and how it makes you not only not respond to the disease when it comes around, but more susceptible to it in many cases.
Today, we have kind of disnutrition, you know, like DYS, disnutrition, and that everyone's fat, so they don't really look malnourished. Pretty much, you know, you go on a cruise or you go to the beach. Even skinny people have big bellies now. Big belly is the thing. What was that?
Today, we have kind of disnutrition, you know, like DYS, disnutrition, and that everyone's fat, so they don't really look malnourished. Pretty much, you know, you go on a cruise or you go to the beach. Even skinny people have big bellies now. Big belly is the thing. What was that?
Who's that? That's my friend. Okay, hi, Bert. He's going to hate that you don't know who he is.
Who's that? That's my friend. Okay, hi, Bert. He's going to hate that you don't know who he is.
But so today we've got inflamed guts from glyphosate and the wheat that's been altered to make us inflamed and then just the chemicals that are added to our food and the vitamins that actually don't help us and set us back that are fortifying our bread and milk, lack of vitamin D. So we have a different kind of a problem, but essentially causing the same bodily dysfunction.
But so today we've got inflamed guts from glyphosate and the wheat that's been altered to make us inflamed and then just the chemicals that are added to our food and the vitamins that actually don't help us and set us back that are fortifying our bread and milk, lack of vitamin D. So we have a different kind of a problem, but essentially causing the same bodily dysfunction.
Yeah. You think, oh, maybe it's just the high carbs, but you just proved that it wasn't because in Italy you were okay with it.
Yeah. You think, oh, maybe it's just the high carbs, but you just proved that it wasn't because in Italy you were okay with it.
Waiting for the hit. Never came.
Waiting for the hit. Never came.
Yeah. Bread in Scandinavia, same.
Yeah. Bread in Scandinavia, same.
People don't know that. What's that?
People don't know that. What's that?
It is. Like, real food, real cream.
It is. Like, real food, real cream.
It is interesting.
It is interesting.
Yeah. Yeah. I kind of agree. Like I'm not gluten sensitive, but I definitely feel more awake when I don't have it.
Yeah. Yeah. I kind of agree. Like I'm not gluten sensitive, but I definitely feel more awake when I don't have it.
It's good on holiday or when you want to go to sleep. But it's so delicious. I know. I know.
It's good on holiday or when you want to go to sleep. But it's so delicious. I know. I know.
The question of the century, isn't it? Okay, now we have to back up a minute because... I had that same question, and I had to go dig deep. To all the questions you have in your head right now, I had them too at one point.
The question of the century, isn't it? Okay, now we have to back up a minute because... I had that same question, and I had to go dig deep. To all the questions you have in your head right now, I had them too at one point.
Add some arsenic and it'd be great.
Add some arsenic and it'd be great.
Thank you for smoking.
Thank you for smoking.
Well, you know, there's something to that because, you know, about the nicotinic receptors and, you know, the smokers got less COVID than the rest of us. And I did hear about that.
Well, you know, there's something to that because, you know, about the nicotinic receptors and, you know, the smokers got less COVID than the rest of us. And I did hear about that.
What happens? So the spike of COVID is the evil part of COVID. has all these horrible lab-engineered proteins encoded into them. Two of them are snake toxin proteins that bind onto your nicotinic receptors. So if you can smoke nicotine or take nicotine gum, then you're going to block those receptors up so you can trade off some of the stuff that's from the spike.
What happens? So the spike of COVID is the evil part of COVID. has all these horrible lab-engineered proteins encoded into them. Two of them are snake toxin proteins that bind onto your nicotinic receptors. So if you can smoke nicotine or take nicotine gum, then you're going to block those receptors up so you can trade off some of the stuff that's from the spike.
Yes, like that would probably – if you're having long COVID or any kind of post-COVID syndrome that's related to the nicotinic receptors, you only know by trying it. But listen, I always say start small. Don't go out and be a hero and take a whole dose at once. Start with a quarter of whatever it says and wait and see what happens.
Yes, like that would probably – if you're having long COVID or any kind of post-COVID syndrome that's related to the nicotinic receptors, you only know by trying it. But listen, I always say start small. Don't go out and be a hero and take a whole dose at once. Start with a quarter of whatever it says and wait and see what happens.
Because nicotine is a powerful drug. Try a cigar.
Because nicotine is a powerful drug. Try a cigar.
Yeah. Well, I mean, I've been around. I did a tour one time and there were two heavy, heavy smokers on the bus with me. And they were the only two people that didn't come down with whatever flu with all the rest of us got. Not even that flu couldn't even live in their throats.
Yeah. Well, I mean, I've been around. I did a tour one time and there were two heavy, heavy smokers on the bus with me. And they were the only two people that didn't come down with whatever flu with all the rest of us got. Not even that flu couldn't even live in their throats.
So here I am, a medical doctor, working in the field, believing in pretty much everything I was told, giving hundreds if not thousands of vaccines out to my patients, hepatitis B vaccines in particular, flu shots for sure. I was a nephrologist, kidney specialist, and dialysis, etc., And initially, you know, we all kind of have an aversion to needles. I think it's a natural human aversion.
So here I am, a medical doctor, working in the field, believing in pretty much everything I was told, giving hundreds if not thousands of vaccines out to my patients, hepatitis B vaccines in particular, flu shots for sure. I was a nephrologist, kidney specialist, and dialysis, etc., And initially, you know, we all kind of have an aversion to needles. I think it's a natural human aversion.
Well, it changes the polarity of your mucous membranes, the charge of the cells on your mucous membranes. And that's probably part of why even the viruses can't adhere properly.
Well, it changes the polarity of your mucous membranes, the charge of the cells on your mucous membranes. And that's probably part of why even the viruses can't adhere properly.
No, we're not at all.
No, we're not at all.
But if you are, they should be non-cured, naturally cured, non-chemical. Oh, like American Spirits? Yes.
But if you are, they should be non-cured, naturally cured, non-chemical. Oh, like American Spirits? Yes.
I get all my smoking friends to convert to that brand.
I get all my smoking friends to convert to that brand.
Totally. Oh, come on. Are you kidding me? You know how many horrible carcinogens there are? Do you know back in the native days when they were smoking and people were smoking natural cigarettes, it was almost unheard of for them to develop lung cancer with a natural tobacco? Right.
Totally. Oh, come on. Are you kidding me? You know how many horrible carcinogens there are? Do you know back in the native days when they were smoking and people were smoking natural cigarettes, it was almost unheard of for them to develop lung cancer with a natural tobacco? Right.
They're absolutely wrong. It is.
They're absolutely wrong. It is.
Don't you love the packages that have the people spitting up blood on the packages and stuff? Do you see them, right?
Don't you love the packages that have the people spitting up blood on the packages and stuff? Do you see them, right?
No, they have it now.
No, they have it now.
Do they not have it? They used to have it in America.
Do they not have it? They used to have it in America.
That's right. That's where I first saw it. But it's moved to the rest of the world. I know, it's hilarious. It's like, can they still buy them and smoke them?
That's right. That's where I first saw it. But it's moved to the rest of the world. I know, it's hilarious. It's like, can they still buy them and smoke them?
I just wrote down SV40 while you were talking. And I'm just going to give you an example of what you're saying is correct. The fact of the matter is that all cancers in humanity have gone up since the inception of vaccination. And my opinion, my educated opinion, is that our lifespan should be 120 years.
I just wrote down SV40 while you were talking. And I'm just going to give you an example of what you're saying is correct. The fact of the matter is that all cancers in humanity have gone up since the inception of vaccination. And my opinion, my educated opinion, is that our lifespan should be 120 years.
And I think with the knowledge that we have and the wealth that we have on this planet, the ingenuity we have on this planet, we should be able to be touching the 120-year mark. more commonly than we do. So when vaccines started coming into humanity, we started introducing animal disease into humanity through the skin.
And I think with the knowledge that we have and the wealth that we have on this planet, the ingenuity we have on this planet, we should be able to be touching the 120-year mark. more commonly than we do. So when vaccines started coming into humanity, we started introducing animal disease into humanity through the skin.
And then we started doing intermuscular injections after the hypodermic needle was created. And then you started having deeper injections of animal disease and of chemicals and mercuries and things like that. So along comes polio research and the polio vaccine, even to this day, is made on African green monkey kidney cells.
And then we started doing intermuscular injections after the hypodermic needle was created. And then you started having deeper injections of animal disease and of chemicals and mercuries and things like that. So along comes polio research and the polio vaccine, even to this day, is made on African green monkey kidney cells.
Now, the African green monkey kidneys early on were basically taken out of their wild habitat in India and millions of monkeys were brought to the USA for use. Unbeknownst to them. And discovered by a scientist named Dr. Bernice Eddy is that there was a cancer-causing entity inside of the substrate that they were using to make the vaccine on the Petri dishes.
Now, the African green monkey kidneys early on were basically taken out of their wild habitat in India and millions of monkeys were brought to the USA for use. Unbeknownst to them. And discovered by a scientist named Dr. Bernice Eddy is that there was a cancer-causing entity inside of the substrate that they were using to make the vaccine on the Petri dishes.
And that entity was simianvirus 40, SV40, called SV40 because before there were 39 others discovered before it. Now we're up over 100. So... That information was suppressed heavily. Bernice Eddy was offered a ticket to wherever she wanted to go and as much money as she wanted, and she said, no, I'm staying.
And that entity was simianvirus 40, SV40, called SV40 because before there were 39 others discovered before it. Now we're up over 100. So... That information was suppressed heavily. Bernice Eddy was offered a ticket to wherever she wanted to go and as much money as she wanted, and she said, no, I'm staying.
So when we're kids, we don't know what's going on. I want to go get my vaccines. You know, OK, fine. Sore arm. You get over it. Most of us were lucky enough to get over it. So by the time the first instance of. problem occurred in front of my eyes, I was already a fully seasoned professor of medicine, you know, working in a tertiary care medical center. Okay. And so it's been a bit of a process.
So when we're kids, we don't know what's going on. I want to go get my vaccines. You know, OK, fine. Sore arm. You get over it. Most of us were lucky enough to get over it. So by the time the first instance of. problem occurred in front of my eyes, I was already a fully seasoned professor of medicine, you know, working in a tertiary care medical center. Okay. And so it's been a bit of a process.
Long story short is they just kept taking her away from her work and distracting her, and there was another doctor, J. Anthony Morris, as well. Anyway, so SB40 was around, and then Maurice Hilleman validated it later and said it came from the African green monkey kidneys. Now, it's benign in the African green monkey, SB40. It is not benign in human beings.
Long story short is they just kept taking her away from her work and distracting her, and there was another doctor, J. Anthony Morris, as well. Anyway, so SB40 was around, and then Maurice Hilleman validated it later and said it came from the African green monkey kidneys. Now, it's benign in the African green monkey, SB40. It is not benign in human beings.
In human beings, it was called the perfect war machine by Dr. Michelle Carboni, who was one of the primary researchers looking at the carcinogenic potential of simian virus 40. So simian virus 40 would have been in the live polio vaccines because there was nothing to kill it. But it was most likely also in the killed.
In human beings, it was called the perfect war machine by Dr. Michelle Carboni, who was one of the primary researchers looking at the carcinogenic potential of simian virus 40. So simian virus 40 would have been in the live polio vaccines because there was nothing to kill it. But it was most likely also in the killed.
And African green monkey cells are actually still a listed ingredient on vaccines. So you can go ahead and look that up. It's a fact. So how this affects me is that I'm a kidney specialist. And I looked at the curve of kidney cancers that have gone up. since the inception of polio vaccines and SV40 introduction.
And African green monkey cells are actually still a listed ingredient on vaccines. So you can go ahead and look that up. It's a fact. So how this affects me is that I'm a kidney specialist. And I looked at the curve of kidney cancers that have gone up. since the inception of polio vaccines and SV40 introduction.
So what this virus does, it enhances two cancer-promoting genes, and it inhibits two cancer suppressors, okay? That's why it's called the perfect war machine. So that was in the vaccines that were injected. And so the bad news is that we don't need vaccines to give it to us anymore because we're going to give it to each other forever and it's never going anywhere.
So what this virus does, it enhances two cancer-promoting genes, and it inhibits two cancer suppressors, okay? That's why it's called the perfect war machine. So that was in the vaccines that were injected. And so the bad news is that we don't need vaccines to give it to us anymore because we're going to give it to each other forever and it's never going anywhere.
That was introduced to humanity like a lot of other diseases were through vaccination. We can give it to our kids. We can give it to each other. It comes out in the urine. And so it lives in the green monkey kidneys. It lives in our kidneys. As a kidney specialist, there are a lot of mysterious diseases.
That was introduced to humanity like a lot of other diseases were through vaccination. We can give it to our kids. We can give it to each other. It comes out in the urine. And so it lives in the green monkey kidneys. It lives in our kidneys. As a kidney specialist, there are a lot of mysterious diseases.
Lo and behold, there was some research into some of them, and the research was just put – this is the other thing. The research that's really important just gets killed. The funding gets killed. In terms of SV40 kidney cancers, there's no doubt that the rate of kidney cancers has gone up alongside with the infection rate of humanity for SV40, as well as diseases like glomerulonephritis –
Lo and behold, there was some research into some of them, and the research was just put – this is the other thing. The research that's really important just gets killed. The funding gets killed. In terms of SV40 kidney cancers, there's no doubt that the rate of kidney cancers has gone up alongside with the infection rate of humanity for SV40, as well as diseases like glomerulonephritis –
which they do find the pathogen genetic material inside. And even in the old days, they found it in the tumors but not the surrounding areas. So that just tells you that it was a stimulant for the tumor cells to just start propagating. So that's just one of the things that – that's just one of many, many of the obvious ones. And even though it's been well-defined in the medical literature –
which they do find the pathogen genetic material inside. And even in the old days, they found it in the tumors but not the surrounding areas. So that just tells you that it was a stimulant for the tumor cells to just start propagating. So that's just one of the things that – that's just one of many, many of the obvious ones. And even though it's been well-defined in the medical literature –
you will still see that they only admit that it causes mesotheliomas and one other thing, not that it causes all the other things that it does, that it's been shown to cause in the other medical literature that got its funding revoked.
you will still see that they only admit that it causes mesotheliomas and one other thing, not that it causes all the other things that it does, that it's been shown to cause in the other medical literature that got its funding revoked.
We probably both have it. Most of us probably have had it one time or other, whether it's lying dormant in our kidneys. Everything depends on your background immunity, which depends on what you're doing for fun and not fun and how you're eating and how much you're sleeping, et cetera, how much sun you're getting, sweating. Sweating gets rid of a lot of stuff. It's really good to sweat.
We probably both have it. Most of us probably have had it one time or other, whether it's lying dormant in our kidneys. Everything depends on your background immunity, which depends on what you're doing for fun and not fun and how you're eating and how much you're sleeping, et cetera, how much sun you're getting, sweating. Sweating gets rid of a lot of stuff. It's really good to sweat.
Oh, it's the same thing. It's not going to make much difference in terms. It'll gravitate to your kidneys. Obviously, it probably goes to lung as well. Brain tumors were a big problem with it back in the polio days. Dr. Michelle Carboni was looking at the brain tumors with that. There's a really good book called The Virus and the Vaccine by Bookchin and Schumacher.
Oh, it's the same thing. It's not going to make much difference in terms. It'll gravitate to your kidneys. Obviously, it probably goes to lung as well. Brain tumors were a big problem with it back in the polio days. Dr. Michelle Carboni was looking at the brain tumors with that. There's a really good book called The Virus and the Vaccine by Bookchin and Schumacher.
It's an incredible book that details everything about those years, the scientists involved. the suppression, the oppression, the lies, the skullduggery. Then they would bring in the scientist who had no experience in actually detecting SV40, and lo and behold, he couldn't find it. And he was the one that got to make the ultimate statement on whether SV40 causes human disease or not.
It's an incredible book that details everything about those years, the scientists involved. the suppression, the oppression, the lies, the skullduggery. Then they would bring in the scientist who had no experience in actually detecting SV40, and lo and behold, he couldn't find it. And he was the one that got to make the ultimate statement on whether SV40 causes human disease or not.
Because for me, it was the influenza vaccines in 2008, 2009, that showed me without a doubt that vaccines can and do cause kidney failure and put people on dialysis, that that does happen. It can cause hypertension. So we're not told to take a vaccine history in medical school. We're not told to even look there. It's not even part of, especially in adults.
Because for me, it was the influenza vaccines in 2008, 2009, that showed me without a doubt that vaccines can and do cause kidney failure and put people on dialysis, that that does happen. It can cause hypertension. So we're not told to take a vaccine history in medical school. We're not told to even look there. It's not even part of, especially in adults.
Oh, and the stocks that contained SV40 were still... basically being used by the vaccine manufacturers up into the 1990s and probably beyond because there's two different kinds of SV40. You're making me remember a whole bunch of things that I thought I forgot. But there's the fast dividing and there's the slow dividing. There's two different kind of strains of it.
Oh, and the stocks that contained SV40 were still... basically being used by the vaccine manufacturers up into the 1990s and probably beyond because there's two different kinds of SV40. You're making me remember a whole bunch of things that I thought I forgot. But there's the fast dividing and there's the slow dividing. There's two different kind of strains of it.
And the original test, so when they made a vaccine, they would test it for 14 days looking for SV40. If it didn't have it, off you went and your vaccine was good to go. But The problem is there was a slower dividing SV40 that remained in the vaccines that were injected and probably in the stocks. The stock is basically like your mother tincture or whatever.
And the original test, so when they made a vaccine, they would test it for 14 days looking for SV40. If it didn't have it, off you went and your vaccine was good to go. But The problem is there was a slower dividing SV40 that remained in the vaccines that were injected and probably in the stocks. The stock is basically like your mother tincture or whatever.
It's what you use to kind of inoculate all the new batches over time. And so the stocks were found. That's, again, quote Dr. Attorney Stanley Kopp's quote in the book about the SV40 still being in the stock market.
It's what you use to kind of inoculate all the new batches over time. And so the stocks were found. That's, again, quote Dr. Attorney Stanley Kopp's quote in the book about the SV40 still being in the stock market.
up and through the 1990s and you know god only knows if there's if it's still if they're still using those same stocks i don't know because i haven't gone into the to the more modern times of sv40 but yeah we all have it and there's no doubt in my mind that it's just like another one of the things that the parasites have finally pretty much put into us to set us back demons
up and through the 1990s and you know god only knows if there's if it's still if they're still using those same stocks i don't know because i haven't gone into the to the more modern times of sv40 but yeah we all have it and there's no doubt in my mind that it's just like another one of the things that the parasites have finally pretty much put into us to set us back demons
Well, they'll say that it was just an unfortunate set of events. that happened because they took wild monkeys from India. See, I could work for them. That's their excuse. And they say, we cleaned it up. You know, we started our own monkey colonies and we started breeding our own monkey colonies that were now found to be free of SV40.
Well, they'll say that it was just an unfortunate set of events. that happened because they took wild monkeys from India. See, I could work for them. That's their excuse. And they say, we cleaned it up. You know, we started our own monkey colonies and we started breeding our own monkey colonies that were now found to be free of SV40.
The only problem with that is that, as I said, they had already inoculated humanity. And it's with a virus that can be spread vertically and horizontally, as the scientists would describe, meaning we've all given it to each other. I think there are going to be very few people walking around today that haven't been introduced to it.
The only problem with that is that, as I said, they had already inoculated humanity. And it's with a virus that can be spread vertically and horizontally, as the scientists would describe, meaning we've all given it to each other. I think there are going to be very few people walking around today that haven't been introduced to it.
Yeah, that's what I'm talking about. That's what I did is I, in one of my videos, I did that and looked at the cancer rates since they were, you know, so again, what they'll say is, well, we just didn't look at the rates beforehand, but the rates were quite low before. You can know what the surgical, what the nephrectomies were.
Yeah, that's what I'm talking about. That's what I did is I, in one of my videos, I did that and looked at the cancer rates since they were, you know, so again, what they'll say is, well, we just didn't look at the rates beforehand, but the rates were quite low before. You can know what the surgical, what the nephrectomies were.
So it's kind of an easy thing to look at because that's the treatment for kidney cancer. You take the kidney out. Because you've got another kidney and it's a slow-growing tumor, even though it can metastasize. But anyway, I did look. And the rate has skyrocketed for kidney cancers. Pretty much everybody knows somebody who had a kidney cancer.
So it's kind of an easy thing to look at because that's the treatment for kidney cancer. You take the kidney out. Because you've got another kidney and it's a slow-growing tumor, even though it can metastasize. But anyway, I did look. And the rate has skyrocketed for kidney cancers. Pretty much everybody knows somebody who had a kidney cancer.
No. And also these protein-losing diseases, which is, again, it's not controversial. It was documented when they looked at the areas that were affected in the kidney with this horrible disease that makes people lose the proteins that need to stay in their blood, in their body, out into their urine. that the SV40 was related to that.
No. And also these protein-losing diseases, which is, again, it's not controversial. It was documented when they looked at the areas that were affected in the kidney with this horrible disease that makes people lose the proteins that need to stay in their blood, in their body, out into their urine. that the SV40 was related to that.
It's called focal and segmental glomerulosclerosis, and it's a real problematic disease in children and adults. Ultimately, you have to go on horrible chemotherapy drugs that ruin your immune system, and then transplantation if you can't stay on top of it. Big moneymaker. Now, do I think that that was the purpose? Look, I don't know what was in the hearts and minds.
It's called focal and segmental glomerulosclerosis, and it's a real problematic disease in children and adults. Ultimately, you have to go on horrible chemotherapy drugs that ruin your immune system, and then transplantation if you can't stay on top of it. Big moneymaker. Now, do I think that that was the purpose? Look, I don't know what was in the hearts and minds.
But when I did start looking there, I started to see more and more associations. Let's just put it that way. And so first I had to go down the flu vaccine bunny trail. And every time I went down that flu vaccine bunny trail, guess what I was asked? What about polio?
But when I did start looking there, I started to see more and more associations. Let's just put it that way. And so first I had to go down the flu vaccine bunny trail. And every time I went down that flu vaccine bunny trail, guess what I was asked? What about polio?
I don't know what was accidental and what wasn't. But I do know that there was intentional suppression of the truth. Any doubts, whether or not well-funded, must not be allowed to exist. That is a fact, and it's always been that way. And there have been scientists and doctors talking about that since the beginning of vaccination.
I don't know what was accidental and what wasn't. But I do know that there was intentional suppression of the truth. Any doubts, whether or not well-funded, must not be allowed to exist. That is a fact, and it's always been that way. And there have been scientists and doctors talking about that since the beginning of vaccination.
Yeah. It's kind of a childlike situation that humanity and most of humanity is in is that, you know, I think most people are good and they want to believe everybody else is good. And they want to believe that the government is looking out for them. And it's a really it's a kind of horrifying. Imagine if it was true that your government actually wasn't looking out for you.
Yeah. It's kind of a childlike situation that humanity and most of humanity is in is that, you know, I think most people are good and they want to believe everybody else is good. And they want to believe that the government is looking out for them. And it's a really it's a kind of horrifying. Imagine if it was true that your government actually wasn't looking out for you.
And that might be one of the causes of your decreasing lifespan. Imagine that if the government might not care so much if your baby ends up with no stem cells or your baby gets cancer or autism, which will be outright. And I mean, look at autism. Hello. Like, do we how many? I mean, we're to start with that.
And that might be one of the causes of your decreasing lifespan. Imagine that if the government might not care so much if your baby ends up with no stem cells or your baby gets cancer or autism, which will be outright. And I mean, look at autism. Hello. Like, do we how many? I mean, we're to start with that.
But that was another thing where there was no doubt whether or not well-funded allowed to exist. What came to autism and every autistic parent, parent of an autistic child will tell you this. Everyone has tried to lobby and get to the truth with autism will tell you that the brick walls and the plexiglass and the lead walls are. that went down were intense and still are intense.
But that was another thing where there was no doubt whether or not well-funded allowed to exist. What came to autism and every autistic parent, parent of an autistic child will tell you this. Everyone has tried to lobby and get to the truth with autism will tell you that the brick walls and the plexiglass and the lead walls are. that went down were intense and still are intense.
And the lying studies that they use to uphold vaccines don't cause autism are so easy to dismantle. But you know, Joe, you know, the lie gets around the earth three times before the truth has a chance to get out of bed. And that's just pretty much what happens when the media is owned. And like, you're like one of the cracks in the matrix here, quite frankly.
And the lying studies that they use to uphold vaccines don't cause autism are so easy to dismantle. But you know, Joe, you know, the lie gets around the earth three times before the truth has a chance to get out of bed. And that's just pretty much what happens when the media is owned. And like, you're like one of the cracks in the matrix here, quite frankly.
So I thought, all right, even though this has absolutely zero to do with polio because I'm watching people crap out in front of me after influenza vaccines, let's see about polio. Because I knew very little about polio, just like most people walking around out there do, that, you know, it was invented by this guy named Jonas Salk and it saved humanity.
So I thought, all right, even though this has absolutely zero to do with polio because I'm watching people crap out in front of me after influenza vaccines, let's see about polio. Because I knew very little about polio, just like most people walking around out there do, that, you know, it was invented by this guy named Jonas Salk and it saved humanity.
Thank you. Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you. Thank you.
We don't see these little crippled kids anymore. We don't have iron lungs anymore. Yay. Well, I would have to say that the polio bunny trail was the darkest one of all. And so after polio then became smallpox. And I thought, you know, we still have people walking the earth that have experienced the polio years.
We don't see these little crippled kids anymore. We don't have iron lungs anymore. Yay. Well, I would have to say that the polio bunny trail was the darkest one of all. And so after polio then became smallpox. And I thought, you know, we still have people walking the earth that have experienced the polio years.
So I kind of like to stick to polio because most of the smallpox, you know, people that would have been familiar with it are off the planet. But there's still some doctors around that'll talk about smallpox. The guy named Thomas Mack, who's probably close to 90, who was kind of ground zero in the 1940s and knows a lot about it and still says we shouldn't be vaccinating for smallpox today.
So I kind of like to stick to polio because most of the smallpox, you know, people that would have been familiar with it are off the planet. But there's still some doctors around that'll talk about smallpox. The guy named Thomas Mack, who's probably close to 90, who was kind of ground zero in the 1940s and knows a lot about it and still says we shouldn't be vaccinating for smallpox today.
Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you.
But it will show that you have had an experience inside of your body with COVID.
But it will show that you have had an experience inside of your body with COVID.
So then there was that. And then everyone and their dog was talking about autism. And I didn't really want to have anything to do with autism because I was an adult doctor.
So then there was that. And then everyone and their dog was talking about autism. And I didn't really want to have anything to do with autism because I was an adult doctor.
And this will stop it from you getting it.
And this will stop it from you getting it.
How was that? How close was that to the time you said you felt a little tired in the gym that day?
How was that? How close was that to the time you said you felt a little tired in the gym that day?
OK, a few months.
OK, a few months.
You're supposed to be fearful, you know.
You're supposed to be fearful, you know.
He's ruining the world's immunity. Well, I had the same thing. Like, you know, when I was first waking up, I had a friend who had unvaccinated kids that were part of a Steiner school. And they were like mutant freaks to me because they had never been on an antibiotic. They were like bright and happy and interactive and talented kids.
He's ruining the world's immunity. Well, I had the same thing. Like, you know, when I was first waking up, I had a friend who had unvaccinated kids that were part of a Steiner school. And they were like mutant freaks to me because they had never been on an antibiotic. They were like bright and happy and interactive and talented kids.
And at one point, one of them was playing with a hammer and nail. And I said to her mother, I was like, you got to be careful because she doesn't have a tetanus vaccine. And someone in the room said, well, Suzanne, what do you know about tetanus? And like in my head, I'm a full-fledged doctor at this point. I thought, I don't know anything about tetanus.
And at one point, one of them was playing with a hammer and nail. And I said to her mother, I was like, you got to be careful because she doesn't have a tetanus vaccine. And someone in the room said, well, Suzanne, what do you know about tetanus? And like in my head, I'm a full-fledged doctor at this point. I thought, I don't know anything about tetanus.
And outside I said, I know you don't want to get it. And I know it'll cause lockjaw. And then I started reading about tetanus and I had to go back and, you know, kind of apologize. And then I did a big video. I have a big video out on tetanus and the actual
And outside I said, I know you don't want to get it. And I know it'll cause lockjaw. And then I started reading about tetanus and I had to go back and, you know, kind of apologize. And then I did a big video. I have a big video out on tetanus and the actual
truth about the tetanus vaccines and actual tetanus which you know that's even harder for most people like most people who don't want to vaccinate their kids they'll vaccinate for tetanus if they can get a single shot and second only to polio everybody's got their two vaccines that they're their two diseases they're afraid of for their kid that makes them feel like they're at least doing something well the polio one always gets thrown in my face yeah they say it all all the time about polio yeah and i just go i don't have the time to do this
truth about the tetanus vaccines and actual tetanus which you know that's even harder for most people like most people who don't want to vaccinate their kids they'll vaccinate for tetanus if they can get a single shot and second only to polio everybody's got their two vaccines that they're their two diseases they're afraid of for their kid that makes them feel like they're at least doing something well the polio one always gets thrown in my face yeah they say it all all the time about polio yeah and i just go i don't have the time to do this
Thank you. Read the book.
Thank you. Read the book.
Well, they started killing dogs. You know, in New York, in that incidence I told you about where the vaccine, the gain-of-function strain escaped, people were throwing their cats out the window. Some 20,000 cats in New York City were killed during that time because there was a belief that cats spread the disease.
Well, they started killing dogs. You know, in New York, in that incidence I told you about where the vaccine, the gain-of-function strain escaped, people were throwing their cats out the window. Some 20,000 cats in New York City were killed during that time because there was a belief that cats spread the disease.
Yeah. Cinnamon is a powerful herb, actually, and it's known to be helpful in glucose handling for a lot of diabetics taking it in capsule form now. I noticed at the end of my nephrology career. that a lot of my own patients were taking cinnamon capsules. But it also has a lot of vitamin C in it, and I think that was probably one of the keys.
Yeah. Cinnamon is a powerful herb, actually, and it's known to be helpful in glucose handling for a lot of diabetics taking it in capsule form now. I noticed at the end of my nephrology career. that a lot of my own patients were taking cinnamon capsules. But it also has a lot of vitamin C in it, and I think that was probably one of the keys.
Wound-up. It was basically a natural virus that got kind of wound up by humans.
Wound-up. It was basically a natural virus that got kind of wound up by humans.
You're not allowed to cure it. Look, I was living in a country where... The government said there's no cure for COVID, there is no treatment for it, and there is no prevention for it except a vaccine.
You're not allowed to cure it. Look, I was living in a country where... The government said there's no cure for COVID, there is no treatment for it, and there is no prevention for it except a vaccine.
And lo and behold, we found out that there was a contract between the government and the pharmaceutical industry to have the emergency use of the vaccine trial on the population only under the condition that there is no other treatment available. And that's why the treatments were shut down.
And lo and behold, we found out that there was a contract between the government and the pharmaceutical industry to have the emergency use of the vaccine trial on the population only under the condition that there is no other treatment available. And that's why the treatments were shut down.
Because emergency use, there has to be no other treatment available. If you have ivermectin or if you have zinc and all the other things that we use with success. You know, there were so many people that I treated that should have been dead. I gave COVID to a 95-year-old woman who had chronic lung disease called bronchiectasis. She should have been the low-hanging fruit.
Because emergency use, there has to be no other treatment available. If you have ivermectin or if you have zinc and all the other things that we use with success. You know, there were so many people that I treated that should have been dead. I gave COVID to a 95-year-old woman who had chronic lung disease called bronchiectasis. She should have been the low-hanging fruit.
I was starting to feel a little bit unhappy one day, really just sluggish, like you mentioned. And when I was done seeing her, she goes, I just want to give you a hug. And she came over and I was going, oh, no. And after about three days, I was like, I've definitely got it. I tested and I rang her daughter. And I said, I've got to tell you, I was exposed. Margie was exposed to blah, blah, blah.
I was starting to feel a little bit unhappy one day, really just sluggish, like you mentioned. And when I was done seeing her, she goes, I just want to give you a hug. And she came over and I was going, oh, no. And after about three days, I was like, I've definitely got it. I tested and I rang her daughter. And I said, I've got to tell you, I was exposed. Margie was exposed to blah, blah, blah.
And she's like, yeah, mom's not feeling so good right now. And then two weeks later, I thought, I've got to call back again. I've got to make sure this lady's OK. She said, oh, no, mom's out at the hairdresser getting her hair done. Two weeks later, I still wasn't recovered. Two weeks later, she was out getting her hair done. Was she a smoker? She probably used to. I don't know.
And she's like, yeah, mom's not feeling so good right now. And then two weeks later, I thought, I've got to call back again. I've got to make sure this lady's OK. She said, oh, no, mom's out at the hairdresser getting her hair done. Two weeks later, I still wasn't recovered. Two weeks later, she was out getting her hair done. Was she a smoker? She probably used to. I don't know.
She can't remember that detail. But there was my senior partner had leukemia. He should have been absolutely, absolutely dead. Well, not on my watch. He wasn't going to be dead. So he survived the entire thing and died like two years later of something else.
She can't remember that detail. But there was my senior partner had leukemia. He should have been absolutely, absolutely dead. Well, not on my watch. He wasn't going to be dead. So he survived the entire thing and died like two years later of something else.
You're not allowed to have a healthy immune system.
You're not allowed to have a healthy immune system.
It depends. I get maybe what state you live in.
It depends. I get maybe what state you live in.
Yeah, it could be because you still have your teenagers and your young college students that are in sports and things like that. A lot of older people are more.
Yeah, it could be because you still have your teenagers and your young college students that are in sports and things like that. A lot of older people are more.
Yeah, and what supplements and how, you know, sometimes you can overdo. You do a hair mineral analysis on people, and sometimes you find things that are, you know, pretty shocking in terms of that came from supplements. You know, you can overdo it with even selenium.
Yeah, and what supplements and how, you know, sometimes you can overdo. You do a hair mineral analysis on people, and sometimes you find things that are, you know, pretty shocking in terms of that came from supplements. You know, you can overdo it with even selenium.
You can end up with big problems.
You can end up with big problems.
So they didn't clean their bins.
So they didn't clean their bins.
Well, I also, it's not what I think, because that's the thing. Like, look, when I got into this, I didn't say, oh, you know, I want to argue that vaccines are great. I said, look, I don't care. I didn't have skin in the game. I didn't have vaccine injured kids. I couldn't have cared less about it, essentially, except that it was something in front of me and didn't make sense. So I thought.
Well, I also, it's not what I think, because that's the thing. Like, look, when I got into this, I didn't say, oh, you know, I want to argue that vaccines are great. I said, look, I don't care. I didn't have skin in the game. I didn't have vaccine injured kids. I couldn't have cared less about it, essentially, except that it was something in front of me and didn't make sense. So I thought.
We're talking about adults here, presumably, but one of the facts is that the foundation that your immune system is created and developed in is probably, if not as more important than that, and that is
We're talking about adults here, presumably, but one of the facts is that the foundation that your immune system is created and developed in is probably, if not as more important than that, and that is
being born, vaginal birth versus a C-section, not putting down people who've had C-section, I'm just saying the science shows that there is a distinct difference in C-section babies' immune systems versus non-C-section. There's a distinct difference in breastfed babies versus non-breastfed.
being born, vaginal birth versus a C-section, not putting down people who've had C-section, I'm just saying the science shows that there is a distinct difference in C-section babies' immune systems versus non-C-section. There's a distinct difference in breastfed babies versus non-breastfed.
And there's a distinct difference in babies whose mothers have a healthy diet and breastfeed versus mothers who don't have a healthy diet and breastfeed. So that foundation actually makes your gut grow normally, which is a large part of your immune system.
And there's a distinct difference in babies whose mothers have a healthy diet and breastfeed versus mothers who don't have a healthy diet and breastfeed. So that foundation actually makes your gut grow normally, which is a large part of your immune system.
It colonizes your gut because the bacteria from your mother's gut goes into your gut, goes from her gut through her lymph system into her breast and then to your gut. And so all that foundational stuff is something not to be ignored because it's going to make you deal with diseases better. And if you have to get vaccinated, it's going to make you deal with vaccines better, even as a child.
It colonizes your gut because the bacteria from your mother's gut goes into your gut, goes from her gut through her lymph system into her breast and then to your gut. And so all that foundational stuff is something not to be ignored because it's going to make you deal with diseases better. And if you have to get vaccinated, it's going to make you deal with vaccines better, even as a child.
Not that I'm in favor of that, but I'm just saying, if you want to set things up as solidly as possible to be able to take that insult The problem is we don't know 20, 30, 40 years later what the associations are between bone diseases, skin diseases, cancers, autoimmune diseases. We have some clues. I have some clues that nobody wants to look at.
Not that I'm in favor of that, but I'm just saying, if you want to set things up as solidly as possible to be able to take that insult The problem is we don't know 20, 30, 40 years later what the associations are between bone diseases, skin diseases, cancers, autoimmune diseases. We have some clues. I have some clues that nobody wants to look at.
But we've got this long-term problem that nobody looks at.
But we've got this long-term problem that nobody looks at.
long-term effects of lifestyle of vaccination of even sv40 there was one study that started tracking a thousand sv40 people that they knew were infected with sv40 looking for diseases later in life and they stopped it after 19 years again axed when they still had over 700 people left in the study because they said too much time had gone by well the fact of the matter is that's when the study should have started 17 to 20 years later is when they sort of started looking at that point
long-term effects of lifestyle of vaccination of even sv40 there was one study that started tracking a thousand sv40 people that they knew were infected with sv40 looking for diseases later in life and they stopped it after 19 years again axed when they still had over 700 people left in the study because they said too much time had gone by well the fact of the matter is that's when the study should have started 17 to 20 years later is when they sort of started looking at that point
Not one year, two years. But, you know, most vaccine trials and drug trials, they don't they don't vaccine trials. It's like two weeks is almost a miracle for someone to follow out that long. Forget about looking months or years later. Doesn't happen.
Not one year, two years. But, you know, most vaccine trials and drug trials, they don't they don't vaccine trials. It's like two weeks is almost a miracle for someone to follow out that long. Forget about looking months or years later. Doesn't happen.
Well, you know, it was a bit of a process if you want to know it.
Well, you know, it was a bit of a process if you want to know it.
Yeah. So what first happened is I kept getting challenged while I was I stayed on for two years as a nephrologist in my hospital. So I wasn't kicked out. I left because like my soul just couldn't hang out there anymore. And so during that time, even though I was kind of ostracized behind my back, everybody still respected me as a nephrologist, but I still had to go.
Yeah. So what first happened is I kept getting challenged while I was I stayed on for two years as a nephrologist in my hospital. So I wasn't kicked out. I left because like my soul just couldn't hang out there anymore. And so during that time, even though I was kind of ostracized behind my back, everybody still respected me as a nephrologist, but I still had to go.
And in that time, I started doing public appearances. Like I went on the Gary Null show and started doing things like that, just talking about smallpox and polio because those were my focus because everyone's saying, what about smallpox? What about polio? And then when I started finding out, I just, I became obsessed with it. It was so interesting.
And in that time, I started doing public appearances. Like I went on the Gary Null show and started doing things like that, just talking about smallpox and polio because those were my focus because everyone's saying, what about smallpox? What about polio? And then when I started finding out, I just, I became obsessed with it. It was so interesting.
Wherever the truth falls, that's what I'm going to talk about. So what I say is that what the facts line up to show you is that polio is still here. Polio is still alive and well. Polio is called different things today. Whereas back in the 1940s, 1950s, the criteria for diagnosing polio were completely different to the year that the vaccine was introduced.
Wherever the truth falls, that's what I'm going to talk about. So what I say is that what the facts line up to show you is that polio is still here. Polio is still alive and well. Polio is called different things today. Whereas back in the 1940s, 1950s, the criteria for diagnosing polio were completely different to the year that the vaccine was introduced.
So I was morbidly fascinated by the whole thing and about how Everything I found was absolutely contrary to what the mainstream dogma is. And what I had was a mountain, you know, pile high to the ceiling and they had soundbites. They had nothing to fight back with me on. Nothing. Um, so, um, this guy named Roman Bistrianic heard me on the radio show and he, he rung my office.
So I was morbidly fascinated by the whole thing and about how Everything I found was absolutely contrary to what the mainstream dogma is. And what I had was a mountain, you know, pile high to the ceiling and they had soundbites. They had nothing to fight back with me on. Nothing. Um, so, um, this guy named Roman Bistrianic heard me on the radio show and he, he rung my office.
And after his third call, I was like, I guess I better call this guy back. And, um, And he had this idea for a book. And he had done all the charts and the graphics and started writing the narrative around that of what the historical document showed. And then I came in as kind of the medical person that was obsessed with polio and smallpox and happened to know quite a bit about pertussis.
And after his third call, I was like, I guess I better call this guy back. And, um, And he had this idea for a book. And he had done all the charts and the graphics and started writing the narrative around that of what the historical document showed. And then I came in as kind of the medical person that was obsessed with polio and smallpox and happened to know quite a bit about pertussis.
So we started writing the book together. And there's probably about There's got to be if you were to take a full time job 20 years, at least 20 years. But for me, it was condensed because I became obsessed after I quit my job. All I did, I basically had no money. I lived in a tent with a pop up camper. That was my office. And I was like crazy Ted Kaczynski obsessed with polio in my tent.
So we started writing the book together. And there's probably about There's got to be if you were to take a full time job 20 years, at least 20 years. But for me, it was condensed because I became obsessed after I quit my job. All I did, I basically had no money. I lived in a tent with a pop up camper. That was my office. And I was like crazy Ted Kaczynski obsessed with polio in my tent.
And so, no, I didn't have apprehension. I was like, this information, it's been so, the U.S. Polio Surveillance Unit charts were supposed to be available in libraries. Lo and behold, every library I went to to find them, I was told they're not here. There's only one library, the AMA library, and you have to have special high security clearance to look at them.
And so, no, I didn't have apprehension. I was like, this information, it's been so, the U.S. Polio Surveillance Unit charts were supposed to be available in libraries. Lo and behold, every library I went to to find them, I was told they're not here. There's only one library, the AMA library, and you have to have special high security clearance to look at them.
Well, I won't say how, but I got a hold of them. And what those documents show is that it wasn't just Cutter Laboratories that had a problem with live polio. It wasn't just Wyeth. We didn't talk about this, but all the vaccine companies had a problem with live virus in their injectable vaccines during Salk's year.
Well, I won't say how, but I got a hold of them. And what those documents show is that it wasn't just Cutter Laboratories that had a problem with live polio. It wasn't just Wyeth. We didn't talk about this, but all the vaccine companies had a problem with live virus in their injectable vaccines during Salk's year.
So 1954, 1955, up to 1959, they all were producing vaccine with live virus in it because Salk wouldn't listen to the scientists abroad who were saying his inactivation curve was where the sun doesn't shine. So that beginning of that and just tracking all that down and asking the questions that you asked, well, where did polio go? What was really causing the paralysis? Why don't we see it today?
So 1954, 1955, up to 1959, they all were producing vaccine with live virus in it because Salk wouldn't listen to the scientists abroad who were saying his inactivation curve was where the sun doesn't shine. So that beginning of that and just tracking all that down and asking the questions that you asked, well, where did polio go? What was really causing the paralysis? Why don't we see it today?
Like I had to answer all those questions and every question I answered It was so satisfying that I just wanted to go on to the next question. And so there was never any hesitation because I just actually I was so single minded that I didn't think about, you know, the threats that could happen as a result of that. And it wasn't until after the book was out that the threats happened.
Like I had to answer all those questions and every question I answered It was so satisfying that I just wanted to go on to the next question. And so there was never any hesitation because I just actually I was so single minded that I didn't think about, you know, the threats that could happen as a result of that. And it wasn't until after the book was out that the threats happened.
And I'm still here. And look, I figure if anybody wants to do me and now the timing is really bad because this is pretty much out there now.
And I'm still here. And look, I figure if anybody wants to do me and now the timing is really bad because this is pretty much out there now.
Yeah, so did I. So many of our childhood fables turn out not to be true. But that was a big one. And it's still hard for a lot of people to believe. But I just think it's like anything, like if you're open to different information. And I always say, look, I can make mistakes. I'm not infallible. Someone has actually found a mistake in the book. I actually went in and corrected it.
Yeah, so did I. So many of our childhood fables turn out not to be true. But that was a big one. And it's still hard for a lot of people to believe. But I just think it's like anything, like if you're open to different information. And I always say, look, I can make mistakes. I'm not infallible. Someone has actually found a mistake in the book. I actually went in and corrected it.
That's the difference between me and these other people. is that if I made a mistake, I want to know about it, and I will go and make it right, and I will publicly admit that I made a mistake. But I will say that 99.9% of what's in this book is true, factual, and provable. And because I've done the research, but it's a hard thing to do. What doctor is going to quit their job? I was lucky.
That's the difference between me and these other people. is that if I made a mistake, I want to know about it, and I will go and make it right, and I will publicly admit that I made a mistake. But I will say that 99.9% of what's in this book is true, factual, and provable. And because I've done the research, but it's a hard thing to do. What doctor is going to quit their job? I was lucky.
I didn't have kids. I didn't have – You know, medical royalty ancestors who would have been disappointed in me. I came from nothing. I wasn't afraid to go back to nothing. And so that's why I was willing to live in a tent until this thing was done and published in 2013. So how long did it take you? I started working on it. Roman had been working on it for years.
I didn't have kids. I didn't have – You know, medical royalty ancestors who would have been disappointed in me. I came from nothing. I wasn't afraid to go back to nothing. And so that's why I was willing to live in a tent until this thing was done and published in 2013. So how long did it take you? I started working on it. Roman had been working on it for years.
The playing field, the goalposts, everything was changed so that despite the fact that there was more paralytic polio in the years after that vaccine was introduced, they were able to show a complete cascading drop of paralytic polio simply because of the way they changed the definitions of what polio is and what could cause it.
The playing field, the goalposts, everything was changed so that despite the fact that there was more paralytic polio in the years after that vaccine was introduced, they were able to show a complete cascading drop of paralytic polio simply because of the way they changed the definitions of what polio is and what could cause it.
He had been going to libraries because his kids got hit hard by an ex-wife who jabbed them. He didn't know about it and they got really sick. And then he started looking at old graphs and going, oh, that doesn't make sense. So he got obsessed in his own way with the numbers. He's the numbers guy. And so he had been working on it.
He had been going to libraries because his kids got hit hard by an ex-wife who jabbed them. He didn't know about it and they got really sick. And then he started looking at old graphs and going, oh, that doesn't make sense. So he got obsessed in his own way with the numbers. He's the numbers guy. And so he had been working on it.
And then the two of us together worked on it probably from 2009 to 2013. And then it was published in 2013. We couldn't find a publisher. Even the alternative publishers didn't want anything to do with it. So we self-published. And then after it was successful, guess who wanted to publish our book? And I was like, nope, sorry. We're going to carry on the way we are.
And then the two of us together worked on it probably from 2009 to 2013. And then it was published in 2013. We couldn't find a publisher. Even the alternative publishers didn't want anything to do with it. So we self-published. And then after it was successful, guess who wanted to publish our book? And I was like, nope, sorry. We're going to carry on the way we are.
Oh, but you're going to get such more credibility. It's like unlikely.
Oh, but you're going to get such more credibility. It's like unlikely.
If you give us most of your profits.
If you give us most of your profits.
We'll give you $1 a book. Wow.
We'll give you $1 a book. Wow.
Self-published. It's all lies.
Self-published. It's all lies.
What's that there? Forbidden Science.
What's that there? Forbidden Science.
A long time ago. A long time ago.
A long time ago. A long time ago.
I think similar threads would run through his experience, definitely. Oh, I'm sure. Forbidden science.
I think similar threads would run through his experience, definitely. Oh, I'm sure. Forbidden science.
That's enough. That's it.
That's enough. That's it.
And they started testing for the virus, where before they would never test for the virus.
And they started testing for the virus, where before they would never test for the virus.
You're going to get it big time. I've gotten it already. They'll start picking apart my facts and they'll want to come on and dismantle. This is what always happens. I come in first. I tell my story.
You're going to get it big time. I've gotten it already. They'll start picking apart my facts and they'll want to come on and dismantle. This is what always happens. I come in first. I tell my story.
And then they bring in the experts who are able to take without me being in the room, of course, because I can't be able to defend myself and then let the public believe that everything I said was just one big sack of lies.
And then they bring in the experts who are able to take without me being in the room, of course, because I can't be able to defend myself and then let the public believe that everything I said was just one big sack of lies.
Not that I can recall.
Not that I can recall.
Yeah. I have to say I'm not that interested in doing that because I just feel like debate is an actual skill to be a debater. People study debate and people get really good at it. I'm not a debater. If somebody wanted to debate me in writing, I would be happy to do that because then I could sit there and take my time, go through the references that I needed rather than having to –
Yeah. I have to say I'm not that interested in doing that because I just feel like debate is an actual skill to be a debater. People study debate and people get really good at it. I'm not a debater. If somebody wanted to debate me in writing, I would be happy to do that because then I could sit there and take my time, go through the references that I needed rather than having to –
And when they started testing for the virus later, what they would find that people had Guillain-Barre syndrome, they didn't have virus, or they had Coxsackie virus or echo virus, or they were lead poisoned or mercury poisoned, which was the mercury and lead were the leading treatments of the day, including bloodletting.
And when they started testing for the virus later, what they would find that people had Guillain-Barre syndrome, they didn't have virus, or they had Coxsackie virus or echo virus, or they were lead poisoned or mercury poisoned, which was the mercury and lead were the leading treatments of the day, including bloodletting.
You know, have the artillery ready, you know, at me without having a shield. Right.
You know, have the artillery ready, you know, at me without having a shield. Right.
But I would do it only if we had a topic that was, you know... basically agreed upon beforehand that we could both upskill on and use what we know as that debate point. But it usually just becomes character assassination.
But I would do it only if we had a topic that was, you know... basically agreed upon beforehand that we could both upskill on and use what we know as that debate point. But it usually just becomes character assassination.
Well, just like in sports, it's the same here. It's like cheating is for losers. If you're a winner, you don't have to cheat. And that's the same with them. Like if their product is so wonderful that everybody needs it so badly, then why is there such – what they say is that we're too stupid to understand how they're saving our lives and how they –
Well, just like in sports, it's the same here. It's like cheating is for losers. If you're a winner, you don't have to cheat. And that's the same with them. Like if their product is so wonderful that everybody needs it so badly, then why is there such – what they say is that we're too stupid to understand how they're saving our lives and how they –
This is one of the big arguments that we really ought to touch on, is that they say that our lifespan has improved as a result of medical interventions. When what we show in here, what other scientists have shown, is that it's about 3.5% of... The contribution from medicine goes into our extended lifespan, 3.5% based on antibiotics, vaccines, et cetera.
This is one of the big arguments that we really ought to touch on, is that they say that our lifespan has improved as a result of medical interventions. When what we show in here, what other scientists have shown, is that it's about 3.5% of... The contribution from medicine goes into our extended lifespan, 3.5% based on antibiotics, vaccines, et cetera.
The rest of it was all about the revolution, the health revolution, the clean water, the shelter, the electricity, the child labor laws ending. So, you know, the magic of medicine is not what people think, and it really traps a lot of people. Like, I think there's a value to the medical field in terms of surgery and certain drugs, and if you have an organ failure, like, absolutely. But why not?
The rest of it was all about the revolution, the health revolution, the clean water, the shelter, the electricity, the child labor laws ending. So, you know, the magic of medicine is not what people think, and it really traps a lot of people. Like, I think there's a value to the medical field in terms of surgery and certain drugs, and if you have an organ failure, like, absolutely. But why not?
Like, my Hippocratic Oath said that I should consult, you know, any consultant that will help my patient and keep the well-being of my patient stable. Well, to me, that includes, you know, using every therapy that is available The most benign therapies possible first.
Like, my Hippocratic Oath said that I should consult, you know, any consultant that will help my patient and keep the well-being of my patient stable. Well, to me, that includes, you know, using every therapy that is available The most benign therapies possible first.
The ones that work along with the blueprint of a human body, that go along with the theory of health rather than pounding down disease. You're always going to get a better result that way, assuming you've got time and you haven't waited until the last minute.
The ones that work along with the blueprint of a human body, that go along with the theory of health rather than pounding down disease. You're always going to get a better result that way, assuming you've got time and you haven't waited until the last minute.
Well, that's the big thing. And the other thing is people trust what they see on the television. CNN was my go-to thing for the longest time. Yeah. And now I look at it and I think, oh, my goodness. You know what cracked it for me is when they publicly – villainized Andy Wakefield. And I actually knew the story behind Andy Wakefield at the time. What was that story?
Well, that's the big thing. And the other thing is people trust what they see on the television. CNN was my go-to thing for the longest time. Yeah. And now I look at it and I think, oh, my goodness. You know what cracked it for me is when they publicly – villainized Andy Wakefield. And I actually knew the story behind Andy Wakefield at the time. What was that story?
They were literally blowing smoke up people's butts. Like that's where the term comes from. Because if you want to Google that now, you'll see that there's an instrument that does it. So the polio story, where to even begin. And so there's about 70 pages. And so that became my obsession. So. When people said, what about polio? And I started digging this up. I went deep into it.
They were literally blowing smoke up people's butts. Like that's where the term comes from. Because if you want to Google that now, you'll see that there's an instrument that does it. So the polio story, where to even begin. And so there's about 70 pages. And so that became my obsession. So. When people said, what about polio? And I started digging this up. I went deep into it.
The story behind him is that he was the doctor you'll hear. He was publicly shamed. His license was removed. He published an article about what he called toxic nodular enterocolitis in children with autism. He was a gastroenterologist, a very high-level, very well-respected, decorated gastroenterologist. And he published this paper, which remained in the journal for 12 years.
The story behind him is that he was the doctor you'll hear. He was publicly shamed. His license was removed. He published an article about what he called toxic nodular enterocolitis in children with autism. He was a gastroenterologist, a very high-level, very well-respected, decorated gastroenterologist. And he published this paper, which remained in the journal for 12 years.
And all it said at the end was further research needs to be done in order to see if there is any real connection between the MMR vaccine, autism, and toxic nodular enterocolitis. These kids suffer with horrible bowel disease. It's not just brain disease.
And all it said at the end was further research needs to be done in order to see if there is any real connection between the MMR vaccine, autism, and toxic nodular enterocolitis. These kids suffer with horrible bowel disease. It's not just brain disease.
And so he was about to publish another paper showing that in this certain type of monkeys that were vaccinated against hepatitis B lost a lot of their reflexes and had problems. And it was on the eve of the publication of that paper that his original paper was revoked. And ever since then, he has been the poster child for vaccine nonsense, for anti-vax crazy people.
And so he was about to publish another paper showing that in this certain type of monkeys that were vaccinated against hepatitis B lost a lot of their reflexes and had problems. And it was on the eve of the publication of that paper that his original paper was revoked. And ever since then, he has been the poster child for vaccine nonsense, for anti-vax crazy people.
And, in fact, every time I've done anything, his name – funny that I brought his name up. I love him. He's a great guy. But his name would always come up. Well, you're a friend of Andy Wakefield. No, Andy Wakefield because autism and vaccines has been – debunked because Andy Wakefield lied. He didn't lie. All he said is, I did biopsies, I saw this, and this is possibly a connection.
And, in fact, every time I've done anything, his name – funny that I brought his name up. I love him. He's a great guy. But his name would always come up. Well, you're a friend of Andy Wakefield. No, Andy Wakefield because autism and vaccines has been – debunked because Andy Wakefield lied. He didn't lie. All he said is, I did biopsies, I saw this, and this is possibly a connection.
And since then, other scientists have come in, done the same thing, biopsies. Then they looked at whether the vaccine virus was in that biopsy, and it was. It wasn't a wild virus. It was the vaccine virus in that area, not the surrounding area. So there is a relationship between gut disease, MMR vaccine, retained, you know,
And since then, other scientists have come in, done the same thing, biopsies. Then they looked at whether the vaccine virus was in that biopsy, and it was. It wasn't a wild virus. It was the vaccine virus in that area, not the surrounding area. So there is a relationship between gut disease, MMR vaccine, retained, you know,
virus that hasn't been processed properly because it didn't come into your body properly, and disease, brain disease. So that's a fact. But CNN did a hit job on Andy Wakefield. And I remember going, huh, well, what's going on here? Because I know what happened with that whole situation. Now, CNN is saying this. And that was kind of when the windscreen cracked for me.
virus that hasn't been processed properly because it didn't come into your body properly, and disease, brain disease. So that's a fact. But CNN did a hit job on Andy Wakefield. And I remember going, huh, well, what's going on here? Because I know what happened with that whole situation. Now, CNN is saying this. And that was kind of when the windscreen cracked for me.
And I just had to start questioning anything. And then you've got the doctors that go on there. There are a couple of doctors. I think you interviewed one of them, didn't you? I
And I just had to start questioning anything. And then you've got the doctors that go on there. There are a couple of doctors. I think you interviewed one of them, didn't you? I
Yeah. Yeah. There was a guy before him and some of the stuff he said was pretty unbelievable. That's what the public is going to hear. You know, your best chances of dealing with this is to just get the vaccine. You don't want to get shingles. Get that vaccine. Never mind the whole other truth around that, because like you say, it's the advertisers, but it's bigger than that.
Yeah. Yeah. There was a guy before him and some of the stuff he said was pretty unbelievable. That's what the public is going to hear. You know, your best chances of dealing with this is to just get the vaccine. You don't want to get shingles. Get that vaccine. Never mind the whole other truth around that, because like you say, it's the advertisers, but it's bigger than that.
What do you think about giving yourself a vaccine for something you already have? Like, you think about it. Like, chicken pox is a disease that we all got as kids. You got it as a kid, probably. You're kind of superhuman, though. You didn't even get COVID. I got it eventually. You did, yeah. So I got it eventually. It broke you down. But I got chicken pox really bad.
What do you think about giving yourself a vaccine for something you already have? Like, you think about it. Like, chicken pox is a disease that we all got as kids. You got it as a kid, probably. You're kind of superhuman, though. You didn't even get COVID. I got it eventually. You did, yeah. So I got it eventually. It broke you down. But I got chicken pox really bad.
Yeah, there you go. Back in the old days, we would all get chicken pox and then we'd be exposed to other kids that had chicken pox.
Yeah, there you go. Back in the old days, we would all get chicken pox and then we'd be exposed to other kids that had chicken pox.
Yeah, people do. They still do that. I didn't have to. I got it somehow. I don't know how I got it. Probably from my brother. And so you have this virus lays dormant in your body until your immune system breaks down. So but part of it is not just your immune system breakdown. It's the fact that all these kids are now vaccinated and the circulation of the disease.
Yeah, people do. They still do that. I didn't have to. I got it somehow. I don't know how I got it. Probably from my brother. And so you have this virus lays dormant in your body until your immune system breaks down. So but part of it is not just your immune system breakdown. It's the fact that all these kids are now vaccinated and the circulation of the disease.
See, some vaccines work in terms of they stop the circulation of the disease, but add a detriment to us. So it's been a detriment for measles and it's been a detriment for chickenpox. So chickenpox, we used to get continuous. You didn't have adults didn't get shingles. It was very rare for adults to get shingles. before the chickenpox vaccine came out. Extremely rare.
See, some vaccines work in terms of they stop the circulation of the disease, but add a detriment to us. So it's been a detriment for measles and it's been a detriment for chickenpox. So chickenpox, we used to get continuous. You didn't have adults didn't get shingles. It was very rare for adults to get shingles. before the chickenpox vaccine came out. Extremely rare.
But since then, the rate of shingles in adults and children has skyrocketed because we're no longer getting our boosters being exposed to the circulating microbes. So now the solution to that is to give adults like four times the dose of the childhood chickenpox in an injectable vaccine against something that they already have.
But since then, the rate of shingles in adults and children has skyrocketed because we're no longer getting our boosters being exposed to the circulating microbes. So now the solution to that is to give adults like four times the dose of the childhood chickenpox in an injectable vaccine against something that they already have.
Yes. Yes. You have to dive into pesticides because the tonnage of production of DDT absolutely mirrored the diagnosis for polio in the days. And the countries that still make DDT today is where we're still seeing this paralytic polio situation happen.
Yes. Yes. You have to dive into pesticides because the tonnage of production of DDT absolutely mirrored the diagnosis for polio in the days. And the countries that still make DDT today is where we're still seeing this paralytic polio situation happen.
And so the theory is that you're going to ramp up your antibodies and then you're going to be able to do battle if your viruses come out again. The only problem with that is that the problem is the immune system. If you get AIDS or you're on chemotherapy, your chances of that happening are really high. And yeah, does the vaccine work or not? I don't know.
And so the theory is that you're going to ramp up your antibodies and then you're going to be able to do battle if your viruses come out again. The only problem with that is that the problem is the immune system. If you get AIDS or you're on chemotherapy, your chances of that happening are really high. And yeah, does the vaccine work or not? I don't know.
But I just don't think it's just to me just a completely strange concept to inject myself with something that I already have, along with all the other excipients and compounds that go in a vaccine that nobody wants to talk about either.
But I just don't think it's just to me just a completely strange concept to inject myself with something that I already have, along with all the other excipients and compounds that go in a vaccine that nobody wants to talk about either.
Well, in terms of the COVID vaccine, you just needed a pile of crap, actually, because it's made on E. coli cells. And that's where you find E. coli. So with a lot of the other vaccines, you do need living. Like for tetanus, you need rotten meat. That's how the tetanus vaccine is made, with rotten meat.
Well, in terms of the COVID vaccine, you just needed a pile of crap, actually, because it's made on E. coli cells. And that's where you find E. coli. So with a lot of the other vaccines, you do need living. Like for tetanus, you need rotten meat. That's how the tetanus vaccine is made, with rotten meat.
Yeah. Yeah. Big wake-up call with tetanus. So, you know, what we see, if anyone's worried about tetanus, what we're shown is a picture of a soldier from, like, the 1800s with his— He's naked and his back is arched. If you just Google tetanus right now and you look for images, you'll get this image. And so that's what we're told will happen if we get tetanus. It's a sure thing.
Yeah. Yeah. Big wake-up call with tetanus. So, you know, what we see, if anyone's worried about tetanus, what we're shown is a picture of a soldier from, like, the 1800s with his— He's naked and his back is arched. If you just Google tetanus right now and you look for images, you'll get this image. And so that's what we're told will happen if we get tetanus. It's a sure thing.
You're just going to get tetanus and you're going to die. Well, the fact of the matter is that when I started doing my deep dive in World War I, look, it was fought in the trenches with horses. That's where you get tetanus from ruminant animals. It lives in their gut and then it goes in the soil and it's just a spore. It doesn't do anything until it gets into an area that doesn't have oxygen.
You're just going to get tetanus and you're going to die. Well, the fact of the matter is that when I started doing my deep dive in World War I, look, it was fought in the trenches with horses. That's where you get tetanus from ruminant animals. It lives in their gut and then it goes in the soil and it's just a spore. It doesn't do anything until it gets into an area that doesn't have oxygen.
So you get a cut. You get a surgeon to close you up real nice without cleaning it out properly. And you're a setup for tetanus, which will transform from a spore to a different kind of a microbe and start releasing a toxin that can, it first starts as numbness, usually in that limb.
So you get a cut. You get a surgeon to close you up real nice without cleaning it out properly. And you're a setup for tetanus, which will transform from a spore to a different kind of a microbe and start releasing a toxin that can, it first starts as numbness, usually in that limb.
The extreme case is in that soldier who would have been malnourished, stressed out, probably vaccinated for smallpox before he hit the fields. and exposed to enormous amounts of tetanus, possibly gunshot wound or a slice somewhere, and then sewn up. So, yeah, his nervous system could have had a real big dose of toxin, and nobody did anything about it. That's the worst-case scenario.
The extreme case is in that soldier who would have been malnourished, stressed out, probably vaccinated for smallpox before he hit the fields. and exposed to enormous amounts of tetanus, possibly gunshot wound or a slice somewhere, and then sewn up. So, yeah, his nervous system could have had a real big dose of toxin, and nobody did anything about it. That's the worst-case scenario.
You don't want that to happen. But in today's – I've treated tetanus. Let's just put it that way. I've treated several cases of tetanus. One of the cases was a neurologically diagnosed tetanus. So tetanus is treatable. You can get on it early.
You don't want that to happen. But in today's – I've treated tetanus. Let's just put it that way. I've treated several cases of tetanus. One of the cases was a neurologically diagnosed tetanus. So tetanus is treatable. You can get on it early.
Rabbit studies have shown that if you give vitamin C, if you have a good high vitamin C level before you put glass with tetanus spores on it inside the skin of a rabbit, that you can prevent the tetanus from happening. Even if you give the vitamin C at the time of the injury, you can prevent it from happening. If you give it after the event, the death rate goes down to very, very low, if not zero.
Rabbit studies have shown that if you give vitamin C, if you have a good high vitamin C level before you put glass with tetanus spores on it inside the skin of a rabbit, that you can prevent the tetanus from happening. Even if you give the vitamin C at the time of the injury, you can prevent it from happening. If you give it after the event, the death rate goes down to very, very low, if not zero.
The first cases of polio, yes.
The first cases of polio, yes.
So vitamin C is a main factor, but the biggest factor is cleaning a wound and keeping the wound open if you think it's a dirty wound and not to close it straight up, which is why nails, you say stepping on a nail is the classic because rust can kind of hold the old spores inside of it. You step on the nail, you get inoculated, and then you wait for it to heal over.
So vitamin C is a main factor, but the biggest factor is cleaning a wound and keeping the wound open if you think it's a dirty wound and not to close it straight up, which is why nails, you say stepping on a nail is the classic because rust can kind of hold the old spores inside of it. You step on the nail, you get inoculated, and then you wait for it to heal over.
You have to open that wound if that's going to happen. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
You have to open that wound if that's going to happen. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Yes, it was out in the countryside. Well, that was probably more because of the sheep and cow dipping. So arsenic, you'd have to look at arsenic. You have to look at the mercurials. You have to look at the calcium arsenate, lead arsenate sprays that were put on trees. But what you're talking about in particular, they would call the cow disease. They'd go out in the family when you would.
Yes, it was out in the countryside. Well, that was probably more because of the sheep and cow dipping. So arsenic, you'd have to look at arsenic. You have to look at the mercurials. You have to look at the calcium arsenate, lead arsenate sprays that were put on trees. But what you're talking about in particular, they would call the cow disease. They'd go out in the family when you would.
Go to the house. They'd say, all the kids have the cow disease, what the cows had before. Well, what were they doing? They would have these trenches. You talk to farmers, even today. Oh, yeah, we had trenches. We would just walk them straight through, and I'd be soaked with this stuff by the end of the day.
Go to the house. They'd say, all the kids have the cow disease, what the cows had before. Well, what were they doing? They would have these trenches. You talk to farmers, even today. Oh, yeah, we had trenches. We would just walk them straight through, and I'd be soaked with this stuff by the end of the day.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Yeah. So they're basically soaking and bathing in arsenic, which is great for killing fleas and ticks. But it's not really great for keeping your nervous system happy because the fact of the matter is, and this again, I've got medical references, everything. I can't get away with making stuff up. OK, I have to put a reference for everything.
Yeah. So they're basically soaking and bathing in arsenic, which is great for killing fleas and ticks. But it's not really great for keeping your nervous system happy because the fact of the matter is, and this again, I've got medical references, everything. I can't get away with making stuff up. OK, I have to put a reference for everything.
A lot of those old remedies that we wrote about, the magic in them probably was the vitamin C in them.
A lot of those old remedies that we wrote about, the magic in them probably was the vitamin C in them.
cle cle disput disput cle cle cleacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketketketketacacket disputacacketket familiacacketket familiacacketketket familiacacketketket disput disputosketketket cleosketketacac familiketketket disputacketketket cleosketketketacacacac disputketketketketket cleosketketketacacacacacketketket disputacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacac disputacososket
cle cle disput disput cle cle cleacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketketketketacacket disputacacketket familiacacketket familiacacketketket familiacacketketket disput disputosketketket cleosketketacac familiketketket disputacketketket cleosketketketacacacac disputketketketketket cleosketketketacacacacacketketket disputacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacac disputacososket
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Where my brain was locked down and I was told what to do and how to do it and then watching the results. It would be one thing if the results were good, okay? But the results aren't good. Like we treat symptoms. We treat hypertension. Hypertension is a symptom. It's not a disease.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Where my brain was locked down and I was told what to do and how to do it and then watching the results. It would be one thing if the results were good, okay? But the results aren't good. Like we treat symptoms. We treat hypertension. Hypertension is a symptom. It's not a disease.
But arsenic causes the exact same spinal pathology that and fevers and everything. It literally mimics what they were calling polio and a polio virus back in the day.
But arsenic causes the exact same spinal pathology that and fevers and everything. It literally mimics what they were calling polio and a polio virus back in the day.
That's exactly right. So polio virus is what we call a commensal, just like you have staph on your skin and strep on your skin, and it actually serves a purpose. It keeps other microbes in check as long as you don't get a cut. and have not a good immune system to deal from the inside out.
That's exactly right. So polio virus is what we call a commensal, just like you have staph on your skin and strep on your skin, and it actually serves a purpose. It keeps other microbes in check as long as you don't get a cut. and have not a good immune system to deal from the inside out.
Hypertension can come from lots of different things. That's just one case in point. I really love being able to now have the freedom to look at the full human being and their physiology and look at them as an electromagnetic entity that has some chemicals and vitamins and help them direct their body back towards the blueprint that it was designed upon.
Hypertension can come from lots of different things. That's just one case in point. I really love being able to now have the freedom to look at the full human being and their physiology and look at them as an electromagnetic entity that has some chemicals and vitamins and help them direct their body back towards the blueprint that it was designed upon.
So polio, the reason I can say that polio is a commensal is because, again, there are medical studies that showed that people who dared to get on the edge of some of these wild native tribes down in South America or elsewhere, but in particular I'm talking about a South American tribe called the Javante Indians.
So polio, the reason I can say that polio is a commensal is because, again, there are medical studies that showed that people who dared to get on the edge of some of these wild native tribes down in South America or elsewhere, but in particular I'm talking about a South American tribe called the Javante Indians.
And that's, to me, what real healing and real medicine is about. It's not about being anti-antibiotic, anti-this, anti-that. It's like, how about pro-life? How about we get your You know, you're going out working every day. That's great because you know why? You're getting your blood and your lymph flowing and you're sweating. You sweat. You know, aluminum comes out in your sweat.
And that's, to me, what real healing and real medicine is about. It's not about being anti-antibiotic, anti-this, anti-that. It's like, how about pro-life? How about we get your You know, you're going out working every day. That's great because you know why? You're getting your blood and your lymph flowing and you're sweating. You sweat. You know, aluminum comes out in your sweat.
Toxic metals come out in your sweat. You create salt levels in your blood that stimulates your skin immune system, which is a separate entity. Like, I didn't know any of this when I was a conventionally practicing doctor. To even say, like, I wanted to detoxify mercury out of my patients in order to lower their blood pressure. And I was told that that was not allowed. We're not...
Toxic metals come out in your sweat. You create salt levels in your blood that stimulates your skin immune system, which is a separate entity. Like, I didn't know any of this when I was a conventionally practicing doctor. To even say, like, I wanted to detoxify mercury out of my patients in order to lower their blood pressure. And I was told that that was not allowed. We're not...
Like, well, then I don't want to do this anymore because I know from a hair mineral analysis and from a chelation test that that person is burdened with aluminum and mercury. And I know that those both of those things can raise blood pressure. So why wouldn't we want to remove that? The same reason we're not allowed to say vaccines.
Like, well, then I don't want to do this anymore because I know from a hair mineral analysis and from a chelation test that that person is burdened with aluminum and mercury. And I know that those both of those things can raise blood pressure. So why wouldn't we want to remove that? The same reason we're not allowed to say vaccines.
You know what a multibillion dollar industry blood pressure treatment is and cholesterol treatment is?
You know what a multibillion dollar industry blood pressure treatment is and cholesterol treatment is?
Forget about it. But, yeah, I mean, I saw malignant hypertension happen after a tetanus shot in an adult patient of mine. And so that was another one, you know, thing that woke me up. And I was like, well, gosh, that's weird. And then you look up, you see there's other case reports. And then you're told, well, case reports don't mean anything. You need randomized controlled studies. Yeah.
Forget about it. But, yeah, I mean, I saw malignant hypertension happen after a tetanus shot in an adult patient of mine. And so that was another one, you know, thing that woke me up. And I was like, well, gosh, that's weird. And then you look up, you see there's other case reports. And then you're told, well, case reports don't mean anything. You need randomized controlled studies. Yeah.
So it's like there's frustration at every corner. But I love doing what I do now. And I love I love the fact. Look, it was all it's all great. Like I wouldn't change anything in my life. Just put it that way. And I'm really glad I have the background of conventional medicine. But that's like background of conventional medicine is like year one and really learning about healing and life.
So it's like there's frustration at every corner. But I love doing what I do now. And I love I love the fact. Look, it was all it's all great. Like I wouldn't change anything in my life. Just put it that way. And I'm really glad I have the background of conventional medicine. But that's like background of conventional medicine is like year one and really learning about healing and life.
It's just it's the very basics. And doctors still need to keep learning. But most conventional doctors are mandated to keep learning, but they're told where they can read to get their credits every year. You can only get your credits from reading this and answering the questions like a good little doggy every year. which I still have to do.
It's just it's the very basics. And doctors still need to keep learning. But most conventional doctors are mandated to keep learning, but they're told where they can read to get their credits every year. You can only get your credits from reading this and answering the questions like a good little doggy every year. which I still have to do.
But beyond that, when I have my own spare time, you know, like I've learned ozone therapy. I've learned how to use vitamin C. I've learned how to look at the body electromagnetically and use bioresonance.
But beyond that, when I have my own spare time, you know, like I've learned ozone therapy. I've learned how to use vitamin C. I've learned how to look at the body electromagnetically and use bioresonance.
And there's just so much stuff you can do that really helps people and keeps them out of a whole bunch of trouble that they would have gotten into if they went and took allergy medicines and got their tonsils out or kept on their blood pressure medications and let the inflammation go wild in their body and didn't know anything about how to dampen. Look, most disease comes from inflammation.
And there's just so much stuff you can do that really helps people and keeps them out of a whole bunch of trouble that they would have gotten into if they went and took allergy medicines and got their tonsils out or kept on their blood pressure medications and let the inflammation go wild in their body and didn't know anything about how to dampen. Look, most disease comes from inflammation.
You know, cholesterol is trying to save you. It's not trying to kill you. The cholesterol is a response to inflammation. It's like your fever is trying to save your life. It's like everything in medicine is about dampening down the symptoms that are trying to save your life. You know? So it's like I look at it and I think, I can't believe I ever actually agreed upon that.
You know, cholesterol is trying to save you. It's not trying to kill you. The cholesterol is a response to inflammation. It's like your fever is trying to save your life. It's like everything in medicine is about dampening down the symptoms that are trying to save your life. You know? So it's like I look at it and I think, I can't believe I ever actually agreed upon that.
So the Indian Health Service got to the edge of it and bargained that they would get some stool and some blood from the tribes so that they could test it for polio. And what they found was 98 to 99 percent of every person they tested, and it was hundreds of people, had evidence of immunity to all three strains of polio. And they said to them, well, where are your crippled children?
So the Indian Health Service got to the edge of it and bargained that they would get some stool and some blood from the tribes so that they could test it for polio. And what they found was 98 to 99 percent of every person they tested, and it was hundreds of people, had evidence of immunity to all three strains of polio. And they said to them, well, where are your crippled children?
And if that wasn't the case, we would have more medical freedom than we have, right?
And if that wasn't the case, we would have more medical freedom than we have, right?
Because we would have choices. We would have options. We wouldn't be told what we have to do to protect the public.
Because we would have choices. We would have options. We wouldn't be told what we have to do to protect the public.
Pretty crazy, isn't it?
Pretty crazy, isn't it?
Cheers to you.
Cheers to you.
That's what the reports showed. And even today, apple cider vinegar, you know, it's had a big resurgence in terms of, you know, keeping your gut pH nice and low so that you can digest your food better, which has downstream effects to everything. But it's also a fermented product. You know, it's got a lot of benefits, not just that, but even on the skin.
That's what the reports showed. And even today, apple cider vinegar, you know, it's had a big resurgence in terms of, you know, keeping your gut pH nice and low so that you can digest your food better, which has downstream effects to everything. But it's also a fermented product. You know, it's got a lot of benefits, not just that, but even on the skin.
It's like really great to put on chicken pox and probably smallpox as well. If I may, just direct people to dissolvingillusions.com because if you just go to Amazon, there's two different versions of the book. There's the original one that you read and then there's the 10th anniversary version that has 200 extra pages.
It's like really great to put on chicken pox and probably smallpox as well. If I may, just direct people to dissolvingillusions.com because if you just go to Amazon, there's two different versions of the book. There's the original one that you read and then there's the 10th anniversary version that has 200 extra pages.
And we delineate early on what the new pages, what the new chapters are so you don't have to go read the old stuff if you don't want to.
And we delineate early on what the new pages, what the new chapters are so you don't have to go read the old stuff if you don't want to.
It covers tuberculosis. It covers one of the chapters I really love. It's toxic medicine of the past, all the different crazy treatments that I was telling you about. And then I added a whole bunch of the whooping cough because more information came out after 2013. So we added that in. And then we published a second book, which is all full of doctor quotes from 200 years.
It covers tuberculosis. It covers one of the chapters I really love. It's toxic medicine of the past, all the different crazy treatments that I was telling you about. And then I added a whole bunch of the whooping cough because more information came out after 2013. So we added that in. And then we published a second book, which is all full of doctor quotes from 200 years.
Because people say, why are you the only one? It's like, well, I'm actually not the only one. It's like back then, this was what was recorded from doctors and public health officials, which is probably 1% of what actually was said. And then we have hard to find vaccination tragedies, Royal Commission on Vaccination timeline.
Because people say, why are you the only one? It's like, well, I'm actually not the only one. It's like back then, this was what was recorded from doctors and public health officials, which is probably 1% of what actually was said. And then we have hard to find vaccination tragedies, Royal Commission on Vaccination timeline.
Where's your short legs? Where are the people that died of respiratory failure? And they were like, we don't have any of that problem. So it was well known.
Where's your short legs? Where are the people that died of respiratory failure? And they were like, we don't have any of that problem. So it was well known.
And then we have rare documents at the back that has like the Encyclopedia Britannica, where they hired a very highly decorated well-known, highly respected doctor to write a chapter on smallpox. And at the end, when he did what I did and basically looked at all the facts, he decimated the vaccine completely. So you can't really find that very easily anymore.
And then we have rare documents at the back that has like the Encyclopedia Britannica, where they hired a very highly decorated well-known, highly respected doctor to write a chapter on smallpox. And at the end, when he did what I did and basically looked at all the facts, he decimated the vaccine completely. So you can't really find that very easily anymore.
So this one is called The Companion Book to Dissolving Illusions. But you can see all the versions and we've been translated into eight languages. We're about to be translated into Chinese. But the best resource is dissolvingillusions.com, and it will show you what your options for purchase and where you can purchase the different books.
So this one is called The Companion Book to Dissolving Illusions. But you can see all the versions and we've been translated into eight languages. We're about to be translated into Chinese. But the best resource is dissolvingillusions.com, and it will show you what your options for purchase and where you can purchase the different books.
If you want an alternative press, we have an alternative press for those people that don't want to do Amazon. And all the different languages and the different versions are on there.
If you want an alternative press, we have an alternative press for those people that don't want to do Amazon. And all the different languages and the different versions are on there.
Thank you for what you're doing.
Thank you for what you're doing.
This is in nature. don't become more problematic as they go through the human system. They become less problematic. Remember the whole COVID thing. In the beginning, people were getting super, super sick. It wasn't as contagious, but it was more virulent. And as it attenuated into the human bodies, it kind of fizzled out a bit.
This is in nature. don't become more problematic as they go through the human system. They become less problematic. Remember the whole COVID thing. In the beginning, people were getting super, super sick. It wasn't as contagious, but it was more virulent. And as it attenuated into the human bodies, it kind of fizzled out a bit.
And then we got the Omicron, which was more spreadable, but it was much less pathological. And that's the natural process that happens. So When you're going to have real problems with microbes, they're usually going to be reverse attenuated, meaning made more lethal in a lab. And then they're introduced into the population. And look, I'm not making this up either.
And then we got the Omicron, which was more spreadable, but it was much less pathological. And that's the natural process that happens. So When you're going to have real problems with microbes, they're usually going to be reverse attenuated, meaning made more lethal in a lab. And then they're introduced into the population. And look, I'm not making this up either.
1916, Upper East Side, Manhattan, there was a Rockefeller lab that their specific stated goal was to try to create the most pathological, neuropathological strain of polio possible. And they did that by taking monkey brains and human spinal serum and injecting it into monkeys. And there was a big problem with that, which was released into the public by accident.
And the world experienced the worst polio epidemic on record, 25% mortality. That's unheard of. Really freaked the public out. And you can see the epicenter as it fanned out. And as it fanned out and as time went on, never heard of it again. It attenuates as it moves through the body because it's a normal human commensal that goes back to its normal state when it's in a human.
It is. And it doesn't develop drug resistance like a lot of the drugs that are engineered for it. Yeah, the hippies seem to have got it right, I think.
And that's generally what happens. If you have a highly lethal virus and it kills a lot of people, those people are dead. They can't spread anything. So that's kind of a different story if you want to talk about hantavirus or something like that. But as far as polio goes, no, polio was only made more lethal by the stupid things that humans did around it.
So make it more invasive into the body, just like you can go do stupid things and end up with herpes outbreaks and staph outbreaks. Poliovirus is a normal commensal. It used to be until we obliterated it with oral vaccines and replaced it with vaccine strain. But the wild strains... are normal human commensals.
Absolutely. Today, it would be the oral polio vaccines because they're the live strains and they're still giving them pulse fashion all throughout India. They did a campaign a few years back in Israel, and they always say that a nomad came and pooped in the sewage system, and they find it in the sewage system, and they don't want an outbreak to happen, so they treat everybody.
So that's today the most common reason to see
poliomyelitis disease from a virus if you test for a virus they'll usually find the vaccine virus and that's why today we don't remember when we were kids because we're about the same age I think they would give us the sugar cube maybe you didn't but I did I got the sugar cube and that was the live vaccine well they stopped doing that because after a while the only cases of polio and it became so obvious that the only cases of polio we were seeing related to a virus when they tested for polio virus were vaccine strains then they started injecting us again
But the early injections caused more paralytic polio than it prevented. And that's the part that people don't understand when they say, what about polio? Because they, like you, just go, well, there's no more iron lungs. There's no more crippling. There's no more of these poor little kids walking around with their casts. Well, that's not true because the iron lung is now called a ventilator.
So that's out the window. Transverse myelitis, which there are about 1,300 cases. I think it's a month diagnosed in one particular – I put a quote – put a quote in here on that. But transverse myelitis is actually something that would have absolutely, it follows the same pathology as polio, would have been called polio back in the day.
So we still have polio that we had in 1953, because in 1953, all you had to have to be diagnosed is polio. Anyone could diagnose you, just one examination with one set of muscles being paralyzed. There was no timeframe on it. There was no testing done on it. And then it was considered a public service to do it because then you were eligible for funding.
Myelitis? Poliomyelitis is the definition of the actual pathology. So it basically means inflammation of the gray matter of your spinal cord. That's what polio in Greek, poliomyelitis. It means gray matter inflammation, poliomyelitis. Poliomyelitis is what happens in the body. If you want to talk about what causes it, then, okay, maybe in some cases a poliovirus causes it.
And all the other things we just mentioned, arsenic, lead arsenate, calcium arsenate, injections, tonsillectomies were huge cause of some of the worst cases of poliomyelitis. And in fact, injections and tonsillectomies and unnecessary surgeries were put on hold during the years where the epidemics were the worst. So that's just proof that even the surgeons knew that.
Okay, so if you happen to have poliomyelitis circulating in your body that's not just sitting in your intestines and, say, it made its way into your body, because we can. Things can go from your intestines into your body. And you happen to have it close to a nerve that's up, say, around your throat, and then you go and take tonsils out.
then what you've done is you've given that access to the blood compartment, the lymph compartment, and the brain stem, which is right there, local. So those are the people that would get what was called bulbar polio, which is the ones that put you on a ventilator. And it's highly lethal. It's the worst kind of polio to get, bulbar polio.
And it was very well known to have been coincident with tonsillectomies. Not only that, but tonsillectomies changed the structure and antibodies and the immunity that occurred in the throat and changed it for the worse, not for the better.
Okay, so again, it's not just a cut and dry answer because let's just say that anyone who's ever brought their child to me because the tonsils were touching or they were snoring has not had to have a tonsillectomy. Now, does that mean that a tonsillectomy won't solve that problem where you're snoring and your kid's maybe not oxygenated? No.
If you let it go that long, probably you're going to need a tonsillectomy. But I've seen so many cases reverse. It's a very easy thing to do. But as doctors, we're not taught about all the things that you were talking about earlier, the natural remedies, but just simply gargling with a solution of –
sodium ascorbate, vitamin C, can make a huge difference because tonsils are like, they're like porous golf balls, if you want to think of them that way. They've got pits in them. And so food you eat and bacteria and pus can build up.
But if you just start rinsing the outsides of them and start nourishing the body from the inside and getting rid of things that the kid might be allergic to, which almost every kid's going to eat if your parent doesn't know better, it can make a remarkable difference in these kids that have these huge tonsils. So I think that
I think everything else should be done first before taking out the tonsils if there's time because I'd say 95% to 99% of the time you can prevent that child from needing their tonsils removed.
Absolutely, 100%. And it's not just something he's dreamed up. Again, provable medical literature in the book, Dissolving Illusions. The physiology, the pathology is known. It's very well known that the vaccines that have aluminum in them skew the immune system. So the immune system kind of just, if you want to break it down really simply, you have your Th1 arm and your Th2 arm.
Your Th1 arm is a really important one. Those are your T cells, you know, your lymphocytes, the cells that, you know, chew up any garbage that's going around. That's the part you want activated in any infection you have, whether it's COVID or measles or smallpox or whatever. And then you have your TH2 arm, which is there mostly to deal with parasites and things like that.
And it's mostly an antibody arm of immunity. That's the one that vaccinologists are obsessed with, making sure there's enough antibody. So the vaccines that have aluminum in them, as opposed to the live attenuated vaccines, which don't have aluminum. All the other ones do. So your DTAP is going to have aluminum in them. All your killed vaccines are going to have aluminum in them.
And that is very well known to trigger that TH2 response, which is the allergic response, which can set up your body for autoimmunity. And so part of the purpose of breastfeeding, which is part of the blueprint for humanity and every other mammal, is that the mother is able to introduce antigens in the world to her baby through her own breast and things that she's been eating and breathing in.
And then the baby's able to develop tolerance. So, you know, while vaccine scientists are obsessed with getting antibodies and ramping up an infant's inadequate immune system, the fact of the matter is, is that it's more important to learn what not to react to when your immune system's developing rather than to becoming defensive against every microbe that could get you.
So that's kind of the paradox there and one of the battlegrounds for immunology, within immunology, and for those of us out here that are going, what are you doing here?
It's so much more than that. And I was actually quite startled when I really went down that rabbit hole to see not only, I mean, it is food. It's excellent nutrition with short-chain fatty acids and sugars that the baby needs. It actually trains your gut. to be healthy in the long run as an adult, which trains your immune system as well.
But what that mother is putting through her breast milk, you know, things like something called HAMLET, H-A-M-L-E-T, which stands for human alpha-lactalbumin made lethal to tumors. And this is a substance. This is a protein. It's like a transformer protein that can literally turn into a cancer-busting molecule that is being used by the oncology industry, okay?
And when it's not in that form, it's a powerful protein that fights off pertussis, all kinds of pneumococcal bacteria. And when it's not doing that, it's food. Okay, so it's like it's got so many different purposes. Stem cells are coming through that mother's milk. Activated T cells. Activated T cells have another substance in them that is kind of hijacked by the oncology industry.
And that is when they're immunosuppressing kids for leukemia or whatever. and they come in contact, say, with chickenpox, what they can do is get somebody like me, who's immune to chickenpox naturally, and take my memory T cells that remember that, and there's a substance in there called dialyzable leukocyte extract.
When you put that into another child, even if whether they eat it or inject it into them, It transfers cellular, that Th1, important arm of immunity I just told you, it transfers it onto them and protects them for a long time.
So that's kind of in the old days when mothers had measles in the old days and normally, and they were able to pass this powerful immunity through that DLE factor, as well as all these other things, including preformed immune globulins. I mentioned something like 80,000 stem cells. It's just incredible. And we still have only hit the tip of the iceberg in terms of what we know about breast milk.
No, they don't tell you anything, just Tylenol, which actually makes the vaccine not work as well, in addition to causing all kinds of immunological disturbances at the time that you're supposed to be upregulating your immune system against this dreaded disease. Yeah, but one of the things about the recommended by the white coats and the authorities is that they
But breast milk also, it's been proven again, that if you're going to, if you are going to vaccinate your baby, if you're breastfeeding, the vaccine will bring that baby more into a Th1. If you're not breastfeeding and you're giving formula, that baby's going to move more into a TH2 in response to that vaccine.
So like if I think if most women understood the powers of breast milk, they would do everything possible to be able to do it.
Parasites. We have we have parasites that. have been parasites upon humanity for such a long time. And that's what happens is that something is discovered. And for some people, maybe it can be a good idea, but then the parasites take it and want to. So when it came to breastfeeding, it was you don't have to do that. You don't have to bother yourself like that.
You don't have to pull your boobs out in public. You don't have to become a dairy cow. Just strap them down. The milk will stop. And then you can start putting this wonderful. When I was a kid, I was fed soy milk in a warm plastic bag. That was the fad then growing up. So the formula industry is a huge moneymaker. And some women do prefer it.
Fortunately, 75% of women in the USA today do initiate breastfeeding. So that's very much better than the polio days when almost nobody was breastfeeding and they were using milk in the infant formula that had been contaminated by what the cows were eating. And so that was another part of the polio story that's not been told.
Well, the cows wouldn't have been necessarily getting sick from it, but it would be concentrating in their milk. And so the milk would have been expressed. But you just brought me back to another place. Cows were also used during the smallpox era, and what you're saying is true about that. So they would basically take – Sorry, it's just so dark that sometimes you have to laugh.
But they would take pus from other animals, scratch it into the belly of a cow, then take the pus off of the big pimples that would form on the belly of a cow. The cow could become very sick, and yet that cow could still be butchered up at the butcher shop. The butcher would get sick with pemphigus or some hand and mouth disease or, you know, the things that the cows normally catch.
And so those cows could still be used to produce meat in those cases. I don't know that it was used to produce milk. I don't think that would have – I don't know. But I know it was used to produce meat because the butchers were getting sick and the people that were eating the meat were getting sick.
And certainly the people that took the vaccines that had certain who knows what in them because it was shown – Like into the 1970s, 80s, and even recently, I have a reference from after the year 2000 that there was more bacteria and fungus in the smallpox vaccines than there was smallpox virus.
The public believes that so many drugs and remedies are standardized that the conventional medical system gives out. And when you go to actually look at them, and this includes vaccines, even though they're standardized, meaning that the manufacturers are told what the regulations should be in terms of production, when people go and look at them, they find it's anything but standardized.
So it was because they had this thing called pure lymph, which was pus that came out of the horse's foot or a donkey's pus skin or a cadaver of a human or a cow's ulcerating udders. and scraped into glycerin and called Pure Lymph and marketed all over the world. This is the joke. This was our success. This is the one vaccine that eliminated, eradicated a disease. Can you believe that fairy tale?
I'll tell you another one. It doesn't get crazy. This is our success. This vaccine that I had described in great detail with what was in it and what people saw under microscopes and then later tested genetically was what was called a quasi-species, meaning they don't even, after a while, it became its own thing. It wasn't from a horse anymore. It wasn't from a human anymore.
They called it humanized horsepox when they genetically characterized the dry vacs and then ordered that every dry vac specimen on the planet be destroyed. I think that was around 2009. Why did they do that? Good question. I don't know. Hiding the evidence, possibly. But they now have a new vaccine, which doesn't work. But they wanted to bring this one back.
When I was in the peak of my career in 2003, I got a letter on my desk stating that they needed people to get vaccinated for smallpox so that
those other people that were getting vaccinated would have somebody that could treat them that would be immune to smallpox because it's well known that if you get a smallpox vaccine and you get these horrible scabs that you're going to spread smallpox and you're going to have a horrible, itchy time of secondary infections. You will need a doctor at some point.
Well, it turns out that the trials that they did on super healthy people, soldiers that were in top shape, were so bad in terms of cardiac disease and other diseases that that the government put it on hold for a second and said, no, no, no, we can't do this. Meanwhile, guess what? They were using the same vaccine in the 1700s and 1800s
late 1700s all through the 1800s into the 1900s, they would sometimes, you probably saw the picture of the child's arm considered a good take, five huge ulcers on the arm with sanitation being what it was, no antibiotics. Can you imagine having your baby have five scars on its arm, ulcerating from these things, having fevers? Sometimes the arms became necrotic.
Sometimes the disease spread all over the place, and there was nothing to give them except bloodletting, mercurials, and arsenicals, and heating them up in a dark room with no sunlight. That was the treatment for smallpox. So you tell me why smallpox was so lethal.
Yes, it is good to keep an open mind, isn't it, and be flexible and look at a 360-degree view of things rather than your tunnel vision and what you're indoctrinated into, isn't it?
It's very variable, which is why we see such variability in the And the results when people receive them, that's only one reason why there's so much variability.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Well, we certainly saw an explosion of their creativity since 1986. So actually in 1986, you're referring to the National Child Vaccine Injury Act that was passed in 1986. But before 1986, we had 1976, which was the swine flu vaccine fiasco. And that was a situation where there was so much injury that the vaccine producing companies were no longer able to get insurance.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you.
And so they went to the government and they said, we need you to indemnify us. And they did. And so the government absorbed all the lawsuit cases that happened as a result of the Guillain-Barre that happened from then. And so that kind of set a precedent for 1986. So back then, vaccines were just kind of, you know, pieces of microbe, or maybe a live attenuated virus. And then they would
put a background of all kinds of hard things inside of it and tell you it was just a clear, beautiful, pure solution. But that's beside the point. So then 1986 comes along because there's so many lawsuits happening because of the diphtheria pertussis tetanus vaccine. that, again, the vaccine companies couldn't continue to go on the way they were because they were being sued so much.
Welcome to my life.
In the 70s. I believe we're in the 70s.
So then this horrible act was passed, which to some people seemed like a good idea. And this is always how it goes, is we're going to make you this promise. Yes, yes, yes, we're going to cover all the lawsuits now out of taxes, but it's going to be okay because we're going to pay out these lawsuits and you're going to be fine. If your kid takes one for the team, you're going to be okay.
Yeah. Well, the way they were able to get away with it is 226 years worth of propaganda. Because the fact of the matter is that ever since the beginning of smallpox vaccines, there have been vaccine deaths. The reason, and look, we've added, I brought you a special copy. This is a limited edition. In the 10th anniversary edition, we added 200 pages. We added a chapter called The White Plague.
The White Plague is also tuberculosis. Tuberculosis was a side effect of the smallpox vaccine. Tuberculosis rates were rampant. In fact, the inventor of the smallpox vaccine, his child died of tuberculosis and so did his two test subjects that he used. And it was well known to follow smallpox. Lots of doctors talked about it. But in about two or three years after the vaccine was
accepted in England, you hear doctors speaking out about it, cursing the day they ever agreed to do it to people, to children, to anybody. And so what happened is that the government came down harder and started making it mandatory and would take your furniture away and started intimidating the doctors. And that's an age old thing as well.
And I experienced it in any doctor that's ever stepped out of line and said something bad about vaccines will either be intimidated or worse. So 226 years of propaganda. And so I'm just going to give you one example, and I'll give you a copy of this to have, and you can put it up later if you want.
But in 1984, because there was so much going on in terms of the public learning about the problems with the diphtheria, tetanus, pertussis vaccine, and the polio vaccines, that a federal register was issued by the government and went to all Health Department in the United States, which is supposed to have been just kept there and never circulated.
And it said, quote, any doubts whether or not well-founded. about the safety of the vaccination program must not be allowed to exist. That's literally what it said. It's straight out of, you know, Lenin. So you had that, and then you have the changing of the goalposts, and the outright lies within scientism, because it's not science.
And what happens is after time, after they get their foot in the door, they narrow down the... they basically have a kangaroo court that decides if you're eligible. And so the qualification tables got narrowed down because in the beginning they were paying out so much of this.
It's the religion that calls itself science, and we still are a victim of that today. Most science today is sponsored by the very people that are going to profit from it. And I think even look, even Jenner, who invented the smallpox vaccine, never did a scientific study. He never did a controlled study. He never did non-vaccinated people, vaccinated people.
and then expose them to smallpox in a large enough group. He would cowpox them and then expose them to smallpox. And it was well known that smallpox followed cowpox. So it's just been, look, again, I never expected to be here. I just wanted to be a healer. I just wanted to be a doctor. I wanted to be a nephrologist and teach medical students and make the world a better place for people.
That's all I ever wanted. This is a nightmare for me, actually, to – while I've met some incredible people and I've had a really good life and I have no regrets and I would do it all again, no doctor wants to be put in a position where their integrity is doubted, their sanity is doubted. And if you want to pull up a page called – it is called – rational wiki, I think, maybe.
Anyway, I'm considered a Sith Lord. And in fact, I didn't know what a Sith Lord was back then. I had to actually look it up. So I'm like Darth Vader. So it was a bit of a compliment. But on the other hand, most doctors can't tolerate being called quacks or having their reputation destroyed.
And I went from treating the CEO of actually the head of the laboratory at my hospital for hypertension to becoming
you know, somebody that was doubted on every levels after a while because of one thing that I said, which was, can we stop giving vaccines to my sick patients, to people who are having chemotherapy while they're having chemotherapy, to my patient before I've even seen them on the ward? Can we just hold this up and give it to them on the day of discharge? That was my request in the beginning.
That's how this all landed here. And had they not tried to intimidate me, doubt me, and pushed me to research and show that what I saw was actually real, I would still be lockstep working as a regular doctor because there were some good things about it. So look, even if you look at what happened with COVID, let's just look at that. Like how did they pass this off? Look at the media today.
Do you know that they're giving COVID vaccines to six-month-old children now? We know how bad it is. We know that it ruins stem cells in pregnant women. They don't give stem cells to their babies. The industry is upset because the placentas no longer have stem cells. They used to use those stem cells in research and cosmetics, et cetera.
So not only did it make the vaccine companies very, very wealthy and indemnify, but as you alluded to just a minute ago, um, the creativity of the vaccine companies expanded. So after that, they could add different, what we call adjuvants, things that stimulate the immune system. So the vaccine works better.
They're not getting them anymore because of what the COVID shots. to the placentas and those infants. That's not being talked about in the media. Nothing bad about the shots being talked about when we have Kevin McKernan and all these people looking at it going, there's SV40 in it. There was a staphylococcal endotoxin gene. There were two snake genes in there.
You know, it's a definite gain of function. Nope. We got to put it on the vaccine, the baby vaccine schedule. Because any doubts, whether or not well-funded, about the vaccination must not be allowed to exist. That's why.
And it's been gone on.
Three of them. They get three by the certain, you'd have to look up the schedule, but I believe it starts at six months and they get three of them kind of boom, boom, boom. Are doctors really recommending this? It's on the, look, there's a group of people called ACIP, the doctors, usually with vaccine interest in their bank accounts that make the recommendations for the vaccines.
And they've recommended vaccines. that six-month-old. So if your doctor is following the ACIP program, you have to be offered that vaccine. And now that doctor, this is another part of the story, is that doctor's likely to lose $250,000 a year if they don't do that because there's incentive given to
hospitals and doctors, which is what naively I was on the other end of when I woke up in 2008 and said, wait a minute, why are we doing this stuff to my sick, inflamed patients? You're giving more inflammation. It's because the hospital would lose something like $40,000 if they didn't give a vaccine within the first 24 hours of admission.
And they would get $40,000. It was all a money game. That's really the bottom line of it. And I didn't know that until a nurse years ago who was a high-level administration. She said, Suzanne, this is why they did that to you. Oh, wow. Okay. Well, at least it makes sense now.
Well, that's been the case since basically the medical profession was infiltrated in the early 1900s by high-level interests that didn't want us thinking for ourselves and carrying on with the natural cures that actually work. carrying on with normal midwifery.
There was just so many changes that happened as a result of best practice medicine, not to mention the forming of the AMA by a couple of real quacks. That's a really good story. And the AMA would give their stamp of approval. So say you created an infant formula, well, it would say AMA approved, and your infant formula would sell even better. Remember when doctors smoked camels?
Uh, then they start, that's why we're able to be in a messenger RNA vaccine situation today, which, which that wouldn't have happened if it weren't for this indemnification that, you know, the vaccine trials have always been a bit of a joke, but they're even more of a joke today than they were in the beginning. We've never seen a vaccinated unvaccinated, um,
Because camels were best.
Well, first Rockefeller, I think oil was one of their primary investments. So that's the pharmaceutical aspect of it. That's right.
Oh, so you want to talk about the school system.
You want to know the irony? It's crazy. It kind of works. Yeah. I got rid of a really bad case of mange in a dog by kerosene, putting kerosene diluted in olive oil. And they had been through everything. They could not get rid of this mange on this beautiful dog.
That's crazy that that worked. It was a cane corso dog.
Really bad. But one spray, it was done.
You have to keep careful around the flames and stuff.
No, it can't. Joe, come on. You had to have an expert help you. No kerosene, no nothing, just love.
Food and love. That was an argument I had in a hallway once with the senior— chief of medicine, he was like, he would always say, so how are you today? And normally be like, good, you know, superficial confidence. I said, by the way, I'm having real trouble with, you know, the H1N1 vaccine. My patient's getting kidney failure after getting it. And he turned dark on me. I never saw him dark before.
And he said, no, they just didn't have time to take effect. And of course, then I heard every kind of soundbite in the book from him, which I didn't know were soundbites at the time. And then he said, well, what do you think has happened with meningitis in these college kids? I'm like, oh, come on. That's a total no-brainer. It's like their nutrition goes down the tubes when they leave home.
They're smoking. They're staying up all night long. They're hanging out with their pals. They're doing everything they couldn't do when they were at home. Oh, you've got to be kidding me. So you think it's their food that's causing problems? And I was like, well, what medical school did you go to? Like I was actually taught that nutrition matters and how it matters and why it matters.
But that's been almost completely – like if you want to sneak vitamin C into somebody's hospital room, you know the best way to do it? Don't bring in a jar of vitamin C because they will stop that at the door. You get yourself a McDonald's milkshake or a burger. And you just dump that milkshake out and you put something else in there, a smoothie with some vitamin C, and they will say, off you go.
That's perfectly fine. That's going to be great for this person, this child. That's how you can get it in because they think that McDonald's is wonderful. In fact, McDonald's are kind of situated proximal to a lot of hospitals and the McDonald's, Ronald McDonald houses are there and everything else.
But bring in a homeopathic or, you know, magnesium or vitamin C and you've got to get permission for it and go through so much red tape and a lot of time you'll be told.
study that is accepted by the powers that be as good enough. The vaccinated unvaccinated studies that they have, they use another vaccine for. You probably know that. So if you're testing a measles vaccine, you could test it against a diphtheria vaccine or a flu shot vaccine is tested against a hepatitis A vaccine.
No, you can't give it because, oh, you'll cause bowel necrosis, you'll cause diarrhea, you'll cause kidney stones, everything in the book that doesn't actually happen with vitamin C. Look, they've measured vitamin C levels on people that enter hospitals, and pretty much everybody's deficient or on the border of deficient when they enter, and pretty much everybody when they leave has got borderline scurvy.
If not full scurvy. Fortunately, they go home and start doing other things and can rebuild some of their vitamin C scores. But there's a lot of subclinical scurvy walking around out there. And those are the people that are going to do the worst with the vaccine and they're going to do the worst with the actual disease.
Well, you know, it's not just the poor diet. So any kind of stress will consume vitamin C. A cigarette will consume 75 milligrams of vitamin C. And they tell you that you only need 190 milligrams a day. That's the FDA requirement.
So you just have a few cigarettes and you've depleted your stores. We don't make our own vitamin C as humans. Humans and guinea pigs, we don't do that. And so we have to consume it. And we're reliant upon our fruits and vegetables or supplements to do it. Or if you eat organ meat, you can eat the adrenals that are loaded with it.
But aside from that, it's your fruits and vegetables that are going to give it to you. So if you're under a lot of stress or you're taking medication or you have a lot of inflammation or arthritis, whatever, that's going to consume vitamin C. Because vitamin C is an antioxidant as well as an antiviral and good for your nervous system. So yeah, most people are walking around skimming the edge.
You can see kind of a red line on some people's gums. They're probably vitamin C deficient. If your gums are bleeding a lot when you floss, you probably need some vitamin C. And, you know, you could have an infection, too, but it will deal to the infection as well as the integrity and the collagen inside of your bones and your soft tissues.
I mean, it's it's like one of those things that's so important. It should be given upon admission to every hospital.
Probably not enough. Not enough.
And you're a hippie if you want to just eat kiwi fruits and get your vitamin C from that or have oranges or broccoli. Oh, my gosh. Broccoli makes you a total hippie. Or kale. Yeah. Forget about it.
Now, see, we have a different kind of malnutrition today than we describe in the book. Back then it was people were toxic from basically drinking poop water and being worked to death and having diseases all around them. And so they were protein calorie malnutrition people. as well as vitamin as well.
There's no saline placebo because the few studies that exist with saline placebos show how bad the vaccine actually is and how it makes you not only not respond to the disease when it comes around, but more susceptible to it in many cases.
Today, we have kind of disnutrition, you know, like DYS, disnutrition, and that everyone's fat, so they don't really look malnourished. Pretty much, you know, you go on a cruise or you go to the beach. Even skinny people have big bellies now. Big belly is the thing. What was that?
Who's that? That's my friend. Okay, hi, Bert. He's going to hate that you don't know who he is.
But so today we've got inflamed guts from glyphosate and the wheat that's been altered to make us inflamed and then just the chemicals that are added to our food and the vitamins that actually don't help us and set us back that are fortifying our bread and milk, lack of vitamin D. So we have a different kind of a problem, but essentially causing the same bodily dysfunction.
Yeah. You think, oh, maybe it's just the high carbs, but you just proved that it wasn't because in Italy you were okay with it.
Waiting for the hit. Never came.
Yeah. Bread in Scandinavia, same.
People don't know that. What's that?
It is. Like, real food, real cream.
It is interesting.
Yeah. Yeah. I kind of agree. Like I'm not gluten sensitive, but I definitely feel more awake when I don't have it.
It's good on holiday or when you want to go to sleep. But it's so delicious. I know. I know.
The question of the century, isn't it? Okay, now we have to back up a minute because... I had that same question, and I had to go dig deep. To all the questions you have in your head right now, I had them too at one point.
Add some arsenic and it'd be great.
Thank you for smoking.
Well, you know, there's something to that because, you know, about the nicotinic receptors and, you know, the smokers got less COVID than the rest of us. And I did hear about that.
What happens? So the spike of COVID is the evil part of COVID. has all these horrible lab-engineered proteins encoded into them. Two of them are snake toxin proteins that bind onto your nicotinic receptors. So if you can smoke nicotine or take nicotine gum, then you're going to block those receptors up so you can trade off some of the stuff that's from the spike.
Yes, like that would probably – if you're having long COVID or any kind of post-COVID syndrome that's related to the nicotinic receptors, you only know by trying it. But listen, I always say start small. Don't go out and be a hero and take a whole dose at once. Start with a quarter of whatever it says and wait and see what happens.
Because nicotine is a powerful drug. Try a cigar.
Yeah. Well, I mean, I've been around. I did a tour one time and there were two heavy, heavy smokers on the bus with me. And they were the only two people that didn't come down with whatever flu with all the rest of us got. Not even that flu couldn't even live in their throats.
So here I am, a medical doctor, working in the field, believing in pretty much everything I was told, giving hundreds if not thousands of vaccines out to my patients, hepatitis B vaccines in particular, flu shots for sure. I was a nephrologist, kidney specialist, and dialysis, etc., And initially, you know, we all kind of have an aversion to needles. I think it's a natural human aversion.
Well, it changes the polarity of your mucous membranes, the charge of the cells on your mucous membranes. And that's probably part of why even the viruses can't adhere properly.
No, we're not at all.
But if you are, they should be non-cured, naturally cured, non-chemical. Oh, like American Spirits? Yes.
I get all my smoking friends to convert to that brand.
Totally. Oh, come on. Are you kidding me? You know how many horrible carcinogens there are? Do you know back in the native days when they were smoking and people were smoking natural cigarettes, it was almost unheard of for them to develop lung cancer with a natural tobacco? Right.
They're absolutely wrong. It is.
Don't you love the packages that have the people spitting up blood on the packages and stuff? Do you see them, right?
No, they have it now.
Do they not have it? They used to have it in America.
That's right. That's where I first saw it. But it's moved to the rest of the world. I know, it's hilarious. It's like, can they still buy them and smoke them?
I just wrote down SV40 while you were talking. And I'm just going to give you an example of what you're saying is correct. The fact of the matter is that all cancers in humanity have gone up since the inception of vaccination. And my opinion, my educated opinion, is that our lifespan should be 120 years.
And I think with the knowledge that we have and the wealth that we have on this planet, the ingenuity we have on this planet, we should be able to be touching the 120-year mark. more commonly than we do. So when vaccines started coming into humanity, we started introducing animal disease into humanity through the skin.
And then we started doing intermuscular injections after the hypodermic needle was created. And then you started having deeper injections of animal disease and of chemicals and mercuries and things like that. So along comes polio research and the polio vaccine, even to this day, is made on African green monkey kidney cells.
Now, the African green monkey kidneys early on were basically taken out of their wild habitat in India and millions of monkeys were brought to the USA for use. Unbeknownst to them. And discovered by a scientist named Dr. Bernice Eddy is that there was a cancer-causing entity inside of the substrate that they were using to make the vaccine on the Petri dishes.
And that entity was simianvirus 40, SV40, called SV40 because before there were 39 others discovered before it. Now we're up over 100. So... That information was suppressed heavily. Bernice Eddy was offered a ticket to wherever she wanted to go and as much money as she wanted, and she said, no, I'm staying.
So when we're kids, we don't know what's going on. I want to go get my vaccines. You know, OK, fine. Sore arm. You get over it. Most of us were lucky enough to get over it. So by the time the first instance of. problem occurred in front of my eyes, I was already a fully seasoned professor of medicine, you know, working in a tertiary care medical center. Okay. And so it's been a bit of a process.
Long story short is they just kept taking her away from her work and distracting her, and there was another doctor, J. Anthony Morris, as well. Anyway, so SB40 was around, and then Maurice Hilleman validated it later and said it came from the African green monkey kidneys. Now, it's benign in the African green monkey, SB40. It is not benign in human beings.
In human beings, it was called the perfect war machine by Dr. Michelle Carboni, who was one of the primary researchers looking at the carcinogenic potential of simian virus 40. So simian virus 40 would have been in the live polio vaccines because there was nothing to kill it. But it was most likely also in the killed.
And African green monkey cells are actually still a listed ingredient on vaccines. So you can go ahead and look that up. It's a fact. So how this affects me is that I'm a kidney specialist. And I looked at the curve of kidney cancers that have gone up. since the inception of polio vaccines and SV40 introduction.
So what this virus does, it enhances two cancer-promoting genes, and it inhibits two cancer suppressors, okay? That's why it's called the perfect war machine. So that was in the vaccines that were injected. And so the bad news is that we don't need vaccines to give it to us anymore because we're going to give it to each other forever and it's never going anywhere.
That was introduced to humanity like a lot of other diseases were through vaccination. We can give it to our kids. We can give it to each other. It comes out in the urine. And so it lives in the green monkey kidneys. It lives in our kidneys. As a kidney specialist, there are a lot of mysterious diseases.
Lo and behold, there was some research into some of them, and the research was just put – this is the other thing. The research that's really important just gets killed. The funding gets killed. In terms of SV40 kidney cancers, there's no doubt that the rate of kidney cancers has gone up alongside with the infection rate of humanity for SV40, as well as diseases like glomerulonephritis –
which they do find the pathogen genetic material inside. And even in the old days, they found it in the tumors but not the surrounding areas. So that just tells you that it was a stimulant for the tumor cells to just start propagating. So that's just one of the things that – that's just one of many, many of the obvious ones. And even though it's been well-defined in the medical literature –
you will still see that they only admit that it causes mesotheliomas and one other thing, not that it causes all the other things that it does, that it's been shown to cause in the other medical literature that got its funding revoked.
We probably both have it. Most of us probably have had it one time or other, whether it's lying dormant in our kidneys. Everything depends on your background immunity, which depends on what you're doing for fun and not fun and how you're eating and how much you're sleeping, et cetera, how much sun you're getting, sweating. Sweating gets rid of a lot of stuff. It's really good to sweat.
Oh, it's the same thing. It's not going to make much difference in terms. It'll gravitate to your kidneys. Obviously, it probably goes to lung as well. Brain tumors were a big problem with it back in the polio days. Dr. Michelle Carboni was looking at the brain tumors with that. There's a really good book called The Virus and the Vaccine by Bookchin and Schumacher.
It's an incredible book that details everything about those years, the scientists involved. the suppression, the oppression, the lies, the skullduggery. Then they would bring in the scientist who had no experience in actually detecting SV40, and lo and behold, he couldn't find it. And he was the one that got to make the ultimate statement on whether SV40 causes human disease or not.
Because for me, it was the influenza vaccines in 2008, 2009, that showed me without a doubt that vaccines can and do cause kidney failure and put people on dialysis, that that does happen. It can cause hypertension. So we're not told to take a vaccine history in medical school. We're not told to even look there. It's not even part of, especially in adults.
Oh, and the stocks that contained SV40 were still... basically being used by the vaccine manufacturers up into the 1990s and probably beyond because there's two different kinds of SV40. You're making me remember a whole bunch of things that I thought I forgot. But there's the fast dividing and there's the slow dividing. There's two different kind of strains of it.
And the original test, so when they made a vaccine, they would test it for 14 days looking for SV40. If it didn't have it, off you went and your vaccine was good to go. But The problem is there was a slower dividing SV40 that remained in the vaccines that were injected and probably in the stocks. The stock is basically like your mother tincture or whatever.
It's what you use to kind of inoculate all the new batches over time. And so the stocks were found. That's, again, quote Dr. Attorney Stanley Kopp's quote in the book about the SV40 still being in the stock market.
up and through the 1990s and you know god only knows if there's if it's still if they're still using those same stocks i don't know because i haven't gone into the to the more modern times of sv40 but yeah we all have it and there's no doubt in my mind that it's just like another one of the things that the parasites have finally pretty much put into us to set us back demons
Well, they'll say that it was just an unfortunate set of events. that happened because they took wild monkeys from India. See, I could work for them. That's their excuse. And they say, we cleaned it up. You know, we started our own monkey colonies and we started breeding our own monkey colonies that were now found to be free of SV40.
The only problem with that is that, as I said, they had already inoculated humanity. And it's with a virus that can be spread vertically and horizontally, as the scientists would describe, meaning we've all given it to each other. I think there are going to be very few people walking around today that haven't been introduced to it.
Yeah, that's what I'm talking about. That's what I did is I, in one of my videos, I did that and looked at the cancer rates since they were, you know, so again, what they'll say is, well, we just didn't look at the rates beforehand, but the rates were quite low before. You can know what the surgical, what the nephrectomies were.
So it's kind of an easy thing to look at because that's the treatment for kidney cancer. You take the kidney out. Because you've got another kidney and it's a slow-growing tumor, even though it can metastasize. But anyway, I did look. And the rate has skyrocketed for kidney cancers. Pretty much everybody knows somebody who had a kidney cancer.
No. And also these protein-losing diseases, which is, again, it's not controversial. It was documented when they looked at the areas that were affected in the kidney with this horrible disease that makes people lose the proteins that need to stay in their blood, in their body, out into their urine. that the SV40 was related to that.
It's called focal and segmental glomerulosclerosis, and it's a real problematic disease in children and adults. Ultimately, you have to go on horrible chemotherapy drugs that ruin your immune system, and then transplantation if you can't stay on top of it. Big moneymaker. Now, do I think that that was the purpose? Look, I don't know what was in the hearts and minds.
But when I did start looking there, I started to see more and more associations. Let's just put it that way. And so first I had to go down the flu vaccine bunny trail. And every time I went down that flu vaccine bunny trail, guess what I was asked? What about polio?
I don't know what was accidental and what wasn't. But I do know that there was intentional suppression of the truth. Any doubts, whether or not well-funded, must not be allowed to exist. That is a fact, and it's always been that way. And there have been scientists and doctors talking about that since the beginning of vaccination.
Yeah. It's kind of a childlike situation that humanity and most of humanity is in is that, you know, I think most people are good and they want to believe everybody else is good. And they want to believe that the government is looking out for them. And it's a really it's a kind of horrifying. Imagine if it was true that your government actually wasn't looking out for you.
And that might be one of the causes of your decreasing lifespan. Imagine that if the government might not care so much if your baby ends up with no stem cells or your baby gets cancer or autism, which will be outright. And I mean, look at autism. Hello. Like, do we how many? I mean, we're to start with that.
But that was another thing where there was no doubt whether or not well-funded allowed to exist. What came to autism and every autistic parent, parent of an autistic child will tell you this. Everyone has tried to lobby and get to the truth with autism will tell you that the brick walls and the plexiglass and the lead walls are. that went down were intense and still are intense.
And the lying studies that they use to uphold vaccines don't cause autism are so easy to dismantle. But you know, Joe, you know, the lie gets around the earth three times before the truth has a chance to get out of bed. And that's just pretty much what happens when the media is owned. And like, you're like one of the cracks in the matrix here, quite frankly.
So I thought, all right, even though this has absolutely zero to do with polio because I'm watching people crap out in front of me after influenza vaccines, let's see about polio. Because I knew very little about polio, just like most people walking around out there do, that, you know, it was invented by this guy named Jonas Salk and it saved humanity.
Thank you. Thank you. Thank you. Thank you. Thank you.
We don't see these little crippled kids anymore. We don't have iron lungs anymore. Yay. Well, I would have to say that the polio bunny trail was the darkest one of all. And so after polio then became smallpox. And I thought, you know, we still have people walking the earth that have experienced the polio years.
So I kind of like to stick to polio because most of the smallpox, you know, people that would have been familiar with it are off the planet. But there's still some doctors around that'll talk about smallpox. The guy named Thomas Mack, who's probably close to 90, who was kind of ground zero in the 1940s and knows a lot about it and still says we shouldn't be vaccinating for smallpox today.
Thank you. Thank you. Thank you. Thank you.
But it will show that you have had an experience inside of your body with COVID.
So then there was that. And then everyone and their dog was talking about autism. And I didn't really want to have anything to do with autism because I was an adult doctor.
And this will stop it from you getting it.
How was that? How close was that to the time you said you felt a little tired in the gym that day?
OK, a few months.
You're supposed to be fearful, you know.
He's ruining the world's immunity. Well, I had the same thing. Like, you know, when I was first waking up, I had a friend who had unvaccinated kids that were part of a Steiner school. And they were like mutant freaks to me because they had never been on an antibiotic. They were like bright and happy and interactive and talented kids.
And at one point, one of them was playing with a hammer and nail. And I said to her mother, I was like, you got to be careful because she doesn't have a tetanus vaccine. And someone in the room said, well, Suzanne, what do you know about tetanus? And like in my head, I'm a full-fledged doctor at this point. I thought, I don't know anything about tetanus.
And outside I said, I know you don't want to get it. And I know it'll cause lockjaw. And then I started reading about tetanus and I had to go back and, you know, kind of apologize. And then I did a big video. I have a big video out on tetanus and the actual
truth about the tetanus vaccines and actual tetanus which you know that's even harder for most people like most people who don't want to vaccinate their kids they'll vaccinate for tetanus if they can get a single shot and second only to polio everybody's got their two vaccines that they're their two diseases they're afraid of for their kid that makes them feel like they're at least doing something well the polio one always gets thrown in my face yeah they say it all all the time about polio yeah and i just go i don't have the time to do this
Thank you. Read the book.
Well, they started killing dogs. You know, in New York, in that incidence I told you about where the vaccine, the gain-of-function strain escaped, people were throwing their cats out the window. Some 20,000 cats in New York City were killed during that time because there was a belief that cats spread the disease.
Yeah. Cinnamon is a powerful herb, actually, and it's known to be helpful in glucose handling for a lot of diabetics taking it in capsule form now. I noticed at the end of my nephrology career. that a lot of my own patients were taking cinnamon capsules. But it also has a lot of vitamin C in it, and I think that was probably one of the keys.
Wound-up. It was basically a natural virus that got kind of wound up by humans.
You're not allowed to cure it. Look, I was living in a country where... The government said there's no cure for COVID, there is no treatment for it, and there is no prevention for it except a vaccine.
And lo and behold, we found out that there was a contract between the government and the pharmaceutical industry to have the emergency use of the vaccine trial on the population only under the condition that there is no other treatment available. And that's why the treatments were shut down.
Because emergency use, there has to be no other treatment available. If you have ivermectin or if you have zinc and all the other things that we use with success. You know, there were so many people that I treated that should have been dead. I gave COVID to a 95-year-old woman who had chronic lung disease called bronchiectasis. She should have been the low-hanging fruit.
I was starting to feel a little bit unhappy one day, really just sluggish, like you mentioned. And when I was done seeing her, she goes, I just want to give you a hug. And she came over and I was going, oh, no. And after about three days, I was like, I've definitely got it. I tested and I rang her daughter. And I said, I've got to tell you, I was exposed. Margie was exposed to blah, blah, blah.
And she's like, yeah, mom's not feeling so good right now. And then two weeks later, I thought, I've got to call back again. I've got to make sure this lady's OK. She said, oh, no, mom's out at the hairdresser getting her hair done. Two weeks later, I still wasn't recovered. Two weeks later, she was out getting her hair done. Was she a smoker? She probably used to. I don't know.
She can't remember that detail. But there was my senior partner had leukemia. He should have been absolutely, absolutely dead. Well, not on my watch. He wasn't going to be dead. So he survived the entire thing and died like two years later of something else.
You're not allowed to have a healthy immune system.
It depends. I get maybe what state you live in.
Yeah, it could be because you still have your teenagers and your young college students that are in sports and things like that. A lot of older people are more.
Yeah, and what supplements and how, you know, sometimes you can overdo. You do a hair mineral analysis on people, and sometimes you find things that are, you know, pretty shocking in terms of that came from supplements. You know, you can overdo it with even selenium.
You can end up with big problems.
So they didn't clean their bins.
Well, I also, it's not what I think, because that's the thing. Like, look, when I got into this, I didn't say, oh, you know, I want to argue that vaccines are great. I said, look, I don't care. I didn't have skin in the game. I didn't have vaccine injured kids. I couldn't have cared less about it, essentially, except that it was something in front of me and didn't make sense. So I thought.
We're talking about adults here, presumably, but one of the facts is that the foundation that your immune system is created and developed in is probably, if not as more important than that, and that is
being born, vaginal birth versus a C-section, not putting down people who've had C-section, I'm just saying the science shows that there is a distinct difference in C-section babies' immune systems versus non-C-section. There's a distinct difference in breastfed babies versus non-breastfed.
And there's a distinct difference in babies whose mothers have a healthy diet and breastfeed versus mothers who don't have a healthy diet and breastfeed. So that foundation actually makes your gut grow normally, which is a large part of your immune system.
It colonizes your gut because the bacteria from your mother's gut goes into your gut, goes from her gut through her lymph system into her breast and then to your gut. And so all that foundational stuff is something not to be ignored because it's going to make you deal with diseases better. And if you have to get vaccinated, it's going to make you deal with vaccines better, even as a child.
Not that I'm in favor of that, but I'm just saying, if you want to set things up as solidly as possible to be able to take that insult The problem is we don't know 20, 30, 40 years later what the associations are between bone diseases, skin diseases, cancers, autoimmune diseases. We have some clues. I have some clues that nobody wants to look at.
But we've got this long-term problem that nobody looks at.
long-term effects of lifestyle of vaccination of even sv40 there was one study that started tracking a thousand sv40 people that they knew were infected with sv40 looking for diseases later in life and they stopped it after 19 years again axed when they still had over 700 people left in the study because they said too much time had gone by well the fact of the matter is that's when the study should have started 17 to 20 years later is when they sort of started looking at that point
Not one year, two years. But, you know, most vaccine trials and drug trials, they don't they don't vaccine trials. It's like two weeks is almost a miracle for someone to follow out that long. Forget about looking months or years later. Doesn't happen.
Well, you know, it was a bit of a process if you want to know it.
Yeah. So what first happened is I kept getting challenged while I was I stayed on for two years as a nephrologist in my hospital. So I wasn't kicked out. I left because like my soul just couldn't hang out there anymore. And so during that time, even though I was kind of ostracized behind my back, everybody still respected me as a nephrologist, but I still had to go.
And in that time, I started doing public appearances. Like I went on the Gary Null show and started doing things like that, just talking about smallpox and polio because those were my focus because everyone's saying, what about smallpox? What about polio? And then when I started finding out, I just, I became obsessed with it. It was so interesting.
Wherever the truth falls, that's what I'm going to talk about. So what I say is that what the facts line up to show you is that polio is still here. Polio is still alive and well. Polio is called different things today. Whereas back in the 1940s, 1950s, the criteria for diagnosing polio were completely different to the year that the vaccine was introduced.
So I was morbidly fascinated by the whole thing and about how Everything I found was absolutely contrary to what the mainstream dogma is. And what I had was a mountain, you know, pile high to the ceiling and they had soundbites. They had nothing to fight back with me on. Nothing. Um, so, um, this guy named Roman Bistrianic heard me on the radio show and he, he rung my office.
And after his third call, I was like, I guess I better call this guy back. And, um, And he had this idea for a book. And he had done all the charts and the graphics and started writing the narrative around that of what the historical document showed. And then I came in as kind of the medical person that was obsessed with polio and smallpox and happened to know quite a bit about pertussis.
So we started writing the book together. And there's probably about There's got to be if you were to take a full time job 20 years, at least 20 years. But for me, it was condensed because I became obsessed after I quit my job. All I did, I basically had no money. I lived in a tent with a pop up camper. That was my office. And I was like crazy Ted Kaczynski obsessed with polio in my tent.
And so, no, I didn't have apprehension. I was like, this information, it's been so, the U.S. Polio Surveillance Unit charts were supposed to be available in libraries. Lo and behold, every library I went to to find them, I was told they're not here. There's only one library, the AMA library, and you have to have special high security clearance to look at them.
Well, I won't say how, but I got a hold of them. And what those documents show is that it wasn't just Cutter Laboratories that had a problem with live polio. It wasn't just Wyeth. We didn't talk about this, but all the vaccine companies had a problem with live virus in their injectable vaccines during Salk's year.
So 1954, 1955, up to 1959, they all were producing vaccine with live virus in it because Salk wouldn't listen to the scientists abroad who were saying his inactivation curve was where the sun doesn't shine. So that beginning of that and just tracking all that down and asking the questions that you asked, well, where did polio go? What was really causing the paralysis? Why don't we see it today?
Like I had to answer all those questions and every question I answered It was so satisfying that I just wanted to go on to the next question. And so there was never any hesitation because I just actually I was so single minded that I didn't think about, you know, the threats that could happen as a result of that. And it wasn't until after the book was out that the threats happened.
And I'm still here. And look, I figure if anybody wants to do me and now the timing is really bad because this is pretty much out there now.
Yeah, so did I. So many of our childhood fables turn out not to be true. But that was a big one. And it's still hard for a lot of people to believe. But I just think it's like anything, like if you're open to different information. And I always say, look, I can make mistakes. I'm not infallible. Someone has actually found a mistake in the book. I actually went in and corrected it.
That's the difference between me and these other people. is that if I made a mistake, I want to know about it, and I will go and make it right, and I will publicly admit that I made a mistake. But I will say that 99.9% of what's in this book is true, factual, and provable. And because I've done the research, but it's a hard thing to do. What doctor is going to quit their job? I was lucky.
I didn't have kids. I didn't have – You know, medical royalty ancestors who would have been disappointed in me. I came from nothing. I wasn't afraid to go back to nothing. And so that's why I was willing to live in a tent until this thing was done and published in 2013. So how long did it take you? I started working on it. Roman had been working on it for years.
The playing field, the goalposts, everything was changed so that despite the fact that there was more paralytic polio in the years after that vaccine was introduced, they were able to show a complete cascading drop of paralytic polio simply because of the way they changed the definitions of what polio is and what could cause it.
He had been going to libraries because his kids got hit hard by an ex-wife who jabbed them. He didn't know about it and they got really sick. And then he started looking at old graphs and going, oh, that doesn't make sense. So he got obsessed in his own way with the numbers. He's the numbers guy. And so he had been working on it.
And then the two of us together worked on it probably from 2009 to 2013. And then it was published in 2013. We couldn't find a publisher. Even the alternative publishers didn't want anything to do with it. So we self-published. And then after it was successful, guess who wanted to publish our book? And I was like, nope, sorry. We're going to carry on the way we are.
Oh, but you're going to get such more credibility. It's like unlikely.
If you give us most of your profits.
We'll give you $1 a book. Wow.
Self-published. It's all lies.
What's that there? Forbidden Science.
A long time ago. A long time ago.
I think similar threads would run through his experience, definitely. Oh, I'm sure. Forbidden science.
That's enough. That's it.
And they started testing for the virus, where before they would never test for the virus.
You're going to get it big time. I've gotten it already. They'll start picking apart my facts and they'll want to come on and dismantle. This is what always happens. I come in first. I tell my story.
And then they bring in the experts who are able to take without me being in the room, of course, because I can't be able to defend myself and then let the public believe that everything I said was just one big sack of lies.
Not that I can recall.
Yeah. I have to say I'm not that interested in doing that because I just feel like debate is an actual skill to be a debater. People study debate and people get really good at it. I'm not a debater. If somebody wanted to debate me in writing, I would be happy to do that because then I could sit there and take my time, go through the references that I needed rather than having to –
And when they started testing for the virus later, what they would find that people had Guillain-Barre syndrome, they didn't have virus, or they had Coxsackie virus or echo virus, or they were lead poisoned or mercury poisoned, which was the mercury and lead were the leading treatments of the day, including bloodletting.
You know, have the artillery ready, you know, at me without having a shield. Right.
But I would do it only if we had a topic that was, you know... basically agreed upon beforehand that we could both upskill on and use what we know as that debate point. But it usually just becomes character assassination.
Well, just like in sports, it's the same here. It's like cheating is for losers. If you're a winner, you don't have to cheat. And that's the same with them. Like if their product is so wonderful that everybody needs it so badly, then why is there such – what they say is that we're too stupid to understand how they're saving our lives and how they –
This is one of the big arguments that we really ought to touch on, is that they say that our lifespan has improved as a result of medical interventions. When what we show in here, what other scientists have shown, is that it's about 3.5% of... The contribution from medicine goes into our extended lifespan, 3.5% based on antibiotics, vaccines, et cetera.
The rest of it was all about the revolution, the health revolution, the clean water, the shelter, the electricity, the child labor laws ending. So, you know, the magic of medicine is not what people think, and it really traps a lot of people. Like, I think there's a value to the medical field in terms of surgery and certain drugs, and if you have an organ failure, like, absolutely. But why not?
Like, my Hippocratic Oath said that I should consult, you know, any consultant that will help my patient and keep the well-being of my patient stable. Well, to me, that includes, you know, using every therapy that is available The most benign therapies possible first.
The ones that work along with the blueprint of a human body, that go along with the theory of health rather than pounding down disease. You're always going to get a better result that way, assuming you've got time and you haven't waited until the last minute.
Well, that's the big thing. And the other thing is people trust what they see on the television. CNN was my go-to thing for the longest time. Yeah. And now I look at it and I think, oh, my goodness. You know what cracked it for me is when they publicly – villainized Andy Wakefield. And I actually knew the story behind Andy Wakefield at the time. What was that story?
They were literally blowing smoke up people's butts. Like that's where the term comes from. Because if you want to Google that now, you'll see that there's an instrument that does it. So the polio story, where to even begin. And so there's about 70 pages. And so that became my obsession. So. When people said, what about polio? And I started digging this up. I went deep into it.
The story behind him is that he was the doctor you'll hear. He was publicly shamed. His license was removed. He published an article about what he called toxic nodular enterocolitis in children with autism. He was a gastroenterologist, a very high-level, very well-respected, decorated gastroenterologist. And he published this paper, which remained in the journal for 12 years.
And all it said at the end was further research needs to be done in order to see if there is any real connection between the MMR vaccine, autism, and toxic nodular enterocolitis. These kids suffer with horrible bowel disease. It's not just brain disease.
And so he was about to publish another paper showing that in this certain type of monkeys that were vaccinated against hepatitis B lost a lot of their reflexes and had problems. And it was on the eve of the publication of that paper that his original paper was revoked. And ever since then, he has been the poster child for vaccine nonsense, for anti-vax crazy people.
And, in fact, every time I've done anything, his name – funny that I brought his name up. I love him. He's a great guy. But his name would always come up. Well, you're a friend of Andy Wakefield. No, Andy Wakefield because autism and vaccines has been – debunked because Andy Wakefield lied. He didn't lie. All he said is, I did biopsies, I saw this, and this is possibly a connection.
And since then, other scientists have come in, done the same thing, biopsies. Then they looked at whether the vaccine virus was in that biopsy, and it was. It wasn't a wild virus. It was the vaccine virus in that area, not the surrounding area. So there is a relationship between gut disease, MMR vaccine, retained, you know,
virus that hasn't been processed properly because it didn't come into your body properly, and disease, brain disease. So that's a fact. But CNN did a hit job on Andy Wakefield. And I remember going, huh, well, what's going on here? Because I know what happened with that whole situation. Now, CNN is saying this. And that was kind of when the windscreen cracked for me.
And I just had to start questioning anything. And then you've got the doctors that go on there. There are a couple of doctors. I think you interviewed one of them, didn't you? I
Yeah. Yeah. There was a guy before him and some of the stuff he said was pretty unbelievable. That's what the public is going to hear. You know, your best chances of dealing with this is to just get the vaccine. You don't want to get shingles. Get that vaccine. Never mind the whole other truth around that, because like you say, it's the advertisers, but it's bigger than that.
What do you think about giving yourself a vaccine for something you already have? Like, you think about it. Like, chicken pox is a disease that we all got as kids. You got it as a kid, probably. You're kind of superhuman, though. You didn't even get COVID. I got it eventually. You did, yeah. So I got it eventually. It broke you down. But I got chicken pox really bad.
Yeah, there you go. Back in the old days, we would all get chicken pox and then we'd be exposed to other kids that had chicken pox.
Yeah, people do. They still do that. I didn't have to. I got it somehow. I don't know how I got it. Probably from my brother. And so you have this virus lays dormant in your body until your immune system breaks down. So but part of it is not just your immune system breakdown. It's the fact that all these kids are now vaccinated and the circulation of the disease.
See, some vaccines work in terms of they stop the circulation of the disease, but add a detriment to us. So it's been a detriment for measles and it's been a detriment for chickenpox. So chickenpox, we used to get continuous. You didn't have adults didn't get shingles. It was very rare for adults to get shingles. before the chickenpox vaccine came out. Extremely rare.
But since then, the rate of shingles in adults and children has skyrocketed because we're no longer getting our boosters being exposed to the circulating microbes. So now the solution to that is to give adults like four times the dose of the childhood chickenpox in an injectable vaccine against something that they already have.
Yes. Yes. You have to dive into pesticides because the tonnage of production of DDT absolutely mirrored the diagnosis for polio in the days. And the countries that still make DDT today is where we're still seeing this paralytic polio situation happen.
And so the theory is that you're going to ramp up your antibodies and then you're going to be able to do battle if your viruses come out again. The only problem with that is that the problem is the immune system. If you get AIDS or you're on chemotherapy, your chances of that happening are really high. And yeah, does the vaccine work or not? I don't know.
But I just don't think it's just to me just a completely strange concept to inject myself with something that I already have, along with all the other excipients and compounds that go in a vaccine that nobody wants to talk about either.
Well, in terms of the COVID vaccine, you just needed a pile of crap, actually, because it's made on E. coli cells. And that's where you find E. coli. So with a lot of the other vaccines, you do need living. Like for tetanus, you need rotten meat. That's how the tetanus vaccine is made, with rotten meat.
Yeah. Yeah. Big wake-up call with tetanus. So, you know, what we see, if anyone's worried about tetanus, what we're shown is a picture of a soldier from, like, the 1800s with his— He's naked and his back is arched. If you just Google tetanus right now and you look for images, you'll get this image. And so that's what we're told will happen if we get tetanus. It's a sure thing.
You're just going to get tetanus and you're going to die. Well, the fact of the matter is that when I started doing my deep dive in World War I, look, it was fought in the trenches with horses. That's where you get tetanus from ruminant animals. It lives in their gut and then it goes in the soil and it's just a spore. It doesn't do anything until it gets into an area that doesn't have oxygen.
So you get a cut. You get a surgeon to close you up real nice without cleaning it out properly. And you're a setup for tetanus, which will transform from a spore to a different kind of a microbe and start releasing a toxin that can, it first starts as numbness, usually in that limb.
The extreme case is in that soldier who would have been malnourished, stressed out, probably vaccinated for smallpox before he hit the fields. and exposed to enormous amounts of tetanus, possibly gunshot wound or a slice somewhere, and then sewn up. So, yeah, his nervous system could have had a real big dose of toxin, and nobody did anything about it. That's the worst-case scenario.
You don't want that to happen. But in today's – I've treated tetanus. Let's just put it that way. I've treated several cases of tetanus. One of the cases was a neurologically diagnosed tetanus. So tetanus is treatable. You can get on it early.
Rabbit studies have shown that if you give vitamin C, if you have a good high vitamin C level before you put glass with tetanus spores on it inside the skin of a rabbit, that you can prevent the tetanus from happening. Even if you give the vitamin C at the time of the injury, you can prevent it from happening. If you give it after the event, the death rate goes down to very, very low, if not zero.
The first cases of polio, yes.
So vitamin C is a main factor, but the biggest factor is cleaning a wound and keeping the wound open if you think it's a dirty wound and not to close it straight up, which is why nails, you say stepping on a nail is the classic because rust can kind of hold the old spores inside of it. You step on the nail, you get inoculated, and then you wait for it to heal over.
You have to open that wound if that's going to happen. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Yes, it was out in the countryside. Well, that was probably more because of the sheep and cow dipping. So arsenic, you'd have to look at arsenic. You have to look at the mercurials. You have to look at the calcium arsenate, lead arsenate sprays that were put on trees. But what you're talking about in particular, they would call the cow disease. They'd go out in the family when you would.
Go to the house. They'd say, all the kids have the cow disease, what the cows had before. Well, what were they doing? They would have these trenches. You talk to farmers, even today. Oh, yeah, we had trenches. We would just walk them straight through, and I'd be soaked with this stuff by the end of the day.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
Yeah. So they're basically soaking and bathing in arsenic, which is great for killing fleas and ticks. But it's not really great for keeping your nervous system happy because the fact of the matter is, and this again, I've got medical references, everything. I can't get away with making stuff up. OK, I have to put a reference for everything.
A lot of those old remedies that we wrote about, the magic in them probably was the vitamin C in them.
cle cle disput disput cle cle cleacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketketketketacacket disputacacketket familiacacketket familiacacketketket familiacacketketket disput disputosketketket cleosketketacac familiketketket disputacketketket cleosketketketacacacac disputketketketketket cleosketketketacacacacacketketket disputacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacosacac disputacososket
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Where my brain was locked down and I was told what to do and how to do it and then watching the results. It would be one thing if the results were good, okay? But the results aren't good. Like we treat symptoms. We treat hypertension. Hypertension is a symptom. It's not a disease.
But arsenic causes the exact same spinal pathology that and fevers and everything. It literally mimics what they were calling polio and a polio virus back in the day.
That's exactly right. So polio virus is what we call a commensal, just like you have staph on your skin and strep on your skin, and it actually serves a purpose. It keeps other microbes in check as long as you don't get a cut. and have not a good immune system to deal from the inside out.
Hypertension can come from lots of different things. That's just one case in point. I really love being able to now have the freedom to look at the full human being and their physiology and look at them as an electromagnetic entity that has some chemicals and vitamins and help them direct their body back towards the blueprint that it was designed upon.
So polio, the reason I can say that polio is a commensal is because, again, there are medical studies that showed that people who dared to get on the edge of some of these wild native tribes down in South America or elsewhere, but in particular I'm talking about a South American tribe called the Javante Indians.
And that's, to me, what real healing and real medicine is about. It's not about being anti-antibiotic, anti-this, anti-that. It's like, how about pro-life? How about we get your You know, you're going out working every day. That's great because you know why? You're getting your blood and your lymph flowing and you're sweating. You sweat. You know, aluminum comes out in your sweat.
Toxic metals come out in your sweat. You create salt levels in your blood that stimulates your skin immune system, which is a separate entity. Like, I didn't know any of this when I was a conventionally practicing doctor. To even say, like, I wanted to detoxify mercury out of my patients in order to lower their blood pressure. And I was told that that was not allowed. We're not...
Like, well, then I don't want to do this anymore because I know from a hair mineral analysis and from a chelation test that that person is burdened with aluminum and mercury. And I know that those both of those things can raise blood pressure. So why wouldn't we want to remove that? The same reason we're not allowed to say vaccines.
You know what a multibillion dollar industry blood pressure treatment is and cholesterol treatment is?
Forget about it. But, yeah, I mean, I saw malignant hypertension happen after a tetanus shot in an adult patient of mine. And so that was another one, you know, thing that woke me up. And I was like, well, gosh, that's weird. And then you look up, you see there's other case reports. And then you're told, well, case reports don't mean anything. You need randomized controlled studies. Yeah.
So it's like there's frustration at every corner. But I love doing what I do now. And I love I love the fact. Look, it was all it's all great. Like I wouldn't change anything in my life. Just put it that way. And I'm really glad I have the background of conventional medicine. But that's like background of conventional medicine is like year one and really learning about healing and life.
It's just it's the very basics. And doctors still need to keep learning. But most conventional doctors are mandated to keep learning, but they're told where they can read to get their credits every year. You can only get your credits from reading this and answering the questions like a good little doggy every year. which I still have to do.
But beyond that, when I have my own spare time, you know, like I've learned ozone therapy. I've learned how to use vitamin C. I've learned how to look at the body electromagnetically and use bioresonance.
And there's just so much stuff you can do that really helps people and keeps them out of a whole bunch of trouble that they would have gotten into if they went and took allergy medicines and got their tonsils out or kept on their blood pressure medications and let the inflammation go wild in their body and didn't know anything about how to dampen. Look, most disease comes from inflammation.
You know, cholesterol is trying to save you. It's not trying to kill you. The cholesterol is a response to inflammation. It's like your fever is trying to save your life. It's like everything in medicine is about dampening down the symptoms that are trying to save your life. You know? So it's like I look at it and I think, I can't believe I ever actually agreed upon that.
So the Indian Health Service got to the edge of it and bargained that they would get some stool and some blood from the tribes so that they could test it for polio. And what they found was 98 to 99 percent of every person they tested, and it was hundreds of people, had evidence of immunity to all three strains of polio. And they said to them, well, where are your crippled children?
And if that wasn't the case, we would have more medical freedom than we have, right?
Because we would have choices. We would have options. We wouldn't be told what we have to do to protect the public.
Pretty crazy, isn't it?
Cheers to you.
That's what the reports showed. And even today, apple cider vinegar, you know, it's had a big resurgence in terms of, you know, keeping your gut pH nice and low so that you can digest your food better, which has downstream effects to everything. But it's also a fermented product. You know, it's got a lot of benefits, not just that, but even on the skin.
It's like really great to put on chicken pox and probably smallpox as well. If I may, just direct people to dissolvingillusions.com because if you just go to Amazon, there's two different versions of the book. There's the original one that you read and then there's the 10th anniversary version that has 200 extra pages.
And we delineate early on what the new pages, what the new chapters are so you don't have to go read the old stuff if you don't want to.
It covers tuberculosis. It covers one of the chapters I really love. It's toxic medicine of the past, all the different crazy treatments that I was telling you about. And then I added a whole bunch of the whooping cough because more information came out after 2013. So we added that in. And then we published a second book, which is all full of doctor quotes from 200 years.
Because people say, why are you the only one? It's like, well, I'm actually not the only one. It's like back then, this was what was recorded from doctors and public health officials, which is probably 1% of what actually was said. And then we have hard to find vaccination tragedies, Royal Commission on Vaccination timeline.
Where's your short legs? Where are the people that died of respiratory failure? And they were like, we don't have any of that problem. So it was well known.
And then we have rare documents at the back that has like the Encyclopedia Britannica, where they hired a very highly decorated well-known, highly respected doctor to write a chapter on smallpox. And at the end, when he did what I did and basically looked at all the facts, he decimated the vaccine completely. So you can't really find that very easily anymore.
So this one is called The Companion Book to Dissolving Illusions. But you can see all the versions and we've been translated into eight languages. We're about to be translated into Chinese. But the best resource is dissolvingillusions.com, and it will show you what your options for purchase and where you can purchase the different books.
If you want an alternative press, we have an alternative press for those people that don't want to do Amazon. And all the different languages and the different versions are on there.
Thank you for what you're doing.
This is in nature. don't become more problematic as they go through the human system. They become less problematic. Remember the whole COVID thing. In the beginning, people were getting super, super sick. It wasn't as contagious, but it was more virulent. And as it attenuated into the human bodies, it kind of fizzled out a bit.
And then we got the Omicron, which was more spreadable, but it was much less pathological. And that's the natural process that happens. So When you're going to have real problems with microbes, they're usually going to be reverse attenuated, meaning made more lethal in a lab. And then they're introduced into the population. And look, I'm not making this up either.